Nanomotor drug-loaded particles, preparation method, and application thereof

Through the design of DNA tetrahedral nanomotor drug-loaded particles, the problems of inaccurate drug delivery and poor photodynamic therapy effect in tumor treatment in existing technologies have been solved, efficient drug delivery and deep penetration in tumors have been achieved, the photodynamic therapy effect has been enhanced, and the drug dosage and adverse reactions have been reduced.

CN119454948BActive Publication Date: 2025-09-26NANJING UNIV OF POSTS & TELECOMM
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202411536872.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-31
Publication Date
2025-09-26
Estimated Expiration
2044-10-31

AI Technical Summary

Technical Problem

Existing chemically driven nanoplatforms for tumor treatment have problems such as complex structure and imperfect treatment mode, making it difficult to achieve accurate and efficient drug delivery, especially in photodynamic therapy within tumors, which lacks simple and versatile strategies.

Method used

DNA tetrahedral nanomotor drug-loaded particles are used to assemble into a DNA tetrahedral structure through base complementary pairing, which is loaded with platinum nanoparticles and methylene blue drugs. Methylene blue is loaded on the DNA tetrahedral structure by electrostatic interaction and connected through ssDNA-Pt complexes to form PM@TDN nanomotor particles for tumor photodynamic therapy.

Benefits of technology

It achieves precise drug loading and deep penetration into tumor cells, enhances the effect of photodynamic therapy, improves the efficiency of drug delivery in tumors, reduces drug dosage, reduces adverse reactions, and has high biocompatibility and safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119454948B_ABST
    Figure CN119454948B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of biomedicine technology and discloses a nanomotor drug-loaded particle and its preparation method and application. The nanomotor drug-loaded particle is formed by loading platinum nanoparticles and methylene blue drugs on a DNA tetrahedron structure. The nanomotor drug-loaded particle can enhance the uptake of the photosensitizer methylene blue (MB) by tumor cells while achieving deep penetration into tumors, thereby reducing the amount of drugs required for conventional systemic cancer treatment. The nanomotor drug-loaded particles are safer and have fewer adverse reactions. The nanomotor drug-loaded particles provided by the present invention have a reliable source, are simple to prepare, have high biocompatibility, specifically respond to photodynamic therapy, and effectively inhibit tumor cell growth.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a nanomotor drug-loaded particle and a preparation method and application thereof. Background Art

[0002] Nanomotors are devices that can generate autonomous propulsion by converting other sources into mechanical motion. They show great promise in sensing, environmental remediation, and even biomedicine. Recent advances in micro / nanobiology have made significant progress in minimally invasive surgery and active drug delivery, particularly for cancer treatment, thanks to their autonomous motion and tunable functionality. As an upgraded version of drug delivery platforms, various nanomotors, driven by light, heat, magnetic fields, ultrasound, chemical reactions, or living organisms, have been well developed for their self-propulsion and precise drug delivery, demonstrating significant advantages for cancer treatment. While chemically driven nanoplatforms offer revolutionary advancements in traditional treatment modalities, their complex structures and imperfect therapeutic modalities mean they remain in their infancy for in vivo tumor therapy, a long way from clinical application.

[0003] DNA nanostructures are highly programmable and controllable, easily modifiable, and exhibit excellent biocompatibility and biodegradability, attracting widespread attention in the biomedical field. Tetrahedral DNA nanostructures are a well-established self-assembled DNA structure, characterized by simple synthesis and high efficiency. As drug carriers, they can effectively deliver a variety of drugs, including small molecules, proteins, and antisense nucleotide sequences, demonstrating their potential in the field of drug delivery.

[0004] Photodynamic therapy (PDT) not only directly kills tumors through photothermal effects and cytotoxic reactive oxygen species (ROS) generated by photosensitizers (PS), but also may promote a domino effect of immune cells in the tumor microenvironment (TME) through various mechanisms. In particular, photodynamic therapy based on nanodrug delivery systems (NDDS) has significantly improved its tumor inhibitory effect. Photodynamic therapy has become a promising tumor treatment modality. Therefore, many nanoparticles (NPs), such as polylactic-co-glycolic acid, chitosan, graphene oxide and other nanomaterials, have been widely reported to specifically load and deliver PS to achieve multiple deliveries for the highest anti-tumor efficiency, which plays a key role in the construction and design of a new generation of NDDS to fight cancer. However, due to the complexity and malignant characteristics of tumors, the establishment of a simple and versatile photodynamic therapy strategy is still in its infancy. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a high-efficiency nanomotor drug-loaded particle that can accurately load drugs, and the nanomotor drug-loaded particle can be used to prepare tumor photodynamic therapy drugs.

[0006] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0007] In a first aspect, the present invention provides a nanomotor drug-loaded particle, namely a DNA tetrahedral nanomotor. The nanomotor drug-loaded particle is formed by loading platinum nanoparticles and methylene blue drugs onto a DNA tetrahedral structure. The DNA tetrahedral structure is assembled from four DNA single strands, each of which includes assembly chain blocks for assembling the tetrahedral main structure, which form a DNA double strand through base complementary pairing, and at least three DNA single strands contain arm chains. After the four DNA single strands are assembled, the arm chains extend out of the tetrahedral structure for connecting the ssDNA-Pt complex. The methylene blue (MB) drug is loaded onto the DNA tetrahedral structure by inserting between the DNA double strands. The insertion of the methylene blue (MB) drug between the DNA double strands is mainly through the electrostatic interaction of the MB cation to bind to the phosphate group of the DNA, and then accumulates on the surface of the DNA tetrahedral helix. The ssDNA-Pt complex is a complex formed by modifying platinum nanoparticles (PtNPs) with thiol DNA (ssDNA). The ssDNA-Pt complex is loaded onto the DNA tetrahedral structure through complementary pairing of ssDNA and the arm chains on the tetrahedral structure.

[0008] Furthermore, considering the size of the DNA tetrahedral structure, among the four DNA single strands used for drug delivery, one DNA single strand contains 112 deoxyribonucleotide monomers, and the other three contain 127 deoxyribonucleotide monomers, and the monomer size of the platinum nanoparticles (PtNPs) is 5 to 10 nm.

[0009] Furthermore, in order to maximize the carrier function of the nanoparticles, from the perspective of economy, the ratio of the amount of the DNA tetrahedral structure to the methylene blue is 1:1800, and the ratio of the amount of the DNA tetrahedral structure to the ssDNA-Pt complex is 1:6.

[0010] Preferably, the assembly chains used to assemble the tetrahedral structure are respectively denoted as S1, S2, S3, and S4, and the base sequences of the assembly chains are respectively as follows (5'→3'):

[0011] Assembly chain S1 is SEQ ID NO.1:

[0012] ACATTCCTAAGTCTGAAGAAGAGCCGCCATAGTACGTTCCCTAACCCTAAC

[0013] CCTAAAACTCTGCTCGACGGATTTTACGTAGTGTCGTTATCACCAGGCAGTT

[0014] GATTGCGCG

[0015] Assembly chain S2 is SEQ ID NO.2:

[0016] AAAAAAAAAAAAAAA GGTCCAATACGCACCTGAGACGCGTTACGCATGAC

[0017] GTTTTTCAACATCAGTCTGATAAGCTATTGTTAAGCTGATTCGCGCAATCAA

[0018] CTGCCTGGTGATAACGACACTACGT

[0019] Assembly chain S3 is SEQ ID NO.3:

[0020] AAAAAAAAAAAAAAA GCTTGCTACACCAACTAGAATGATCGGCTACAGAC

[0021] GTTCGTACTATGGCGGCTCTTCTTCAGACTTAGGAATGTTTTCAGCTTAACA

[0022] ATAGCTTATCAGACTGATGTTGAAA

[0023] Assembly chain S4 is SEQ ID NO.4:

[0024] AAAAAAAAAAAAAAA CGTCTGTAGCCGATCATTCTAGTTGGTGTAGCAAG

[0025] CTTCGTCATGCGTAACGCGTCTCAGGTGCGTATTGGACCTTAATCCGTCGAG

[0026] CAGAGTTTTAGGGTTAGGGTTAGGG

[0027] The ssDNA chain is SEQ ID NO.5: TTTTTTTTTTTTTTT

[0028] In a second aspect, the present invention also provides a preferred method for preparing the nanomotor drug-loaded particles PM@TDN described in the first aspect, such as Figure 1As shown, the preparation steps include: dissolving the above four DNA single strands in ultrapure water, and then mixing the four DNA single strands in a buffer solution at a molar ratio of 1:1:1:1; rapidly heating the mixed solution to 95°C to 100°C and maintaining it for at least 10 minutes, and rapidly annealing it to 2-4°C and maintaining it for 20-30 minutes to obtain a DNA tetrahedron solution; mixing the DNA tetrahedron solution with a methylene blue solution at a molar ratio of 1:1800, and shaking it at 300 rpm at room temperature overnight to obtain an MB@TDN solution; mixing the MB@TDN solution with an ssDNA-Pt complex at a molar ratio of 1:6, and annealing it at 45°C to 25°C for 12 hours to obtain PM@TDN particles.

[0029] Preferably, the preparation steps of the ssDNA-Pt complex include: chloroplatinic acid hexahydrate (H2PtCl 6· 6H2O) and polyvinylpyrrolidone (PVP) were added to ethylene glycol, heated to 180 ° C, maintained for 20 minutes, cooled to room temperature and dialyzed, and centrifuged at 6000g and an effective centrifugal radius of 5 cm for 20 minutes using a 10kDA ultrafiltration tube to concentrate Pt nanoparticles to 9-10mM; among them, chloroplatinic acid hexahydrate (H2PtCl 6· The raw material mass ratio of chloroplatinic acid hexahydrate and ethylene glycol is 203mg:888; the raw material mass volume ratio of chloroplatinic acid hexahydrate and ethylene glycol is 203mg:80ml; Pt nanoparticle concentrate and 100μM ssDNA solution are added to 5×TBE and shaken at 300rpm at room temperature for at least 12h; then, NaCl solution with a volume of 0.1 times, 0.2 times, 0.3 times, and 0.4 times that of the Pt nanoparticle concentrate is added to the solution every 30min, and shaken at 300rpm at room temperature overnight to obtain ssDNA-Pt; wherein, the volume ratio of Pt nanoparticle concentrate, ssDNA and 5×TBE is 1:1:5.

[0030] In a third aspect, the present invention further provides the use of nanomotor-loaded drug particles in the preparation of a drug for photodynamic therapy of tumors. The application comprises dissolving the nanomotor-loaded drug particles as an active ingredient in a buffer solution to prepare a liquid drug preparation, or directly using the nanomotor-loaded drug solution prepared in the second aspect as a liquid drug preparation. The liquid preparation can be enriched at the tumor site after intravenous injection and can be directly used to enhance the photodynamic therapy effect of the tumor.

[0031] Preferably, the concentration of the nanomotor drug-loaded particles in the liquid drug preparation is 1 μM; the buffer is 1×TM Buffer or 1×TAE Mg 2+buffer; further preferably, the composition of the 1×TM Buffer is 10mMTris-HCl, 50mM MgCl2, pH=8.0; or 1×TAE Mg 2+ The components of the buffer are 40mM Tris-acetate, 1mM EDTA, 12.5mM MgCl2, pH=8.0.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] 1. Compared with natural nanocarriers, such as the "Brucea javanica exosomes" disclosed in the patent document "Application of Brucea javanica Exosomes in the Preparation of Anti-Breast Cancer Drugs and Tumor Angiogenesis Inhibiting Drugs" with publication number CN 117582460A, firstly, the nanomotor drug-loaded particles PM@TDN constructed in the present invention are used as nanocarriers for tumor photodynamic therapy drugs. The nanomotor carriers constructed in the present invention are more stable in morphology and have controllable and clear morphological characteristics based on base complementary pairing. Their size is precisely controlled to ensure the effectiveness of the preparation of the nanomotor carriers themselves; secondly, due to the structural characteristics of the tetrahedron itself, the drug loading amount and ratio of methylene blue (MB) and platinum nanoparticles (Pt NPs) loaded on the DNA tetrahedron can be precisely controlled, which can be applied to different medication needs and accurately control the dosage;

[0034] 2. Compared with free methylene blue, the cellular uptake efficiency is low and the penetration effect on tumors is limited, resulting in poor subsequent photodynamic therapy effect; the nanomotor drug-loaded particles constructed by the present invention load methylene blue (MB) onto the DNA tetrahedral structure through the electrostatic adsorption effect, which can effectively enhance the phagocytic effect of tumor cells on drugs. The presence of high concentrations of hydrogen peroxide (H2O2) in the tumor microenvironment serves as the fuel of the nanomotor. The nanomotor drug-loaded particles catalyze the decomposition of hydrogen peroxide (H2O2) to produce oxygen, thereby generating a driving force to push the nanomotor drug-loaded particles deep into the tumor, while improving the tumor's hypoxic microenvironment and providing sufficient oxygen for photodynamic therapy. The nanomotor drug-loaded particle structure is easier to be taken up by tumor cells and can achieve deep penetration into the tumor, significantly improving the photodynamic therapy effect of tumors.

[0035] 3. The nanomotor drug-loaded particles provided by the present invention innovatively anchor platinum nanoparticles (Pt NPs) on the vertices of the DNA tetrahedral framework nucleic acid to prepare nanomotors. The synthesized nanomotor drug-loaded particles can enhance the uptake of the photosensitizer methylene blue (MB) by tumor cells while achieving deep penetration into tumors, which can reduce the amount of drugs required for conventional systemic cancer treatment. They are also safer and have fewer adverse reactions.

[0036] 4. The nanomotor drug-loaded particles provided by the present invention have a reliable source, are simple to prepare, have high biocompatibility, specifically respond to photodynamic therapy, and effectively inhibit tumor cell growth. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The following is a flow chart of the preparation and practical application of the DNA nanomotor drug of the present invention;

[0038] Figure 2 The agarose electrophoresis result in Example 1 is shown;

[0039] Figure 3 This is an atomic force microscope observation image in Example 1;

[0040] Figure 4 This is a transmission electron microscope observation image in Example 1;

[0041] Figure 5 Flow cytometric analysis and quantitative statistics of drug cellular uptake by DNA tetrahedral nanomotors in Example 2;

[0042] Figure 6 This is a laser confocal image of the cellular uptake of the DNA tetrahedral nanomotor drug in Example 2;

[0043] Figure 7 This is a statistical chart of cell survival rates in the DNA tetrahedron nanomotor drug cell safety experiment in Example 3;

[0044] Figure 8 This is the H&E-stained section of the safety test of the DNA tetrahedron nanomotor drug in mice in Example 3;

[0045] Figure 9 Flow cytometric analysis and quantitative statistics of in vitro tumor cell apoptosis using DNA tetrahedral nanomotor drugs in Example 4;

[0046] Figure 10 The reactive oxygen species (ROS) production of tumor cells in vitro by the DNA tetrahedral nanomotor drug in Example 5;

[0047] Figure 11 This is the in vitro penetration depth experiment of the DNA tetrahedron nanomotor drug into 3D tumor spheres in Example 6. DETAILED DESCRIPTION

[0048] The present invention will be further described below in conjunction with the accompanying drawings and specific examples so that those skilled in the art can better understand the present invention and implement it, but the examples are not intended to limit the present invention. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in this specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items.

[0049] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the materials and reagents used are all commercially available unless otherwise specified.

[0050] Example 1 Synthesis and Characterization of Nanomotor Drug-Loaded Particles

[0051] The synthesis of the DNA tetrahedron nanomotor in the present invention is divided into three steps. First, four self-assembled DNA single strands are synthesized into a DNA tetrahedron structure. Then, methylene blue (MB) is mixed with the DNA tetrahedron and loaded onto the DNA tetrahedron by shaking at room temperature to obtain the MB@TDN structure. Finally, ssDNA-Pt is mixed with MB@TDN and annealed to obtain the DNA tetrahedron nanomotor PM@TDN.

[0052] In Example 1, the DNA tetrahedron is mainly composed of one DNA single strand and three DNA single strands with arm extension chains, the molar ratio of the four single strands is 1:1:1:1, the molar ratio of the DNA tetrahedron to methylene blue (MB) is 1:1800, and the molar ratio of the DNA tetrahedron to ssDNA-Pt is 1:6 as a representative for verification, as shown in FIG. Figure 1 shown.

[0053] The sequences of the four DNA single strands are as follows (5'→3', the underlined part is the extended arm strand):

[0054] DNA tetrahedral chain one is S1, and its sequence is shown in SEQ ID NO.1:

[0055] ACATTCCTAAGTCTGAAGAAGAGCCGCCATAGTACGTTCCCTAACCCTAAC

[0056] CCTAAAACTCTGCTCGACGGATTTTACGTAGTGTCGTTATCACCAGGCAGTT

[0057] GATTGCGCG

[0058] DNA tetrahedron chain 2 is S2, and its sequence is shown in SEQ ID NO. 2:

[0059] AAAAAAAAAAAAAAA GGTCCAATACGCACCTGAGACGCGTTACGCATGA

[0060] CGTTTTTCAACATCAGTCTGATAAGCTATTGTTAAGCTGATTCGCGCAATCA

[0061] ACTGCCTGGTGATAACGACACTACGT

[0062] DNA tetrahedron chain three is S3, and its sequence is shown in SEQ ID NO.3:

[0063] AAAAAAAAAAAAAAA GCTTGCTACACCAACTAGAATGATCGGCTACAGAC

[0064] GTTCGTACTATGGCGGCTCTTCTTCAGACTTAGGAATGTTTTCAGCTTAACA

[0065] ATAGCTTATCAGACTGATGTTGAAA

[0066] DNA tetrahedral chain four is S4, and its sequence is shown in SEQ ID NO.4:

[0067] AAAAAAAAAAAAAAA CGTCTGTAGCCGATCATTCTAGTTGGTGTAGCAAG

[0068] CTTCGTCATGCGTAACGCGTCTCAGGTGCGTATTGGACCTTAATCCGTCGAG

[0069] CAGAGTTTTAGGGTTAGGGTTAGGG

[0070] ssDNA chain, the sequence is shown in SEQ ID NO.5:

[0071] TTTTTTTTTTTTTTT

[0072] Preparation method of nanomedicine with the above-mentioned nanomotor drug-loaded particles as the main component:

[0073] (1) Synthesis and preparation of ssDNA-Pt: Accurately weigh chloroplatinic acid hexahydrate (H2PtCl 6·6H2O) 50.75 mg and polyvinylpyrrolidone (PVP) 222 mg were added to 20 ml of ethylene glycol, heated to 180°C for 20 minutes, cooled to room temperature, dialyzed, and concentrated using a 10 kDA ultrafiltration tube at 6000 g for 20 minutes to concentrate the Pt nanoparticles. 20 μl of Pt and 20 μl of 100 μM ssDNA were added to 100 μl of 5× TBE and shaken at 300 rpm at room temperature overnight. The next day, 2 μl, 4 μl, 6 μl, and 8 μl of NaCl solution were added to the solution at 300 rpm intervals at 30-minute intervals to obtain an ssDNA-Pt complex.

[0074] (2) Synthesis and preparation of PM@TDN: The four DNA single strands were dissolved in ultrapure water; the four DNA single strands were mixed in 1×TM Buffer at a molar ratio of 1:1:1:1. The specific components of 1×TM Buffer include: 10 mM Tris-HCl, 50 mM MgCl2, pH = 8.0; the mixed solution was rapidly heated to 95°C and maintained for at least 10 minutes, and then rapidly annealed to 4°C and maintained for 20 minutes to obtain TDN solution.

[0075] (3) The prepared DNA tetrahedron TDN solution was mixed with the methylene blue solution at a molar ratio of 1:1800 and shaken at 300 rpm overnight at room temperature to obtain the MB@TDN solution;

[0076] (4) MB@TDN solution was mixed with ssDNA-Pt at a molar ratio of 1:6 and annealed at 45 °C overnight to room temperature to obtain PM@TDN.

[0077] 6% PAGE gel chromatography analysis: DNA single strands with a concentration of 500 nM were gradually synthesized into samples S1, S1+S2, S1+S2+S3, and TDN, and then mixed with DNA loading buffer and loaded sequentially; Figure 2 The samples from left to right in the figure are standard DNA Marker (500bp), S1, S1+S2, S1+S2+S3, TDN, using 6% PAGE gel, running at 90V for 80min, and stained with ethidium bromide. Using a gel imager, the bands were detected under ultraviolet (UV). Figure 2 It can be seen from the above that the migration rate of each DNA single-stranded sample in the PAGE gel will slow down when it is synthesized. According to the test principle that the migration rate of the sample in PAGE gel electrophoresis decreases with the increase of molecular weight, the synthesis of the DNA tetrahedron sample can be determined.

[0078] Atomic force microscopy characterization: The synthesized DNA tetrahedron and the DNA tetrahedron loaded with methylene blue were diluted to 2nM. 5-10μl of the sample was dropped onto a clean mica sheet and adsorbed for 3 minutes. The results were observed and analyzed using an atomic force microscope. Figure 3 Figure 3 shows the structure of the DNA tetrahedron (MB@TDN) (a), the drug-loaded DNA tetrahedron (MB@TDN) (b), and the height variation between TDN and MB@TDN (c). The synthesized MB@TDN exhibits uniform distribution, and the insertion of the small molecule drug MB has no significant effect on the size of the DNA tetrahedron structure.

[0079] Transmission electron microscopy characterization: The synthesized PM@TDN sample was separated and purified by 1% agarose gel electrophoresis at 100V for 30 minutes. The band containing PM@TDN was cut and recovered, and then the band was dialyzed at 100V to obtain the purified PM@TDN. 10μl was dripped onto a copper grid, naturally dried, and then observed and analyzed using a transmission electron microscope. The results are shown in Figure 2. Figure 4 The circled structure is the PM@TDN structure, and the synthesized PM@TDN is uniformly distributed.

[0080] Example 2 Study on Cell Uptake Efficiency

[0081] To evaluate the uptake efficiency of DNA tetrahedral nanomotors by CT26 tumor cells, non-nanomotor structures MB@TDN and nanomotor structures PM@TDN were prepared according to the method of Example 1. CT26 tumor cells containing 100 μM H2O2 were co-incubated with MB@TDN and PM@TDN loaded with 5 μM methylene blue (MB) for 1 h, 2 h, and 4 h, respectively. Flow cytometry was used to detect phagocytosis at different time points, and laser confocal microscopy was used to study the phagocytosis of CT26 tumor cells after 4 h of co-incubation. The results are shown in Figure 2. Figure 5 and Figure 6 As shown, Figure 5 (a) shows the histogram of phagocytosis of CT26 tumor cells at different co-incubation times. Figure 5 Quantitative data shown in Figure (b) show that the nanomotor structure PM@TDN is more phagocytosed by CT26 tumor cells than the non-nanomotor structure MB@TDN; Figure 6 Figure (a) shows the fluorescence staining results, where the green shows the fluorescence of methylene blue and the blue shows the cell nucleus. The results show that after the same incubation for 4 hours, the statistical results in Figure (b) show that compared with MB@TDN, CT26 tumor cells have taken up a large amount of PM@TDN.

[0082] Example 3 Safety Study

[0083] To evaluate the safety of DNA tetrahedral nanomotors after uptake by CT26 tumor cells, PM@TDN was prepared according to the method of Example 1. CT26 tumor cells were incubated overnight with PM@TDN loaded with different concentrations of MB, specifically 0, 1, 3, 5, 7, 10, 15, and 20 μM MB. The effect of DNA tetrahedral nanomotors on the survival rate of CT26 tumor cells was detected by MTT assay. The results are shown in Figure 1. Figure 7 As shown, the results show that the nanomotor structure PM@TDN does not have a significant killing effect on tumor cells without 660nm laser irradiation.

[0084] The safety of DNA nanomotors in mice was then evaluated. The mice were injected with the same dose of 100 μl of 1xPBS and 100 μl of 1 μM PM@TDN. After 24 hours, the organs of the mice were removed and sliced ​​for H&E staining. Figure 8 As shown, it can be seen that PM@TDN has good biosafety.

[0085] Example 4 DNA tetrahedral nanomotor induces cell apoptosis

[0086] 2×10 5 CT26 cells / well were seeded in a 12-well plate for 12 h. Then, the cells were divided into a blank group (50 μl of water only), a 1xPBS group (50 μl of 1xPBS only), an MB@TDN group (50 μl of 100 nM MB@TDN only), and a PM@TDN group (50 μl of 100 nM PM@TDN only). The cells were then incubated for 4 h and irradiated with a 660 nm laser (100 mW cm -2 ) for 15 minutes and then further cultured in a normoxic incubator or a hypoxic incubator for another 4 hours. Then, live and dead cells were collected and stained with Annexin V-FITC / PI. After incubation in the dark for 20 minutes, cell apoptosis was analyzed by flow cytometry. The results are shown in Figure 2. Figure 9 As shown in Figure (a), under normoxic conditions, PM@TDN exhibited a stronger ability to induce cell apoptosis than MB@TDN, and even under hypoxic conditions, PM@TDN also exhibited excellent ability to induce cell apoptosis; Figure 9 Figure (b) is a quantitative statistical graph of the percentages of different degrees of cell apoptosis in Figure (a).

[0087] Example 5 DNA tetrahedron nanomotor produces reactive oxygen species (ROS)

[0088] In order to study the generation of reactive oxygen species (ROS) after adding PM@TDN to cells in vitro, 2×10 5CT26 cells / well were seeded in 12-well plates for 12 h, and then incubated with medium containing 1xPBS (50 μl), MB@TDN (50 μl 100 nM), and PM@TDN (50 μl 100 nM) for 4 h. The cells were then irradiated with a 660 nm laser (100 mW cm -2 ) for 15 minutes and then incubated in a normoxic or hypoxic incubator for another 4 hours. The original culture medium was then replaced with a medium containing DCFH-DA (10 μM) at 37°C for another 1 hour, and imaging was performed using a CLSM with an excitation wavelength of 488 nm. Quantitative analysis of the fluorescence images was performed simultaneously using ImageJ. Figure 10 As shown, (a) shows the fluorescence staining results of the reactive oxygen species (ROS) production experiment under normoxic conditions, (b) shows the fluorescence staining results of the reactive oxygen species (ROS) production experiment under hypoxic conditions, and (c) shows the statistical results of the reactive oxygen species (ROS) production experiment under normoxic and hypoxic conditions. Green is the fluorescence of DCFH-DA, and blue is the cell nucleus. The results show that under normoxic conditions, PM@TDN can produce more reactive oxygen species inside the tumor compared with MB@TDN, and even under hypoxic conditions, the PM@TDN group shows a reactive oxygen species production ability that is not weaker than that under normoxia.

[0089] Example 6 DNA tetrahedron nanomotor achieves deep tumor penetration

[0090] In order to study the penetration ability of PM@TDN and MB@TDN after adding them to cells in vitro, CT26 cells were seeded into 96-well plates containing 1.5wt% agarose gel and incubated for 72h to obtain relatively dense tumor spheres. Then, 3D tumor spheres of similar size were selected and incubated with culture medium containing MB@TDN (5ul 100nM) and PM@TDN (5ul 100nM) for 4 hours to evaluate their ability to penetrate tumors and observe them using CLSM. Quantitative analysis of fluorescence images was performed simultaneously using ImageJ. The results are shown in Figure 2. Figure 11 As shown in the z-stack CLSM images, it can be clearly observed that the PM@TDN motor group exhibits deeper penetration than the non-motor group MB@TDN. These results suggest that PM@TDN can produce better penetration and accumulation in tumors.

[0091] In summary, the present invention provides a DNA tetrahedral nanomotor for tumor photodynamic therapy, which can effectively enhance the drug uptake efficiency of tumor cells and achieve deep penetration of tumor cells, thereby effectively increasing the production of ROS during tumor photodynamic therapy and achieving effective killing of tumor cells.

Claims

1. A nanomotor drug-loaded particle, characterized in that: The nanomotor drug-loaded particles are formed by loading platinum nanoparticles and methylene blue drugs on a DNA tetrahedral structure. The DNA tetrahedral structure is assembled from four DNA single strands, each of which includes an assembly chain block for assembling a tetrahedral main structure. The assembly chain blocks form a DNA double strand through base complementary pairing, and at least three DNA single strands contain arm chains. After the four DNA single strands are assembled, the arm chains extend out of a tetrahedral structure for connecting an ssDNA-Pt complex. The methylene blue MB drug is loaded on the DNA tetrahedral structure by inserting between the DNA double strands. The ssDNA-Pt complex is a complex formed by modifying platinum nanoparticles, i.e., Pt NPs, with sulfhydryl DNA, i.e., ssDNA. The ssDNA-Pt complex is loaded on the DNA tetrahedral structure through complementary pairing between the ssDNA and the arm chains on the tetrahedral structure. The DNA single strands used to assemble the tetrahedral structure are respectively denoted as S1, S2, S3, and S4. The base sequences of the DNA single strands are respectively shown in SEQ ID NO.1 to SEQ ID NO.4, and the ssDNA chain sequence is shown in SEQ ID NO.

5.

2. The nanomotor drug-loaded particle according to claim 1, characterized in that: Among the four DNA single strands used for drug delivery, one DNA single strand contains 112 deoxyribonucleotide monomers, and the other three contain 127 deoxyribonucleotide monomers, and the monomer size of the platinum nanoparticles (Pt NPs) is 5~10 nm.

3. The nanomotor drug-loaded particle according to claim 1, characterized in that: The molar ratio of the DNA tetrahedral structure to the methylene blue is 1:1800, and the molar ratio of the DNA tetrahedral structure to the ssDNA-Pt complex is 1:

6.

4. The method for preparing the nanomotor drug-loaded particles according to claim 1, comprising the following steps: The four DNA single strands were dissolved in ultrapure water, and then mixed in a buffer solution at a molar ratio of 1:1:1:1; The mixed solution was rapidly heated to 95°C-100°C and maintained for at least 10 minutes, then rapidly annealed to 2-4°C and maintained for 20-30 minutes to prepare a DNA tetrahedron solution. The DNA tetrahedron solution was mixed with a methylene blue solution at a molar ratio of 1:1800 and shaken at 300 rpm at room temperature overnight to obtain an MB@TDN solution. The MB@TDN solution was mixed with an ssDNA-Pt complex at a molar ratio of 1:6 and annealed at 45°C-25°C for 12 hours to obtain PM@TDN particles.

5. The method for preparing nanomotor drug-loaded particles according to claim 4, characterized in that: The preparation steps of the ssDNA-Pt complex include: 6 • 6H2O) and polyvinylpyrrolidone (PVP) were added to ethylene glycol, heated to 180 ° C, maintained for 20 min, cooled to room temperature and dialyzed, and centrifuged using a 10kDA ultrafiltration tube at 6000g and an effective centrifugal radius of 5 cm for 20 min to concentrate Pt nanoparticles to 9~10mM; among them, chloroplatinic acid hexahydrate (H2PtCl 6 • The raw material mass ratio of chloroplatinic acid hexahydrate and ethylene glycol was 203 mg:888; the raw material mass volume ratio of chloroplatinic acid hexahydrate and ethylene glycol was 203 mg:80 ml; Pt nanoparticle concentrate and 100 μM ssDNA solution were added to 5×TBE and shaken at 300 rpm at room temperature for at least 12 hours; then, NaCl solution with a volume of 0.1 times, 0.2 times, 0.3 times, and 0.4 times that of the Pt nanoparticle concentrate was added to the solution every 30 minutes, and the mixture was shaken at 300 rpm at room temperature overnight to obtain ssDNA-Pt; wherein, the volume ratio of Pt nanoparticle concentrate, ssDNA and 5×TBE was 1:1:

5.

6. Use of the nanomotor drug-loaded particles according to claim 1 in the preparation of drugs for tumor photodynamic therapy.

7. The use according to claim 6, characterized in that The application method is: dissolving the nanomotor drug-loaded particles described in any one of claims 1 to 3 as an active ingredient in a buffer solution to prepare a liquid drug preparation, or directly using the nanomotor drug-loaded particle solution prepared by the preparation method described in any one of claims 4 to 5 as a liquid drug preparation, and the liquid drug preparation is intravenously injected for photodynamic therapy.

8. The use according to claim 7, characterized in that The concentration of the nanomotor drug-loaded particles in the liquid drug preparation is 1 μM, and the buffer is 1×TM Buffer or 1×TAE Mg 2+ buffer.

9. The use according to claim 7, characterized in that The specific steps of the photodynamic therapy are: irradiation with 660 nm laser for 15 minutes.

Citation Information

Patent Citations

  • Application of brucea javanica exosome in preparation of anti-breast cancer drugs and tumor angiogenesis inhibition drugs

    CN117582460A

  • Nucleic acid nano drug carrier and application thereof

    CN115317619A

  • Drug-loaded nanoparticles targeting nasopharyngeal tumor cells as well as preparation method and application of drug-loaded nanoparticles

    CN115944606A