Application of circular RNA circTrpc6

Abstract

According to the application of the circular RNA circTrpc6 provided by the invention, experiments prove that the circTrpc6 is interfered, so that the cognitive function of SAMP8 can be improved, the hippocampal A beta expression and tau protein phosphorylation of SAMP8 mice can be obviously inhibited, the percentage of hippocampal neurons nissl bodies of the SAMP8 mice can be obviously reduced, and neuron damage can be alleviated; the number of hippocampal neuron branches, dendritic spine density and branch length of SAMP8 mice are obviously increased, and the shape plasticity of hippocampal synapses is improved. The results show that the circTrpc6 has potential treatment and prevention effects on tauopathy, dementia, AD (Alzheimer's disease) or other neurodegenerative diseases. Therefore, the circular RNA circTrpc6 can be used as a target spot for preparing the medicine for treating or preventing the neurodegenerative diseases.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a new circular RNA circTrpc6, and its application in preparing drugs for treating or preventing neurodegenerative diseases. Background Art

[0002] Aging is a major risk factor for neurodegenerative diseases, including various dementias. Amyloid β (Aβ), as the main component of senile plaques (SP), plays an important role in the pathogenesis of neurodegenerative diseases, including Alzheimer's disease (AD). Circular RNAs (circRNAs) are a new type of non-coding RNA (ncRNAs) molecules composed of special circular structures. Circular RNAs are highly conserved and tissue-specific. Studies have found that circular RNAs are expressed in large quantities in the brain and are associated with neurodegenerative diseases such as AD. For example, circRNA ciRS-7 can sponge miR-7, thereby reducing the expression of the ubiquitin carboxyl-terminal hydrolase L1 (UCHL1) gene, leading to the degradation of APP and β-secretase, suggesting that ciRS-7 may be involved in the pathophysiological process of AD. In addition, Zhang et al. used the SAMP8 mouse model to find that the ceRNA network associated with circRNA was associated with Aβ clearance (Hmgb2) and myelin function (Dio2). These studies indicate that circular RNAs may be involved in the pathogenesis of neurodegeneration such as AD. However, the role of circRNAs in these diseases remains unclear.

[0003] SAMP8 is a mouse model associated with rapid aging, which shows age-related spontaneous neurodegenerative changes, including abnormal Aβ production and clearance in brain regions, tau protein hyperphosphorylation, impaired synaptic plasticity and neuronal apoptosis. Therefore, this mouse is considered an important model for studying neurodegenerative diseases including AD. Summary of the invention

[0004] The purpose of the present invention is to provide, based on the prior art, an application of a circular RNA circTrpc6 in the preparation of a drug for treating or preventing neurodegenerative diseases.

[0005] The second object of the present invention is to provide an application of circular RNA circTrpc6 in the preparation of a drug for treating or preventing dementia.

[0006] The third object of the present invention is to provide a use of circular RNA circTrpc6 in the preparation of a drug for treating or preventing Alzheimer's disease.

[0007] The fourth object of the present invention is to provide a use of circular RNA circTrpc6 in the preparation of a drug for treating or preventing neuronal damage or cognitive damage in the nervous system.

[0008] The fifth object of the present invention is to provide an application of circular RNA circTrpc6 in the preparation of drugs for inhibiting the production of amyloid β protein (Aβ) and tau protein phosphorylation.

[0009] The sixth object of the present invention is to provide an application of circular RNA circTrpc6 in the preparation of a drug for improving the plasticity of neuronal synaptic structure.

[0010] The seventh object of the present invention is to provide a pharmaceutical composition containing circular RNA circTrpc6, which has the above-mentioned circular RNA circTrpc6 interfering AAV virus as an active ingredient or a main active ingredient, and is supplemented with a pharmaceutically acceptable carrier.

[0011] The technical solution of the present invention is as follows:

[0012] The use of circular RNA circTrpc6 in the preparation of a drug for treating or preventing Alzheimer's disease, wherein the sequence of circular RNA circTrpc6 is shown in SEQ ID NO.1, and is specifically as follows:

[0013] TTTGTGGCTC ATCCAAACTG TCAGCAACAG CTCCTGTCCA TATGGTATGA GAACCTCTCTGGTTTACGGC AGCAGACCAT GGCAGTGAAG TTCCTCGTGG TCCTTGCTGT TGCCATTGGA TTGCCCTTCCTGGCTCTCAT ATACTGGTGT GCTCCTTGCA GCAAGATGGG GAAGATATTG CGAGGACCGT TCATGAAGTTTGTAGCACAC GCAGCCTCCT TCACCATTTT CCTGGGGCTG CTCGTCATGA ATGCAGCTGA CAGATTTGAAGGCACCAAGC TCCTCCCTAATGAAACCAGC ACAGATAATG CAAGGCAGCT GTTCAGGATG AAAACATCCTGTTTCTCATG GATGGAGATG CTCATTATAT CCTGGGTAAT AGGCATGATATGGGCTGAAT GTAAAGAAATCTGGACTCAAGGCCCCAAAG AATACTTATT TGAGTTGTGG AATATGCTTG ACTTTGGAAT GCTGGCAATCTTTGCAGCAT CATTCATTGC AAGATTTATG GCGTTCTGGC ATGCATCCAA AGCTCAGAGC ATCATTGATGCAAATGATAC TTTAAAGGAT TTGACAAAAG TCACACTGGG GGACAACGTT AAATACTACAATCTGGCCAGGATAAAGTGG GACCCTACTG ATCCTCAGAT CATCTCTGAAGGTCTTTATG CAATCGCTGT GGTTTTAAGTTTCTCCAGAA TAGCTTACAT TTTACCAGCA AATGAAAGCT TTGGACCTCT GCAGATTTCA CTTGGAAGAACAGTGAAAGA TATCTTCAAATTCATGGTCA TATTCATCAT GGTGTTTGTA GCCTTTATGA TTGGAATGTTCAACCTTTAC TCCTACTACA TTGGCGCAAA ACAGAATGAA GCATTCACAACAGTTGAGGA AAGTTTTAAGACACTGTTCT GGGCTATCTTTGGTCTTTCT GAAGTGAAGT CAGTGGTCAT TAACTACAAT CACAAGTTCATTGAAAACAT CGGCTACGTT CTGTATGGTG TCTATAATGT CACAATGGTC ATTGTTTTGC TAAATATGTTAATTGCGATG ATCAATAGTT CATTCCAGGA AATTGAGGAT GATGCGGACG TGGAGTGGAA GTTTGCAAGGGCCAAATTGT GGTTTTCCTA CTTTGAGGAG GGGAGAACAC TTCCTGTCCC CTTCAATCTT GTACCAAGTCCAAAATCCTT GCTTTATCTC CTATTGAAAT TTAAGAAATG GATGTGTGAG CTCATCCAGG GTCAAAAGCAAGGCTTCCAA GAAGATGCAG AGATGAACAA GAGAAATGAA

[0014] GAAAAGAAAT TTGGAATTTC AGGAAGTCAC GAAGACCTTT CAAAATTTTC ACTTGACAAAAATCAG.

[0015] When circular RNA circTrpc6 is used in the preparation of drugs for treating or preventing Alzheimer's disease, the drugs can be made into solid preparations or liquid preparations. Furthermore, based on the technical solution provided by the present invention, the drugs can be made into injections, oral liquids, granules, powders, tablets or capsules. Pharmaceutically acceptable excipients play a key role in the development of the entire formulation technology. Excipients account for a large part of many preparations, and thus the properties of the excipients determine the properties of the preparations to a large extent. Excellent excipients can enhance the stability of the main drug and extend the shelf life of the drug; they can regulate the release rate of the main drug in vivo and in vitro; they can change the absorption of the drug in the body and increase the bioavailability, and there is no limitation on the specific type of excipients.

[0016] In a preferred embodiment, the circular RNA circTrpc6 uses a virus or a plasmid as a vector, wherein the plasmid is pHBAAV-CMV-EF1 or pHBAAV-U6-MCS-WPRE, and the virus is AAV9 virus.

[0017] The present invention provides the use of circular RNA circTrpc6 in preparing a drug for treating or preventing dementia.

[0018] The present invention provides the use of circular RNA circTrpc6 in preparing a drug for treating or preventing Alzheimer's disease.

[0019] The present invention provides the use of circular RNA circTrpc6 in preparing a drug for treating or preventing neuronal damage or cognitive damage in the nervous system.

[0020] The present invention provides the use of circular RNA circTrpc6 in preparing drugs for inhibiting the production of beta-amyloid protein and tau protein phosphorylation.

[0021] The present invention provides the use of circular RNA circTrpc6 in preparing a drug for improving the plasticity of neuronal synaptic structure.

[0022] The circular RNA circTrpc6 of the present invention can be used to prepare drugs for inhibiting Aβ production and tau protein phosphorylation, and can also be used for drugs for treating neurodegenerative diseases, especially drugs for Alzheimer's disease.

[0023] In the present invention, it was found that the expression of circRNA-Trpc6 in the hippocampus of 3- and 6-month-old rapidly aging mice (Senescence-accelerated mouse-prone 8, SAMP8) was significantly increased compared with the control mice of the same age (Senescence-accelerated mouse-resistant 1, SAMR1). The results of the Morris water maze (MWM) experiment showed that interference with circTrpc6 could significantly increase the number of quadrants where the platform of SAMP8 mice was located and the number of platform times, and prolong the quadrant time where the platform was located and the platform time. The light-dark box experiment showed that interference with circTrpc6 could significantly prolong the wall-dark latency of SAMP8 mice. The results of the new and old object experiment showed that interference with circTrpc6 could significantly increase the percentage of times that SAMP8 mice explored new objects, suggesting that interference with circTrpc6 could improve the cognitive ability of SAMP8 mice to new objects. The above research results show that interference with circTrpc6 can improve the cognitive function of SAMP8 mice. Immunofluorescence experiments showed that interference with circTrpc6 could significantly inhibit the expression of Aβ in the hippocampus of SAMP8 mice. Western blot experiments showed that interference with circTrpc6 could significantly inhibit tau phosphorylation in the hippocampus of SAMP8 mice. These results indicate that interference with circTrpc6 can inhibit Aβ production and tau phosphorylation in SAMP8 mice. Nissl staining results showed that interference with circTrpc6 could significantly reduce the percentage of Nissl bodies in hippocampal neurons of SAMP8 mice, indicating that interference with circTrpc6 could alleviate neuronal damage. Golgi assay results showed that interference with circTrpc6 could significantly increase the number of branches, dendritic spine density and branch length of hippocampal neurons in SAMP8 mice, indicating that interference with circTrpc6 could alleviate synaptic morphological plasticity damage in SAMP8 mice. The above results indicate that circTrpc6 has potential therapeutic and preventive effects on tauopathy, dementia, AD or other neurodegenerative diseases.

[0024] The present invention also provides a pharmaceutical composition containing circular RNA circTrpc6, characterized in that the pharmaceutical composition uses the above-mentioned circular RNA circTrpc6 interfering AAV virus as an active ingredient or a main active ingredient, and is supplemented with a pharmaceutically acceptable carrier. The pharmaceutical composition can be a solid preparation or a liquid preparation, especially an injection, an oral liquid, a granule, a powder, a tablet or a capsule. Pharmaceutically acceptable excipients play a key role in the development of the entire formulation technology. Excipients account for a large part of many preparations, and thus the properties of the excipients determine the properties of the preparation to a large extent. Excellent excipients can enhance the stability of the main drug and extend the shelf life of the drug; they can regulate the release rate of the main drug in vivo and in vitro; they can change the absorption of the drug in vivo and increase the bioavailability, and the specific type of excipients is not limited.

[0025] Adopt the technical scheme of the present invention, the advantages are as follows:

[0026] The present invention confirms that interfering with circTrpc6 can improve SAMP8 cognitive function, significantly inhibit Aβ expression and tau protein phosphorylation in the hippocampus of SAMP8 mice, significantly reduce the percentage of Nissl bodies in hippocampal neurons of SAMP8 mice, significantly reduce neuronal damage, significantly increase the number of branches, dendritic spine density and branch length of hippocampal neurons in SAMP8 mice, and reduce neuronal damage in SAMP8 mice. The above results show that circTrpc6 has potential therapeutic and preventive effects on tau protein disease, dementia, AD or other neurodegenerative diseases. Therefore, circular RNA circTrpc6 can be used as a target for the preparation of drugs for treating or preventing neurodegenerative diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The expression of circular RNA circTrpc6 in the hippocampus of AD model mice SAMP8 at different ages and its effect on behavior;

[0028] in, Figure 1 A is the RT-PCR experiment to detect the expression of circTrpc6 in 3-month-old SAMP8 and SAMR1 of the same-age control mice; Figure 1 B is the RT-PCR experiment to detect the expression of circTrpc6 in 6-month-old SAMP8 and SAMR1 of the same-age control mice; Figure 1 C: The circular structure of circTrpc6 was detected by RNAse digestion experiment; Figure 1 D is a RT-PCR experiment to detect the expression of circTrpc6 after the hippocampus of SAMP8 mice was injected with circTrpc6 interference (shcircTrpc6) AAV; Figure 1E-1H are water-shaking experiments used to detect the effects of circTrpc6 interference on the learning and memory abilities of SAMP8 mice; Figure 1 E is the quadrant number; Figure 1 F is the quadrant time; Figure 1 G is the number of platforms; Figure 1 H is the platform time; Figure 1 I is a light-dark box experiment to detect the effect of circTrpc6 interference on the memory ability of SAMP8 mice; Figure 1 J is a new and old object recognition experiment to detect the effect of circTrpc6 interference on the learning and memory ability of SAMP8 mice.

[0029] Figure 2 The effect of circular RNA circTrpc6 on Aβ expression, tau protein phosphorylation, hippocampal neuron damage and neuronal synaptic structural plasticity;

[0030] in, Figure 2 A is an immunofluorescence experiment to detect the effect of circTrpc6 interference on Aβ expression in the hippocampus of SAMP8 mice; Figure 2 B is a Western blot experiment to detect the effect of circTrpc6 interference on the expression of tau and phosphorylated tau proteins in the hippocampus of SAMP8 mice; Figure 2 C is the Golgi experiment to detect the effect of circTrpc6 interference on the synaptic length and branch number of hippocampal neurons in SAMP8 mice; Figure 2 D is the Nissl staining experiment to detect the effect of circTrpc6 interference on Nissl bodies in hippocampal neurons of SAMP8 mice. DETAILED DESCRIPTION

[0031] The present invention can be better understood according to the following examples. However, it is easy for those skilled in the art to understand that the contents described in the examples are only used to illustrate the present invention, and should not and will not limit the present invention described in detail in the claims.

[0032] Example 1

[0033] Example 1: Expression of circular RNA circTrpc6 in the hippocampus of SAMP8 mice at different ages

[0034] Experimental methods:

[0035] 1. RT-PCR experiment:

[0036] (1) Total RNA extraction from tissue samples:

[0037] 1) Experimental preparation: Wash the glass handheld homogenizer, soak it in acid and then rinse it with water 15 times, and sterilize it in the autoclave together with surgical scissors and forceps. Pre-cool chloroform, isopropanol and 75% ethanol in a refrigerator at 4°C; prepare nuclease-free consumables.

[0038] 2) Weigh the mouse, prepare a 1.5mL centrifuge tube and mark it, remove the mouse's eyeball and collect blood for later use. When the mouse bleeds to death, cut off its head with surgical scissors, peel it on ice, remove the hippocampus, put it in a 1.5mL centrifuge tube, and store it on ice. After the experiment, move the tissue to -80℃ for storage. Take out part of the hippocampus and put it in a small handheld homogenizer, add 800μL Triozl lysis solution, and place the homogenizer on ice. Rotate the homogenizer up and down until the tissue is completely broken, and then pour the Triozl lysis solution into a 2mL nuclease-free centrifuge tube.

[0039] 3) Add chloroform to the above EP tubes one by one at a ratio of 200 μL chloroform / 1 mL Trizol, close the lid, shake the EP tube vigorously up and down for 15 seconds, and let it stand at room temperature for 10 minutes. Prepare a set of 1.5 mL EP tubes without nuclease and mark them.

[0040] 4) Place the EP tube in a low-temperature centrifuge and centrifuge at 12000rpm and 4℃ for 15min. After centrifugation, gently remove the sample. The liquid is now divided into three layers, with RNA being the top aqueous phase, about 400μL. Use a 200μL pipette to draw the upper aqueous phase into another marked centrifuge tube three times, and be sure not to draw the lower layer components.

[0041] 5) Add an equal volume of isopropanol to the above EP tube, close the lid, turn it upside down and gently mix, and let it stand at room temperature for 10 minutes to allow the RNA to fully precipitate.

[0042] 6) Place in a low-temperature centrifuge and centrifuge at 12000rpm and 4℃ for 10min. After centrifugation, slowly pour out the supernatant. The white precipitate at the bottom is the RNA precipitate.

[0043] 7) Add 1 mL of pre-cooled 75% ethanol to the EP tube, use a vortexer to shake until the precipitate floats, and wash the organic phase in the precipitate; place it in a centrifuge, centrifuge at 4°C, 12000 rpm for 10 min, and gently pour off the supernatant.

[0044] 8) Place the EP tube upside down on the table and dry it at room temperature for about 10 minutes until the 75% ethanol is almost completely evaporated.

[0045] 9) Add an appropriate amount (20-50 μL) of nuclease-free water to dissolve the RNA precipitate. Mix by pipetting or gently shake to completely dissolve the precipitate.

[0046] 10) Determine RNA concentration using Nano Drop 1000 Nucleic Acid Analyzer. Wash the injection hole with nuclease-free water before formal measurement. When measuring, measure each sample twice and take the average value. Pay attention to the value of N260 / N280, which should be between 1.8-2.0. Record the RNA concentration of the sample. Store the total RNA sample at -80℃ for later use.

[0047] (2) mRNA reverse transcription: prepare a 200μL nuclease-free EP tube and mark it. Calculate the volume of 1μg RNA based on the RNA concentration, take out the RNA and place it in an EP tube, add nuclease-free water to make the total volume 8μL, add 2μL reverse transcription reagent to each sample, a total of 10μL system of the three, gently vortex to mix and centrifuge, place in a PCR machine, set the program to 25℃, 5min, 42℃, 15min, 85℃, 5s, 12℃, 10min denaturation, and immediately put on ice after denaturation is completed. Store the obtained cDNA at -20℃.

[0048] (3) RT-PCR: The upstream and downstream primer sequences were designed and synthesized by Shanghai Sangon Biotechnology Co., Ltd. Take the primers out of the refrigerator, centrifuge them, and add an appropriate amount of nuclease-free water according to the instructions. Dilute the concentration to 10mM and then divide them into aliquots and store them at -20℃ for future use. The PCR reaction system and primer sequences are shown in the table below. Two replicate wells are set for each sample, and β-actin is used as an internal reference.

[0049] Table 1 PCR reaction system

[0050]

[0051] Table 2 RT-PCR primer sequences

[0052]

[0053] (4) Use LC480Ⅱ real-time fluorescence quantitative PCR instrument for PCR amplification. After adding the sample, seal the PCR-96-well plate with a sealing film, centrifuge at 2000rpm for 5min, and place the plate in the LC480 PCR instrument. Set the computer PCR program as follows: Program 1: Activation: 95℃, 10min; Program 2: PCR: 95℃, 15s; 60℃, 30s, 50cycles; Program 3: Meltingcurves: 95℃, 15s; 60℃, 60s; 95℃; Continuous; Program 4: Cooling: 40℃, 30s. After the reaction is completed, save the experiment, calculate the sample CP value, and export the data using PDF.

[0054] (5) Adopt 2 -△△ct The expression of circRNA in each sample was analyzed.

[0055] 2. RNase enzyme digestion experiment:

[0056] Refer to the instructions of the kit (Guangzhou Jisai Biotechnology Co., Ltd.) for details. The details are as follows: the cultured N2a cells were collected and digested, and total RNA was extracted. The RNase enzyme was digested at 37°C for 30 minutes according to the system in Table 3. After digestion, RT-PCR experiment was used to detect the expression of circTrpc6.

[0057] Table 3 RNase enzyme digestion system

[0058]

[0059] Experimental results: RT-PCR results showed that the expression of circRNA-Trpc6 in the hippocampus of 3- and 6-month-old SAMP8 mice was significantly increased compared with the same-age control mice SAMR1. Figure 1 A and 1B). The RNase digestion experiment was used to detect the circular structure of circTrpc6, and the results showed that circTrpc6 was more resistant to RNase than linear GAPDH ( Figure 1 C), suggesting that circTrpc6 has a ring structure.

[0060] Example 2. Effects of circular RNA circTrpc6 on cognitive function of SAMP8 and SAMR1 mice

[0061] Experimental methods:

[0062] 1. Construction of circTrpc6-interfered AAV9 virus: pHBAAV-U6-MCS-WPRE plasmid vector containing shcircTrpc6 was purchased from Hanheng Biotechnology Co., Ltd. The plasmid was transfected into 293T cells. After 72 hours, the cell supernatant was collected and the virus was purified using a heparin-agarose column. After purification and concentration, the virus particles were divided into virus tubes and stored in liquid nitrogen for later use.

[0063] 2. Hippocampal localization injection of circTrpc6 to interfere with AAV9 virus: After the mice were anesthetized with chloral hydrate, they were fixed on a brain stereotaxic instrument. The injection coordinates were: 1.7mm behind the anterior fontanelle, 2.5mm lateral, and 2.25mm deep. AAV particles were slowly injected at a rate of 0.1μL / min, and the needle was retained for 20min to allow the solution to diffuse fully. After the hippocampal localization injection, the wound was sutured, iodine and gel were applied to the wound, and 5% carprofen injection was injected intraperitoneally every other day at a volume of 0.2mL / 10g for anti-inflammatory analgesia. At the same time, 0.2 million units / day of penicillin was injected intraperitoneally for antibacterial, once a day, for a total of 5 days.

[0064] 3. Morris water maze:

[0065] (1) Adaptive training: Add water to the water maze and set the water temperature to 21°C. Set up the ANYmaze behavioral analysis system, divide the water maze into four quadrants, name them SW, SE, NE, and NW in a clockwise direction, set the animal color, and the total experimental time is 60 seconds; the software records parameters including the average swimming speed of the mouse, the swimming distance, the stay time in each quadrant, the average distance from the platform, the time required to first board the platform (escape latency), the swimming trajectory, etc.; place the platform and make the water surface slightly higher than the platform by one knuckle height. During the experiment, try to keep the room quiet and dark to avoid external factors interfering with the mice. One day before the experiment, all mice were given adaptive training to screen out drowned mice or weak mice with slow swimming speed.

[0066] (2) Positioning and navigation experiment: All experimental mice were placed into the water from the four quadrants one by one, with their heads facing the wall of the water maze. At the same time, ANYmaze software was started to record and track the swimming trajectory of the mice. For mice that failed to climb onto the platform within 60 seconds, a wooden stick was used to guide them to slowly climb onto the platform and stay there for 10 seconds. For mice that found the platform within 60 seconds, the mouse was recorded and allowed to stay on the platform for 10 seconds. After the end, the mouse was wiped dry with a dry cloth. All mice were placed into the water in a uniform quadrant order and position, and the training lasted for 5 consecutive days.

[0067] (3) Spatial exploration experiment: On the sixth day of the experiment, the platform was removed and the mice were placed in the water from the diagonal quadrant of the platform. The mice were tested for their ability to remember the location of the platform by recording the time and number of times they spent in the quadrant where the platform was located. The effects of different treatment groups on the mice's memory and learning cognitive abilities were evaluated.

[0068] 4. Light-dark box experiment: On the first day of the experiment, mice were placed alone in the light box to adapt for 5 minutes, and then the dark box channel was opened to allow mice to enter the dark box, which was continuously powered for 5 minutes (voltage: 36V). 24 hours after training, mice were placed in the light box, and the time when the mice entered the dark box (dark avoidance latency) was recorded. If the mice did not enter the dark box within 5 minutes, the dark avoidance latency of the mice was recorded as 300 seconds. The longer the dark avoidance latency of the mice, the stronger their learning and memory ability.

[0069] 5. New object recognition experiment:

[0070] Adaptive training: Three days before the formal experiment, place a 50 cm square opaque black glass open box in a quiet laboratory, called an open field. Place the mice in the open field for 20 minutes every day to adapt to the environment. Prepare multiple objects of uniform size, different shapes, and the same color.

[0071] Formal experiment: On the first day, two objects of the same shape, size and color were placed in the open field and marked as old objects. Each mouse was then placed in the open field for 10 minutes, and the time the mouse spent exploring the two objects was observed and recorded. After each mouse finished the experiment, the open field and objects were wiped with 75% ethanol to prevent the influence of odor on the experiment. On the second day, one of the old objects was replaced with another object of the same color and size but different shape, marked as a new object. The new and old objects were placed in the open field, and mice were placed at the same time. Each mouse was observed for 10 minutes, and the time the mouse spent exploring the new and old objects was recorded. The results were expressed as the distinguishing index (DI). The calculation formula for the distinguishing index is: DI = N / (N+F) 100%, where N is the number of times used to explore the new object, and F is the number of times used to explore the old object.

[0072] Experimental results:

[0073] 1. Morris water maze test results

[0074] The pHBAAV-U6-MCS-WPRE plasmid vector was used to construct the circTrpc6 interference AAV9 virus, which was then injected into the hippocampus of SAMP8 mice. Six weeks later, RT-PCR was used to detect the expression of circTrpc6. Figure 1 As shown in D, compared with the blank virus group, the expression of circTrpc6 in the hippocampus of mice in the circTrpc6 interference group was significantly reduced, indicating that the AAV virus infection effect was better.

[0075] The results of Morris water maze showed that compared with the blank virus group, interference with circTrpc6 significantly increased the number of quadrant entries and platform entries of SAMP8 mice, and prolonged the quadrant time and platform time of the platform, which suggested that circTrpc6 interference could improve the spatial memory ability of SAMP8 mice. Figure 1 E~1H).

[0076] 2. Results of the light and dark box experiment

[0077] .Depend on Figure 1 As shown in I, compared with the blank virus group, the step-through latency of SAMP8 mice in the circTrpc6 interference group was significantly prolonged, indicating that circTrpc6 interference can significantly improve the memory ability of SAMP8 mice.

[0078] 3. Experimental results of new object recognition

[0079] Depend on Figure 1 As shown in Figure J, compared with the corresponding blank virus group, interference with circTrpc6 can significantly increase the percentage of exploration entries of new objects in SAMP8 mice, suggesting that interference with circTrpc6 can improve the cognitive ability of SAMP8 mice to new objects.

[0080] In summary, the above experiments show that interfering with circTrpc6 can improve the cognitive function of SAMP8 mice.

[0081] Example 3. Effects of circular RNA circTrpc6 on Aβ production and tau protein phosphorylation

[0082] Experimental methods:

[0083] 1. Western blot experiment:

[0084] (1) Leak detection: After thoroughly cleaning the rubber sheet, assemble it onto the rubber rack. Use a spray bottle to fill the rubber sheet with double distilled water. After 10 minutes, observe whether the rubber sheet is leaking. After confirming that there is no leakage, pour out the water and turn the rubber rack upside down to dry.

[0085] (2) Glue preparation: Prepare the lower layer of glue in a clean small beaker according to the ratio in Table 4. After adding the reagents, stir and mix quickly. Use a pipette to slowly add the mixture to the glue plate to avoid adding bubbles. Be careful not to fill it up. The liquid level should be 4 cm below the small plate. In order to flatten the lower layer of glue, gently add double distilled water until it is full. Wash the comb and dry it. After 35 minutes, the lower layer of glue solidifies and the upper layer of double distilled water is discarded. Prepare the upper layer of glue and add it to the glue plate, insert the comb. Let it stand for 30 minutes to solidify.

[0086] (3) Sample loading: Remove the comb, place the gel plate into the electrophoresis tank, fill the tank with 1× electrophoresis solution, and use a 10 μL pipette to add protein sample according to the sample volume for protein quantification.

[0087] (4) Electrophoresis: After loading, add electrophoresis solution to the outer tank and plug in the power supply according to the positive and negative poles. Set the electrophoresis program: Program 1: 60V, 30min; Program 2: 110V, 100min.

[0088] (5) Semi-dry transfer: Prepare the NC membrane and thick filter paper in advance and soak them in semi-dry transfer solution for 5 minutes. Place the moistened thick filter paper in the center of the semi-dry transfer instrument, and then place the NC membrane on the thick filter paper. After the electrophoresis is completed, cut the gel of the target protein according to the position of the marker based on the protein molecular weight, and transfer it to the NC membrane in parallel. During the process, add semi-dry transfer solution to prevent the NC membrane from drying, and carefully remove the bubbles between the NC membrane and the gel. Press another thick filter paper on the gel and cover the lid of the semi-dry transfer instrument. Turn on the power, set the constant voltage to 15V, and transfer for 35 minutes.

[0089] (6) Blocking: After the transfer is completed, remove the NC membrane with tweezers, wash it three times with TBST on a shaker, and then place it in the blocking solution and block it on a shaker for 1 hour.

[0090] (7) Primary antibody incubation: Dilute with primary antibody diluent according to the ratio in the primary antibody instructions, mix well and place in the incubation box, then place the NC membrane and incubate overnight at 4°C. Be careful to avoid bubbles on the membrane.

[0091] (8) Secondary antibody incubation: After overnight at 4°C, remove the NC membrane and rewarm it for 30 minutes. Wash it three times with TBST on a shaker, shaking rapidly for 5 minutes each time. Dilute the secondary antibody at a ratio of 1:10,000, place the secondary antibody and NC membrane in the secondary antibody incubation box, and incubate it on a shaker for 1 hour. Then wash it three times with TBST, shaking rapidly for 5 minutes each time. Note that it should be kept away from light during and after the use of the secondary antibody.

[0092] (9) Color development: The NC membrane was sandwiched between filter paper and blotted dry, scanned with an EPSON scanner, and the image was saved. The protein bands were analyzed by grayscale analysis using Image J software, with GAPDH as the internal reference.

[0093] Table 4 Polyacrylamide separation gel and concentration gel formula

[0094]

[0095]

[0096] 2. Immunofluorescence experiment

[0097] 2.1 Preparation of paraffin sections

[0098] (1) Paraformaldehyde fixation After the animal is deeply anesthetized, the abdomen is dissected, the heart is exposed, the right atrial appendage is cut open, and a venous puncture needle is inserted from the apex of the heart (left ventricle). Pre-cooled saline is injected until the liquid flowing out of the right atrial appendage is transparent and the organ turns white. After the blood in the body is drained, 150 mL of 4% paraformaldehyde is slowly injected until the mouse body is completely stiff. The brain is then dissected and immersed in 4% paraformaldehyde.

[0099] (2) Tissue dehydration and paraffin embedding. Repair the brain tissue to an appropriate size and use a tissue program dehydrator to dehydrate according to the program: 75% ethanol for 1 hour, 85% ethanol for 1 hour, 95% ethanol for 1 hour, 95% ethanol for 1 hour, anhydrous ethanol for 1 hour, anhydrous ethanol for 1 hour, xylene I for 1 hour, xylene II for 1 hour, 65℃ paraffin I for 1 hour, 65℃ paraffin II for 1 hour, 65℃ paraffin III for 1 hour. After dehydration, fix the tissue in a paraffin embedding box and store the embedded tissue at 4℃.

[0100] (3) Paraffin sectioning: Fix the embedded paraffin tissue on the paraffin slicer, set the slice thickness to 4 μm, and set the water temperature of the slice bleaching machine to 40°C. Bleach the cut wax slices first, and after they are completely spread out, use a brush to gently push the tissue onto the slide, spread the slices at 37°C for 2 hours until the water on the slide is completely dry, place the slices at 60°C for 4 hours, and finally bake the slices at 37°C overnight.

[0101] (4) Conventional dewaxing and hydration: soak in xylene I for 5 min; soak in xylene II for 5 min; soak in anhydrous ethanol for 3 min; soak in 90% ethanol for 3 min; soak in 80% alcohol for 3 min; after dewaxing and hydration, rinse with PBS 3 times, 5 min each time.

[0102] 2.2 Immunofluorescence experiments

[0103] (1) Antigen repair of paraffin sections: After the routine dewaxing and hydration steps, perform antigen repair. Prepare 0.1M sodium citrate buffer and place the sections in the sodium citrate buffer for microwave repair. Heat at high temperature for 5 minutes, then heat at low temperature for 15 minutes. Take the sections out and let them cool naturally for 1 hour. Rinse with PBS 3 times, 5 minutes each time, and wipe off the excess liquid around.

[0104] (2) Block with 5-10% normal goat serum (diluted with PBS) at room temperature for 30 minutes, then pour off the solution without washing.

[0105] (3) Remove excess liquid, add primary antibody (1:200, diluted in blocking solution) 30 μL / slice, and place in a humidified box at 4°C overnight.

[0106] (4) The next day, remove the tube from 4°C and allow to warm to room temperature for 30 min. Rinse with PBS three times, 5 min each time, and wipe off excess liquid.

[0107] (5) Add fluorescent secondary antibody (1:300, diluted in PBS) and incubate at room temperature in the dark for 1 h.

[0108] (6) Protect from light, rinse with PBS three times, 5 min each time, and wipe off excess liquid.

[0109] (7) Rinse with PBS three times, 5 min each time, add DAPI staining solution, stain for 10 min at room temperature, and then rinse with PBS three times, 5 min each time.

[0110] (8) After sealing with an anti-fluorescence quencher, the slide was placed under a fluorescence microscope for observation, and the results were recorded and analyzed.

[0111] Experimental results: The results of immunofluorescence IF experiments showed that compared with the blank virus group, the average optical density and immunopositive area of ​​hippocampal Aβ in the SAMP8 mice in the circTrpc6 interference group were significantly reduced ( Figure 2 A), indicating that interference with circTrpc6 can inhibit the production of Aβ. The results of Western blot experiments showed that compared with the blank virus group, the expression of tau and phosphorylated tau proteins in the hippocampus of SAMP8 mice in the circTrpc6 interference group was significantly reduced ( Figure 2 B), indicating that interference with circTrpc6 can inhibit tau protein phosphorylation in SAMP8 mice.

[0112] Example 4 Effects of circular RNA circTrpc6 on hippocampal neuron damage and neuronal synaptic structural plasticity in SAMP8 mice

[0113] Experimental methods:

[0114] 1. Golgi experiment:

[0115] (1) Tissue preparation: The animal is deeply anesthetized before sampling, and the brain of the animal is quickly removed from the skull. Be very careful during the operation to avoid damaging or compressing the tissue. Use double distilled water to quickly clean the blood on the surface of the brain tissue, and place the brain tissue in a staining solution mixed with solution A and solution B that has been mixed 24 hours in advance. Each brain tissue requires at least 5 times the volume of AB mixed solution. After soaking for 24 hours, replace the AB mixed solution and soak for 14 consecutive days. Keep it away from light, and the AB liquid cannot come into contact with metal. After 14 days, replace it with 5 times the volume of solution C; replace solution C again after 24 hours, and soak it for 3 days to 1 week before it can be used for slicing.

[0116] (2) Sectioning and staining:

[0117] 1) Slicing: Fix the brain tissue on a vibrating slicer in the dark, adjust the appropriate amplitude and slicing speed to prevent the amplitude from being too large and the speed from being too fast, which may cause tissue fragmentation, or the speed from being too large and the amplitude from being too small, which may damage the tissue. Cut the brain tissue into 100 μm slices in PBS solution; collect the slices on a glass slide, add a small amount of solution C and soak for 5 minutes, then dry the solution C and use a paper towel to absorb the solution C on the brain tissue; finally, air-dry the slices in the dark and use them for staining. The sliced ​​slices can be stored at room temperature for up to 3 days.

[0118] 2) Staining: Wash the brain slices twice with double distilled water, 4 minutes each time; prepare the staining solution by mixing solution D, solution E, and double distilled water in a ratio of 1:1:2, gently dripping on the brain slices, and staining for 10 minutes; rinse the slices twice with double distilled water, 4 minutes each time, and replace with new double distilled water each time;

[0119] 3) Dehydration and transparency: Dehydrate the sections in 50%, 75% and 95% ethanol, with each concentration gradient dehydration for 4 minutes; then dehydrate the sections in anhydrous ethanol, 4 times, 4 minutes each time; transparentize in xylene, 3 times, 4 minutes each time, and finally quickly seal the sections with neutral resin sealing media. Be careful to avoid bubbles when aspirating the neutral resin sealing media.

[0120] 4) Data statistics: Image J software and Neuron J plug-in were used to process Golgi images of neurons, identify neuronal morphology and measure length. The number and length of secondary branches of neurons in the hippocampal neurons in the CA1 region of brain slice images were counted, and the differences in neurons among the groups were compared. Image J counting function was used to count the number and length of dendritic spines and to calculate the density of dendritic spines.

[0121] 2. Nissl staining experiment: TUNEL kit was purchased from Meilun Biotechnology Co., Ltd., and the specific method was carried out according to the instructions. Specifically as follows: After the tissue paraffin sections were made and dewaxed to water (the specific method was carried out according to the method in Example 3), an appropriate volume of Nissl staining solution was added to each section after dewaxing and hydration, and the sections were stained at 37°C in the dark for 1 hour. After the staining was completed, the sections were rinsed with running water, the surface moisture of the sections was dried, and the sections were sealed with neutral resin. The Nissl bodies were observed and photographed under an optical microscope, and the percentage of Nissl bodies was calculated by the following formula: Nissl body (%) = number of Nissl bodies per field of view / number of cells per field of view.

[0122] Experimental results:

[0123] The results of Golgi staining experiments showed that compared with the blank virus group, the synaptic length (Branch length) and branch number (Branch number) of the hippocampus of SAMP8 mice in the circTrpc6 interference group were significantly increased ( Figure 2 C), indicating that interference with circTrpc6 can inhibit synaptic damage in the hippocampus of SAMP8 mice. The results of Nissl staining experiments showed that compared with the blank virus group, the percentage of Nissl bodies in the hippocampus of SAMP8 mice in the circTrpc6 interference group was significantly increased ( Figure 2 D), indicating that interference with circTrpc6 can inhibit hippocampal neuronal damage in SAMP8 mice.

[0124] In summary, circTrpc6 has potential therapeutic and preventive effects on tauopathy, dementia, AD or other neurodegenerative diseases.

[0125] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, a person skilled in the art should understand that it is still possible to modify the technical solutions described in the aforementioned embodiments, or to perform equivalent replacements on some of the technical features therein. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of circular RNA circTrpc6 in the preparation of a drug for treating or preventing neurodegenerative diseases, characterized in that: The sequence of the circular RNA circTrpc6 is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The medicine is prepared into a liquid preparation or a solid preparation.

3. The use according to claim 2, characterized in that: The medicine is prepared into injection, oral liquid, granules, powder, tablets or capsules.

4. The use according to claim 1, characterized in that: The circular RNA circTrpc6 uses a virus or a plasmid as a vector, wherein the plasmid is pHBAAV-CMV-EF1 or pHBAAV-U6-MCS-WPRE, and the virus is AAV9 virus.

5. Use of circular RNA circTrpc6 in the preparation of a drug for treating or preventing dementia, characterized in that: The sequence of the circular RNA circTrpc6 is shown in SEQ ID NO.

1.

6. Use of circular RNA circTrpc6 in the preparation of a drug for treating or preventing Alzheimer's disease, characterized in that: The sequence of the circular RNA circTrpc6 is shown in SEQ ID NO.

1.

7. Use of circular RNA circTrpc6 in the preparation of a drug for treating or preventing neuronal damage or cognitive damage in the nervous system, characterized in that: The sequence of the circular RNA circTrpc6 is shown in SEQ ID NO.

1.

8. Use of circular RNA circTrpc6 in the preparation of a drug for inhibiting the production of amyloid β and the phosphorylation of tau protein, characterized in that: The sequence of the circular RNA circTrpc6 is shown in SEQ ID NO.

1.

9. Use of circular RNA circTrpc6 in the preparation of a drug for improving the plasticity of neuronal synaptic structure, characterized in that: The sequence of the circular RNA circTrpc6 is shown in SEQ ID NO.

1.

10. A pharmaceutical composition containing circular RNA circTrpc6, characterized in that: It uses the circular RNA circTrpc6 interfering AAV virus described in claim 1 as an active ingredient or a main active ingredient, and is supplemented with a pharmaceutically acceptable carrier.

Images