Use of c1q and / or subunits thereof as targets in the prevention and treatment of psoriasis
By using C1Q and/or its subunits as biotherapeutic targets for psoriasis, drugs targeting the mononuclear/macrophage system have been developed, overcoming the tolerance and drug resistance issues of existing treatments and achieving safe and effective treatment for psoriasis.
Patent Information
- Application Number
- CN202411454643.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-17
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2044-10-17
AI Technical Summary
Existing biological target therapies for psoriasis suffer from inconsistent responses and tolerability issues. Long-term use may lead to drug resistance, and existing biologics may increase the risk of infection, tumors, etc., lacking flexibility and sustainability.
Using C1Q and/or its subunits as novel biotherapeutic targets for psoriasis, drugs targeting the mononuclear/macrophage system, including antibodies, siRNA, dsRNA, miRNA, shRNA, compounds, or traditional Chinese medicines, can be developed to modulate the immune response and inflammation levels in psoriasis patients by inhibiting the expression of C1Q and/or its subunits.
It effectively reduces the expression of psoriasis-related inflammatory factors, alleviates skin inflammation and hyperkeratosis, improves clinical symptoms, has good safety, does not increase the risk of infection or tumors, and is suitable for the prevention and treatment of psoriasis.
Smart Images

Figure CN119454964B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biological medicine, and relates to application of C1Q and / or a subunit thereof as a target point in prevention and treatment of psoriasis. BACKGROUND
[0002] Psoriasis biological target treatment is a treatment method for improving skin lesions by targeting certain cytokines or receptors in the body, regulating the immune system, and inhibiting inflammatory reactions. The development of psoriasis biological target treatment has experienced several stages, from the earliest TNF-alpha class, to the IL-17 class, and then to the IL-12 / 23 class and the IL-23p19 class. The treatment target gradually approaches the upstream link of the disease, improving the effectiveness of treatment.
[0003] The existing technologies for psoriasis biological target treatment mainly include the following:
[0004] TNF-alpha class: including etanercept, infliximab, adalimumab, etc. This kind of biological preparation can neutralize or block the pro-inflammatory cytokine TNF-alpha, reduce the infiltration and activation of inflammatory cells, and improve the lesions of skin and joints. The advantages of this kind of biological preparation are fast-acting, suitable for psoriasis and arthropathic psoriasis, and can also be used to treat other inflammatory diseases such as inflammatory bowel disease and rheumatoid arthritis. The disadvantages of this kind of biological preparation are that it may increase the risk of infection, tumor, cardiovascular disease, etc., and regular monitoring of blood, liver function, tuberculin test, etc. is required. There are also certain drug resistance and tolerance problems.
[0005] IL-17 class: including ixekizumab, secukinumab, etc. This kind of biological preparation can target pro-inflammatory cytokine IL-17A, inhibit its binding to the receptor, block the inflammatory signaling pathway mediated by it, and improve the lesions of skin and joints. The advantages of this kind of biological preparation are high efficacy, fast-acting, suitable for psoriasis and arthropathic psoriasis, and can also be used to treat spondyloarthritis. The disadvantages of this kind of biological preparation are that it may increase the risk of infection, tumor, inflammatory bowel disease, etc., and regular monitoring of blood, liver function, tuberculin test, etc. is required. There are also certain drug resistance and tolerance problems.
[0006] IL-12 / 23 class: including ustekinumab. This kind of biological preparation can target IL-12 / 23p40 subunit, inhibit the differentiation and activation of Th1 and Th17 cells, reduce the level of pro-inflammatory cytokines such as IL-17 and IL-22, and reduce the inflammation of skin and joints. The advantages of this kind of biological preparation are good efficacy, suitable for psoriasis and arthropathic psoriasis, and can also be used to treat Crohn's disease. The disadvantages of this kind of biological preparation are that it may increase the risk of infection, tumor, cardiovascular disease, etc., and regular monitoring of blood, liver function, tuberculin test, etc. is required. There are also certain drug resistance and tolerance problems.
[0007] IL-23p19 class: including guselkumab, risankizumab, tildrakizumab, etc. This class of biological agents targets the IL-23p19 subunit, inhibits the synthesis and release of IL-23, reduces the differentiation and activation of Th17 cells, reduces the levels of IL-17, IL-22, and other pro-inflammatory cytokines, and reduces inflammation in the skin and joints. The advantages of this class of biological agents are high efficacy, fast onset, long dosing interval, and suitable for psoriasis and psoriatic arthritis. The disadvantages of this class of biological agents are that they may increase the risk of infection, tumor, inflammatory bowel disease, etc., and require regular monitoring of blood, liver function, tuberculin test, etc. There are also some drug resistance and tolerance problems.
[0008] Different patients may have different responses and tolerances to biological agents, and some patients may not be sensitive or tolerant to a certain biological agent, resulting in poor treatment effect or adverse reactions. Therefore, the selection of biological agents should be based on individualized assessment and adjustment of patient's condition, constitution, immune status, genotype, drug metabolism, etc.
[0009] In addition, long-term or repeated use of biological agents may lead to the production of anti-drug antibodies (ADA) in patients, which can neutralize or eliminate biological agents, reduce their concentration and activity in the blood, and thus weaken or disappear their therapeutic effect. The occurrence of drug resistance is related to the type, dose, dosing interval, combination of biological agents, etc. It is generally believed that humanized or fully humanized biological agents are less likely to develop drug resistance than murine or chimeric biological agents.
[0010] In summary, biological target therapy for psoriasis is an effective treatment, but there are also some defects, disadvantages and shortcomings. Developing new biological treatment targets for psoriasis can help overcome the limitations and shortcomings of existing treatments, reduce the risk and burden of treatment, increase the choice and flexibility of treatment, and improve the sustainability and stability of treatment.
[0011] C1Q is composed of three subunits (C1QA, C1QB and C1QC), each of which has 6 monomers, forming a flower-like structure. The molecular weight of C1Q is about 410 kDa, and the molecular weights of C1QA, C1QB and C1QC are 25 kDa, 23 kDa and 23 kDa, respectively. C1Q is a complex glycoprotein composed of 18 polypeptide chains, and its C-terminal spherical head region can recognize various molecular structures, and its N-terminal collagen-like tail can mediate immune effector mechanisms. C1Q was first discovered as part of C1, the starting component of the classical complement pathway, but recent studies have shown that C1Q can regulate various cellular processes independently of complement activation. C1Q can mediate various immunomodulatory functions, such as enhancing phagocytosis, regulating cytokine production by antigen-presenting cells, and altering T lymphocyte maturation. SUMMARY
[0012] The purpose of the present application is to provide a new biological treatment target for psoriasis, and specifically, to provide the application of C1Q and / or its subunit as a target in the prevention and treatment of psoriasis.
[0013] In the multi-omics research on the biological samples of psoriasis patients, the present application found that C1Q plays an important role in the pathogenesis of psoriasis, the number of macrophages in psoriasis lesions increases, the expression of C1QA / B / C genes in monocytes / macrophages is enhanced, and there is a significant difference in the content of C1Q subunit protein in the serum of psoriasis patients before and after treatment. After treatment, the expression level of C1Q subunit protein in the serum of psoriasis patients significantly decreased. The above results show that C1Q protein and / or its subunit plays an important role in the pathogenesis of psoriasis and is a potential biological treatment target for psoriasis treatment.
[0014] Further, the present application uses CRISPR / Cas9 gene editing technology to knock out the C1Q gene of the precursor monocytes of human macrophages, which proves that the knockout of C1Q gene can effectively reduce the expression of psoriasis-related inflammatory factors such as IFN-gamma and TNF in C1Q gene-knockout monocytes, indicating that by inhibiting the expression or function of C1Q protein, the immune response and inflammation level of psoriasis patients can be regulated, which can effectively prevent and treat psoriasis. Therefore, C1Q can be used as a biological treatment target for psoriasis to prepare a drug for preventing and treating psoriasis.
[0015] According to one aspect of the present application, there is provided the use of a product for inhibiting the expression of C1Q and / or its subunit in the preparation of a drug for preventing and treating psoriasis.
[0016] In some embodiments, the C1Q subunit can be selected from at least one of C1QA, C1QB and C1QC.
[0017] In some embodiments, the product for inhibiting the expression of C1Q and / or its subunit includes a product for inhibiting the expression, transcription or translation of C1Q and / or its subunit at the gene level and / or the protein level. Specifically, the product for inhibiting the expression of C1Q and / or its subunit can be selected from at least one of (1) to (4):
[0018] (1) an antibody against C1Q and / or its subunit;
[0019] (2) siRNA, dsRNA, miRNA or shRNA of C1Q and / or its subunit;
[0020] (3) a compound for inhibiting the expression of C1Q and / or its subunit;
[0021] (4) a traditional Chinese medicine, a Chinese herbal medicine or a Chinese herbal medicine extract for inhibiting the expression of C1Q and / or its subunit.
[0022] C1Q can promote the development of psoriasis through monocyte / macrophage-mediated inflammatory response, and thus can be applied to the preparation of drugs for preventing and treating psoriasis as a new biological therapeutic target for psoriasis, which can inhibit the activation and secretion of macrophages, thereby reducing skin inflammation and hyperkeratosis and improving the clinical symptoms of psoriasis.
[0023] In addition, the biological therapeutic target drug for psoriasis based on C1Q and / or its subunit is a psoriasis drug targeting the monocyte / macrophage system, which also has the following advantages: (1) the monocyte / macrophage system plays an important role in the pathogenesis of psoriasis, which can secrete a variety of pro-inflammatory cytokines and activate T cells by presenting antigens; (2) the target therapy for the monocyte / macrophage system can inhibit the activation and secretion of T cells, thereby reducing skin inflammation and hyperkeratosis and improving the clinical symptoms of psoriasis; (3) the target therapy for the monocyte / macrophage system can simultaneously act on multiple cytokines and signaling pathways, has a more extensive anti-inflammatory effect, and can be used in combination with other biological agents to improve efficacy; (4) the safety and tolerability of the target therapy for the monocyte / macrophage system are good, which does not increase the risk of infection, tumor or other serious adverse events. BRIEF DESCRIPTION OF DRAWINGS
[0024] Figure 1 UMAP visualization of monocytes and macrophages in skin samples from psoriasis lesion and non-lesion areas, where the cell label is the cell annotation based on the MoMac-VERSE system;
[0025] Figure 2 Cell numbers of different cell types in skin samples from psoriasis lesion and non-lesion areas, where L is lesion and NL is non-lesion;
[0026] Figure 3 The expression of C1QA / B / C genes in different cell types in the skin samples of psoriasis lesion area and non-lesion area;
[0027] Figure 4 The expression difference of C1Q subunit in the serum samples of psoriasis before and after treatment of patients, *P<0.05; wherein, Figure 4 A is the difference of C1QA protein in the serum samples of psoriasis before and after treatment of patients (including local sequential treatment group and local sequential combined traditional Chinese medicine treatment group) detected by mass spectrometry, Figure 4 B is the difference of C1QC protein in the serum samples of psoriasis before and after treatment of patients (local sequential combined traditional Chinese medicine treatment group) detected by chip, Figure 4 C is the difference of C1QC protein in the serum samples of psoriasis before and after treatment of patients (local sequential treatment group) detected by chip;
[0028] Figure 5 ClonePlus TM The sequencing results of C1Q gene knockout monocytes separated and cultured by ClonePlus
[0029] Figure 6 The amplification culture effect of C1Q gene knockout monocytes (100 times lens);
[0030] Figure 7 The expression of inflammatory factors IFN-gamma and TNF of C1Q gene knockout monocytes. DETAILED DESCRIPTION
[0031] The application will be further described in detail below in combination with the embodiments. The examples are only used for explanation and do not limit the application in any way. If not otherwise specified, the raw materials and reagents used in the examples are conventional products which can be commercially available; the experimental methods not specified in the examples are usually carried out according to the conventional conditions in the art or according to the recommended conditions of the manufacturers.
[0032] Example 1 High expression of C1Q and its subunit in immune cells of psoriasis lesion tissue
[0033] 1. Experimental methods and processes
[0034] (1) Sample collection and processing
[0035] After obtaining the approval of the ethics committee, the invention collected skin biopsy samples from the leg skin lesions and non-lesion areas of psoriasis patients. The non-lesion area is selected at least 2 cm away from the lesion area. After collecting fresh skin samples, remove the hair and subcutaneous fat tissue, cut the skin sample into skin fragments, then incubate in 5 mL RPMI containing 0.25 mg / mL lysozyme and 1 mg / mL Dnase at 37°C for 2 hours. In the last 15 minutes of the incubation period, add 1 mL of 0.25% Trypsin-1 and 0.53 mM EDTA in PBS to the suspension. Add 5 mL of 5% FACS buffer pre-cooled at 4°C to terminate digestion. Use a 10 mL syringe to repeatedly blow the cells into a dissociated state, and finally obtain a cell suspension after dissociation, then filter, count and sort CD45 positive cells.
[0036] (2) Sorting CD45 positive cells
[0037] Resuspend the skin cell suspension with 100 μL of flow buffer per 10 7 cells, then transfer to a polypropylene FACS tube (BD Falcon, 352063). Then stain with 5 μL of CD45 APC-H7 antibody (clone 2D1) per 10 7 cells, and incubate at 4°C in the dark for 30 minutes. After staining, dilute and wash the cells with flow buffer, centrifuge at 500 x g for 5 minutes. Resuspend the cells in 1 mL of sorting buffer containing 3 μM DAPI per 20 x 10 6 cells, filter with a 100 μm cell strainer, and then sort with a BD FACSAria II sorter with a 100 μm fluid nozzle.
[0038] (3) Analysis of CD45 positive cells by single-cell transcriptome sequencing (scRNA-seq).
[0039] Single-cell libraries were generated using the Chromium Controller and Single Cell 5' Library with Gel Bead Kit (10x Genomics, 1000006). Cell suspensions were loaded onto the Chromium Single Cell Controller (10x Genomics) to generate single-cell gel beads in emulsion according to the manufacturer's protocol. A maximum of 10,000 cells can be added per lane, and the estimated recovery of target cells is about 6,000. The captured cells were lysed, and the released RNA was barcoded in single GEMs by reverse transcription.
[0040] Reverse transcription was performed on a S1000TM Touch Thermal Cycler (Bio Rad) with a temperature of 53°C for 45 minutes, followed by 85°C for 5 minutes, and 4°C for holding. After cDNA generation, amplification was performed and quality assessment was performed using Agilent 4200. Sequencing-ready libraries were sequenced using the Illumina Novaseq 6000 platform and 150-bp paired-end (PE150) configuration, with a sequencing depth of at least 100,000 reads per cell.
[0041] The scRNA-seq data was pre-processed using Cell Ranger (v5.0.1). All transcriptome samples were aligned to the human reference genome assembly refdata-gex-GRCh38-2020-A. Expression data was loaded into R (v4.0.3) and further analyzed using the Seurat package (v4.3.0). Cells with gene counts less than 200, or mitochondrial gene proportion exceeding 5% in PBMCs data, or 20% in tissue data, were considered as abnormal cells and filtered out. Gene counts were log-transformed and scaled. PCA was used for dimensionality reduction. Leiden algorithm was used for clustering analysis of skin cells. Cell annotation was referenced to MoMac-VERSE system Figure 1 ).
[0042] 2. Experimental results
[0043] After the above experimental steps and data processing, the results are shown in Figure 2 . Figure 2 The results show that there is a type of C1Q hi macrophage (C1Q Macrophage-16) with strong expression of C1QA / B / C in the immune cells of psoriatic lesion under MoMac-VERSE annotation, which is not expressed in the non-diseased skin samples.
[0044] In addition, the expression of C1QA / B / C genes in each myeloid cell subgroup was detected by single-cell transcriptome sequencing method, and the results are shown in Figure 3 . All these genes are up-regulated in monocyte-derived macrophages in psoriatic lesions, which is consistent with the above cell annotation results: all C1Q hi macrophages come from monocyte-derived macrophages in psoriatic lesions.
[0045] Example 2: The content of C1Q and / or its subunit in the serum of psoriasis patients before and after treatment has significant difference
[0046] 1. Experimental method and process
[0047] In a clinical trial on psoriasis (ChiCTR-TRC-13003233), eligible psoriasis patients were treated with local sequential therapy or local sequential therapy combined with traditional Chinese medicine.
[0048] The medication regimen of the local sequential therapy group: calcipotriol betamethasone ointment was used once a day for the first 4 weeks (the amount was determined according to the skin lesions, and the total amount used per week was not more than 100 grams), followed by calcipotriol ointment for 8 weeks (the amount was determined according to the skin lesions, and the total amount used per week was not more than 100 grams), for a total of 12 weeks.
[0049] The medication regimen of the local sequential therapy combined with traditional Chinese medicine group: calcipotriol betamethasone ointment was used once a day for the first 4 weeks (the amount was determined according to the skin lesions, and the total amount used per week was not more than 100 grams), followed by calcipotriol ointment for 8 weeks (the amount was determined according to the skin lesions, and the total amount used per week was not more than 100 grams). During this period, the patient took the traditional Chinese medicine compound Yinsilitong optimization prescription (PSORI-CM02), twice a day, for a total of 12 weeks.
[0050] According to the treatment plan, the patient was reminded to take medicine and recorded by the patient diary. The specific amount of ointment was determined according to the area of the rash, and 2 palm areas of ointment were distributed per fingertip. Then, serum samples were collected before treatment and within one week after treatment. All samples were processed using the same standard operating procedure. After the patient was drawn blood, the serum was separated as soon as possible by low-speed centrifugation. All serum samples were divided into small portions after processing and stored in a refrigerator at minus 80 degrees Celsius.
[0051] (1) Measurement of psoriasis serum proteome using antibody microarray
[0052] All serum proteins were labeled with biotin. Briefly, 10 μL of serum was diluted with 90 μL of PBS (pH 7.4), and then 1 μL of NHS-PEG4-biotin (20 g / L DMSO) (Thermo Fisher Scientific, MA, USA) was added. After incubation at room temperature for 1 hour, the Bio-Spin column was used to centrifuge at 1000 g for 2 minutes to remove excess biotin molecules. The collected biotinylated proteins were dissolved in 500 μL of PBST containing 5% milk (w / v) and stored at 4°C.
[0053] Antibody microarrays were mounted into incubation dishes (PEPperPRINT, Heidelberg, Germany) and blocked with 500 pL of PBST containing 5% milk (w / v) for 1 h at room temperature. After removal of the milk, the arrays were incubated with pre-labeled serum proteins for 1 h at room temperature. Sections were washed three times for 10 min with PBST. For detection, the arrays were incubated with 2 pg / mL streptavidin-PE for 1 h at room temperature in the dark, followed by three washes with PBST. Slides were washed three times for 5 min with ddH2O. After drying, the slides were scanned using a GenePix 4000A microarray scanner (Molecular Devices, CA, USA). Fluorescence images were analyzed and signal intensities were extracted using GenePix Pro image analysis software (Molecular Devices, CA, USA).
[0054] (2) Mass spectrometry DIA-MS technique measures psoriasis serum proteome.
[0055] Two pL of serum sample was diluted with lysis buffer containing 6M urea (Sigma-Aldrich). Then, the serum sample was reduced with 10 mM dithiothreitol (DTT) for 60 min at 37°C, and alkylated with 500 mM iodoacetamide (IAA) for 45 min at room temperature in the dark. The proteins were sequentially digested with trypsin for 16 h at 37°C. The peptides after trypsin digestion were acidified with 1% trifluoroacetic acid and desalted with a C18 desalting column according to the manufacturer’s protocol. The desalted peptides were dried under vacuum and dissolved in 20 pL of buffer containing 0.1% formic acid and 2% acetonitrile. The concentration of the peptides was measured by Nanoscan (nalytik Jena AG, Jena, Germany). 1.5 pg of peptides were subjected to 30 min of liquid chromatography gradient separation using an analytical column (150 pm x 250 mm, 2 pm C18 particles) and then injected into a QE-HF mass spectrometer (Q Exactive HF Hybrid Quadrupole Orbitrap™, Thermo Fisher). The DIA acquisition scheme included 45 fixed windows from 350 to 1500 m / z. The resolution profiles of MS1 and MS2 were 60000 and 30000, respectively. Identification and quantification were performed using Spectronaut Pulsar X 12.0 (Biognosys, Schlieren, Switzerland). Finally, the FDR of the peptides and the FDR of the proteins were both set to 1% (FDR).
[0056] 2. Experimental results
[0057] As shown in Figure 4 Figure 4 The results show that:
[0058] (1) The CIQA protein in the psoriasis serum samples detected by mass spectrometry showed significant differences before and after treatment in patients in the local sequential treatment group and the local sequential combined traditional Chinese medicine treatment group. The C1QA protein significantly decreased after treatment (A). Figure 4
[0059] (2) The CIQC protein in the psoriasis serum samples detected by the chip showed significant differences before and after treatment in patients in different treatment groups. The C1QC protein significantly decreased after treatment (B and C). Figure 4 Figure 4
[0060] These results indicate that the C1Q protein plays an important role in the pathogenesis of psoriasis and is a potential effective target for psoriasis treatment. C1Q protein is part of the complement system and is involved in immune response and inflammatory processes. Psoriasis is a chronic inflammatory skin disease related to abnormal activation of the immune system. After treatment, the decrease of C1Q protein may reflect the improvement of the immune system balance in psoriasis patients, thereby reducing the inflammation and lesions of the skin. Therefore, C1Q protein can be used as a biomarker for psoriasis treatment and as a potential target for drug intervention to regulate the immune response and inflammation level in psoriasis patients by inhibiting the expression or function of C1Q protein.
[0061] Example 3 Knocking out the C1Q gene of the precursor mononuclear cells of macrophages to verify the use of C1Q as a biological treatment target for psoriasis
[0062] Since there is no commercial C1Q inhibitor and antagonist at present, the present application selects to knock out the C1Q gene of the precursor mononuclear cells of macrophages to verify the use of C1Q as a biological treatment target for psoriasis.
[0063] By entrusting Suzhou Haixing Biotechnology Co., Ltd. (hereinafter referred to as "Haixing Biotechnology Co., Ltd.") based on the principle of CRISPR / Cas9 gene editing technology, the C1Q gene of human macrophage precursor mononuclear cells THP-1 was knocked out using the electroporation method, and monoclonal C1Q gene knockout THP-1 was constructed. At the same time, under the same experimental conditions, a vector containing no target gene was transfected into THP-1, and a control cell was constructed. The C1Q gene knockout THP-1 and the control cell constructed by Haixing Biotechnology Co., Ltd. were amplified and cultured, and then the cells were taken for RNA-seq to detect the expression of inflammatory factors IFN-gamma and TNF of C1Q gene knockout mononuclear cells.
[0064] The relevant steps are briefly described as follows:
[0065] (1) According to the gene sequence of human C1QA / B / C gene (Gene Bank ID: NM_015991 / NM_001371184 / NM_001114101), a specific sgRNA capable of effectively recognizing the full-length gene of C1QA / B / C is designed and screened, and the nucleotide sequence is as follows:
[0066] sgRNA1 (5' to 3'): GGTATCAGTTGTGTGTCTAG GGG .
[0067] sgRNA2 (5' to 3'): ACGATGCGCCCTCTCCCAGG AGG .
[0068] Among them, the underlined part is the PAM region.
[0069] (2) Synthesis of sgRNA, take 1.1 μL of Cas9 nuclease (HyCyte TM Starfish Cas9 nuclease Multi-NLS, S. pyogenes; Catalog No.: GUCN-R003; Product concentration: 20 μM), 1 μL of sgRNA1 (10 pmol / μL), 1 μL of sgRNA2 (10 pmol / μL) are mixed, and the volume is adjusted to 15 μL with buffer, and then mixed and incubated at 26°C for 10 min; then mix the mixture with the precursor mononuclear cells THP-1 of human macrophages and perform electroporation.
[0070] (3) Based on the ClonePlus TM technology of Starfish Biotechnology Co., Ltd., single clone cell strains are screened by limiting dilution method. The edited cell population is re-digested with 0.25% trypsin, and the cell concentration is adjusted to 5 cells / mL with serum-containing cell culture medium, and then plated into 96-well plates with a volume of 100 μL per well. Place the 96-well plate in a CO2 incubator for culture, and about 7 days later, single clones can be observed under a 4X microscope, and the wells with only one single clone are selected, and the remaining multiple clones or cell-free wells are removed. Continue to culture, and after a certain number of cell populations are formed, the cells are digested and transferred to a 24-well plate for expansion culture.
[0071] (4) Take the single clone cells to extract DNA and design primers for PCR identification. Specifically, three groups of primers are designed to perform PCR amplification on the following three regions: sgRNA1 cutting site (Region 1), sgRNA2 cutting site (Region 2), and knockout region (Region 3). The specific sequences of the primers are shown in Table 1.
[0072] Table 1 Primer sequences
[0073]
[0074] The PCR amplification products were subjected to gel electrophoresis, and the electrophoresis results showed that Region 1 and Region 2 could not be amplified to form bands, and Region 3 was amplified to form a smaller band than the wild type. The corresponding PCR amplification products were subjected to sequencing identification.
[0075] The sequencing results were compared with the wild type sequence. If the comparison result shows that a frame shift is generated, it indicates that the knockout at the genomic level has been achieved, and the C1Q gene knockout THP-1 is successfully constructed.
[0076] As shown in Figure 5 , after the sequencing results are compared by Snapgene software, the CRISPR / Cas9 gene editing causes a frame shift in the C1Q exon region, and the ORF is changed, so that the cell strain is determined to be a knockout successful monoclonal cell strain.
[0077] (5) Under the same experimental conditions, a vector containing no target gene was transfected into THP-1 to construct a control cell.
[0078] (6) The C1Q gene knockout THP-1 and the control cell constructed by Haixing Biological Company were subjected to amplification culture, wherein the amplification culture result of the C1Q gene knockout THP-1 is shown in Figure 6 , and the amplification culture result of the C1Q gene knockout mononuclear cell is shown in Figure 6 . It can be seen from the amplification culture result of the C1Q gene knockout mononuclear cell that the successful amplification of the knockout successful monoclonal cell strain can be used for subsequent experiments.
[0079] (7) The C1Q gene knockout THP-1 and the control cell were subjected to RNA-seq sequencing to confirm the expression difference of the psoriasis-related inflammatory factors IFN-gamma and TNF of the two groups of cells. The results are shown in Figure 7 .
[0080] Figure 7 The results show that knocking out the C1Q gene of the precursor mononuclear cell of the human macrophage can effectively reduce the expression of the psoriasis-related inflammatory factors such as IFN-gamma and TNF of the monoclonal cell, which indicates that by inhibiting the expression or function of the C1Q gene / protein, the immune response and inflammation level of the psoriasis patient can be adjusted, and an effective prevention and treatment effect on psoriasis can be achieved. Therefore, C1Q can be used as a psoriasis biological treatment target for preparing a drug for preventing and treating psoriasis.
[0081] The above only describes some embodiments of the present application. Those skilled in the art can make several modifications and improvements without departing from the concept of the present application, and these all belong to the protection scope of the present application.
Claims
1. Use of a product that inhibits the expression of ClQ in the manufacture of an anti-inflammatory medicament, wherein, The components of the product for inhibiting C1Q expression include sgRNAs, the sgRNAs include sgRNA1 and sgRNA2, the nucleotide sequence of the sgRNA1 is 5'-GGTATCAGTTGTGTGTCTAGGGG-3'; the nucleotide sequence of the sgRNA2 is 5'-ACGATGCGCCCTCTCCCAGGAGG-3'.
Citation Information
Patent Citations
Application of reagent for detecting C1Q expression level in preparation of reagent for diagnosis or prognosis and treatment of acute myeloid leukemia
CN115992226A