A DNA tetrahedron-based complex, and a preparation method and use thereof

Abstract

The application provides a DNA tetrahedron-based complex and a preparation method and application thereof, and belongs to the field of medicines. The application designs a functionalized DNA tetrahedron complex modified bioactive composite hydrogel scaffold containing BMP-2, combines the functionalized BMP-2 binding peptide with the tetrahedron framework structure with unique three-dimensional spatial structure and fine programmability through a chemical clicking mode, and further prepares the composite hydrogel scaffold by combining with methacrylated hyaluronic acid. The functionalized DNA tetrahedron complex realizes the performance of efficiently capturing BMP-2, and the composite hydrogel scaffold realizes the targeted capture of endogenous BMP-2 in the early stage of bone defect and stimulates the osteogenic differentiation of stem cells to promote in-situ osteogenesis, avoids a series of complications caused by the delivery of exogenous bone morphogenetic protein-2, and solves the problems of poor in-vivo stability, safety and high cost, and has a good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of medicine, specifically relating to a DNA tetrahedron-based complex, its preparation method, and its uses. Background Technology

[0002] Bone defects in the oral and maxillofacial region are a common clinical and social problem. Bone tissue engineering offers an effective and sustainable strategy for bone defect repair and reconstruction, and is considered a promising alternative to autologous bone grafting. Bone tissue engineering promotes new bone formation through the interaction of scaffold materials, seed cells, and growth factors. Among these, biomaterial-mediated exogenous stem cell transplantation and growth factor delivery systems are two widely studied bone tissue engineering approaches. However, the former has faced challenges in its translation into therapeutic applications due to ethical concerns. The latter, because it plays a role in all stages of the bone defect repair process, is currently the focus of research on the application of growth factor delivery systems that guide bone regeneration.

[0003] Bone morphogenetic protein-2 (BMP-2) is an important multifunctional growth factor belonging to the transforming growth factor β (TGF-β) superfamily. BMP-2 can induce osteogenic differentiation of bone marrow mesenchymal stem cells, playing a crucial role in bone formation and regeneration, and is one of the most widely studied and applied bioactive molecules in bone tissue engineering. Currently, there are three main strategies for utilizing BMP-2: delivery of soluble BMP-2, delivery of exogenous BMP-2 using bioactive carriers, and enrichment of endogenous BMP-2 at local bone defect sites.

[0004] Strategies for delivering soluble BMP-2 have led to the development of recombinant human BMP-2 (rhBMP-2) injections. However, the poor in vivo stability and easy diffusion of soluble BMP-2 necessitate supraphysiological concentrations and systemic administration to achieve the desired effects. Furthermore, exogenous BMP-2 delivery systems based on various bioactive carriers have been widely studied and applied. This strategy enables co-localization and local release of BMP-2 in locally damaged bone tissue. However, therapies based on exogenous BMP-2 delivery also face challenges, including uncontrollable release, low integration rates, technical difficulties such as protein denaturation during integration, ectopic bone formation, radiculitis, vertebral osteolysis, and postoperative complications such as fractures, as well as high costs. To overcome these obstacles, a strategy using endogenous BMP-2 to promote local bone healing in bone defects has been proposed. At the bone defect site, BMP-2 can be synthesized and released into the bone matrix, subsequently entering systemic circulation and not accumulating locally. Therefore, to promote bone defect healing, local enrichment and fixation of endogenous BMP-2 are necessary. Research has discovered a 9-amino acid-based BMP-2-binding peptide (BBP) that specifically binds to BMP-2. Compared to anti-BMP-2 antibodies, BBP exhibits greater stability, higher selective affinity, and lower cost.

[0005] The literature (DOI:10.1177 / 0363546518787507) discloses a method to capture endogenous BMP-2 by covalently immobilizing BBPs (more than one BMP-2 binding peptide) on a polycaprolactone (PCL) membrane; however, the efficiency of capturing BMP-2 is not high.

[0006] The strategy of enriching endogenous BMP-2 based on specific binding to BBP has the problem of low capture efficiency. Therefore, it is of great significance to develop a method that can improve the capture efficiency of endogenous BMP-2. Summary of the Invention

[0007] In order to solve the problems existing in the prior art, the purpose of this invention is to provide a DNA tetrahedron-based complex, its preparation method and uses.

[0008] This invention provides a composite hydrogel, which is obtained by mixing and curing a BMP-2 binding peptide-modified DNA tetrahedral complex, a hydrogel monomer, and a photoinitiator.

[0009] Further, the mass percentage of the hydrogel monomer is 0.5–1.5 wt.% of the total mass of the BMP-2 binding peptide-modified DNA tetrahedral complex and the hydrogel monomer; the molar ratio of the BMP-2 binding peptide-modified DNA tetrahedral complex to the photoinitiator is 1:200–300 × 10⁻⁶.3 .

[0010] Further, the mass of the hydrogel monomer accounts for 1 wt.% of the total mass of the BMP-2 binding peptide-modified DNA tetrahedral complex and the hydrogel monomer; the molar ratio of the BMP-2 binding peptide-modified DNA tetrahedral complex to the photoinitiator is 1:255×10⁻⁶. 3 .

[0011] Furthermore, in the BMP-2 binding peptide-modified DNA tetrahedral complex, the BMP-2 binding peptide modifies 1 to 3 single strands of the DNA tetrahedron.

[0012] Furthermore, in the BMP-2 binding peptide-modified DNA tetrahedral complex, the BMP-2 binding peptide modifies three single strands of the DNA tetrahedron.

[0013] Further, the BMP-2 binding peptide-modified DNA tetrahedral complex is self-assembled from SH-S1, bS2, bS3, bS4, and b*-BBP single strands; SH-S1 is a thiol-modified S1 single strand, b*-BBP is a propargyl-modified BBP, and the azide-modified sticky end is reacted with the catalytic reaction and purified to obtain the final product; the S1 sequence is shown in SEQ ID NO.2, and the sequences of bS2, bS3, bS4, BBP, and sticky end are shown in SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.1, and SEQ ID NO.9, respectively.

[0014] Furthermore, the molar ratio of the propargyl-modified BBP to the azide-modified viscous end is 1:1, and the catalyst is a monovalent copper ion catalyst.

[0015] Furthermore, the hydrogel monomer is methacrylated hyaluronic acid; the photoinitiator is lithium phenyl (2,4,6-trimethylbenzoyl)phosphate.

[0016] Furthermore, the methacrylated hyaluronic acid is prepared from methacrylic anhydride and hyaluronic acid as raw materials, and the mass ratio of methacrylic anhydride to hyaluronic acid is 6-10:5, preferably 8.32:5.

[0017] The present invention also provides a method for preparing the above-mentioned composite hydrogel, the method comprising the following steps: mixing a BMP-2-binding peptide-modified DNA tetrahedral complex, a hydrogel monomer and a photoinitiator, and then curing the mixture to obtain the final product.

[0018] Furthermore, the curing wavelength is 350–400 nm, preferably 365 nm; the curing time is 20–40 seconds, preferably 30 seconds.

[0019] The present invention also provides the use of the above-mentioned composite hydrogel in the preparation of biological scaffold materials for bone defect repair.

[0020] The present invention has achieved the following beneficial effects:

[0021] This invention designs a bioactive composite hydrogel scaffold modified with a functionalized DNA tetrahedral complex containing BMP-2. The functionalized BMP-2 binding peptide is stably bound to a tetrahedral framework structure with a unique three-dimensional spatial structure and fine programmability via chemical click, and then further prepared with methacryloyl hyaluronic acid (HAMA) to obtain the composite hydrogel scaffold. A strategy of immobilizing BMP-2 through specific and high affinity binding to the BMP-2 binding peptide is proposed, achieving efficient capture of BMP-2 by the functionalized DNA tetrahedral complex in an ordered and stable topological conformation. The functionalized composite hydrogel scaffold enables targeted capture of endogenous BMP-2 in the early stages of bone defects, stimulating osteogenic differentiation of stem cells and promoting in situ osteoogenesis. This avoids the complications, poor in vivo stability, safety issues, and high cost associated with the delivery of exogenous bone morphogenetic protein-2, and shows promising application prospects.

[0022] This invention successfully chemically links the BMP-2 binding peptide to a specific sequence of DNA single strands, further synthesizing a stable functionalized DNA tetrahedral framework structure (p3T) and its corresponding composite hydrogel scaffold (HA-p3T), significantly improving the capture efficiency of rhBMP-2 and achieving unexpected technical results. Furthermore, compared to the literature (DOI:10.1177 / 0363546518787507), the capture efficiency of the HA-p3T in this invention is as high as 89.14% ± 4.24%, demonstrating a significant improvement in capture efficiency.

[0023] The mechanical strength of HAMA and its chemical connection with the functionalized DNA tetrahedral framework structure are conducive to the stable realization of biological efficacy by the scaffold. The high affinity and specific binding of BBP to human recombinant BMP-2 (rhBMP-2), as well as the topological conformation of the trivalent ligand binding provided by p3T, help the HA-p3T scaffold to efficiently capture and immobilize BMP-2 in vitro and in vivo. The capture system constructed in this invention can continuously release effective BMP-2 components in the bone marrow mesenchymal stem cell (BMSCs) culture environment, promote osteogenic differentiation of BMSCs, and significantly upregulate the expression of osteogenic differentiation-specific proteins and genes. The p3T-functionalized biological scaffold material HA-p3T can achieve specific and large-scale capture of endogenous BMP-2 in the early stage of bone defects, which is expected to promote early bone formation and accelerate bone defect healing. The HA-p3T scaffold with the ability to specifically capture endogenous BMP-2 can efficiently promote bone regeneration and reconstruction, and ultimately accelerate the bone healing process after bone defects, confirming that HA-p3T is a better candidate for potential clinical application in bone defect repair.

[0024] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0025] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following embodiments. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0026] Figure 1Preparation, verification, and characterization of functionalized DNA tetrahedral framework structures (BBPs-tFNA). (A) Schematic diagram of the preparation process of B*-BBP and p3T. (B) Verification of successful stepwise synthesis of T and p3T by polyacrylamide gel electrophoresis (PAGE). (C) Confirmation of successful preparation of T and p3T by high-performance capillary electrophoresis (HPCE). (D) PAGE results showing the size and relative fluorescence intensity of the synthesized T, p1T, p2T, and p3T, labeled with cy5 for S1 (red) and FITC for BBPs (green), respectively. ns: No statistically significant difference. (E) Particle size of tFNA and p3T. (F) Potential of tFNA and p3T. (G) Transmission electron microscopy (TEM) image of p3T. (H) Atomic force microscopy (AFM) image of p3T. (I) Enzymatic stability of p3T treated with 1 U / ml Dnase I (0, 1, 3, 6, 9, 12, 24, 48 hours). (J) Stability of p3T in 10% fetal bovine serum (FBS) (0, 1, 3, 6, 9, 12, 24, and 48 hours). (K) Stability of p3T in 5% FBS (0, 1, 3, 6, 9, 12, 24, and 48 hours). (L) Storage stability of p3T at room temperature for 7 days. In (I)–(L), Gelred and cy5-labeled S1 were shown with green and red fluorescence, respectively, and their relative fluorescence intensities were statistically analyzed. All experiments were repeated at least three times, and data are expressed as mean ± standard deviation (SD).

[0027] Figure 2Synthesis and characterization of BBPs-tFNA modified HAMA scaffold. (A) Schematic diagram of the preparation of the composite hydrogel scaffold HA-p3T. (B) Scanning electron microscope (SEM) image of HA-p3T. (C) Rheological and compressive properties of HA-p3T, namely stress-time curve (i), stress-strain curve (ii), stress-ω curve (iii), and stress-temperature curve (iv). G' and G” are storage modulus and loss modulus, respectively. (D) Nuclear magnetic resonance (NMR) results reveal the chemical shift of hydrogen bonds in HA and HA-p3T. (E) Water contact angle measurement shows the difference in surface wettability between HA and HA-p3T. ****P<0.0001. (F) Carbon element spectrum was determined by X-ray photoelectron spectroscopy (XPS). Full spectrum scan of HA-p3T (i) was performed, and partial spectrum scans of HA and HA-p3T (ii & iii) were performed respectively. (G) Fluorescence images and detection results show... The elution of BBPs physically adsorbed on HAMA was observed, with FITC (green fluorescent) labeled BBPs. *P<0.05,**P<0.01,***P<0.001,****P<0.0001. (H) Fluorescence images and detection results show the elution of BBPs after chemically binding of p1T, p2T, and p3T to HAMA, with FITC (green fluorescent) labeled BBPs. ns: No statistically significant difference. All experiments were repeated at least three times, and data are expressed as mean ± standard deviation (SD).

[0028] Figure 3The efficacy of BBPs-tFNA-functionalized HAMA for enriching BMP-2. (A) PAGE results show the elution bands of T, p1T, p2T, and p3T after binding with equal concentrations of rhBMP-2 and FBS, respectively, and the quantitative statistics of the band signals showing the capture efficiency of BMP-2 and FBS. (B) Fluorescence images show the elution of reGFP with green signals after incubation with HA and HA-p3T, respectively, and the corresponding relative fluorescence intensity statistics are performed. p3T is labeled with Cy5 (red). (C) Fluorescence images and immunofluorescence quantitative analysis of BMP-2 immobilized by HA and HA-p3T scaffolds. (D) The amount and efficiency of BMP-2 captured by each composite hydrogel scaffold. (E) Quantitative fluorescence results of HAMA-modified 3pS (3BBP-ssDNA) and p3T (3BBP-tFNA) at various concentrations (i); the amount and efficiency of BMP-2 captured by HA-3pS and HA-p3T at the same concentrations (ii). (F) Effect of different BMP-2 concentrations on the efficiency of HA-p3T in capturing BMP-2. (G) Release curve of HA-p3T capturing BMP-2 in 10% FBS. *P<0.05,**P<0.01,***P<0.001,****P<0.0001. ns: No statistical difference. Experiments were repeated at least 3 times. Data are expressed as mean ± standard deviation (SD).

[0029] Figure 4 Validation of the bioactivity of BMP-2 enriched in HA-p3T scaffolds. (A) Cell viability and proliferation of bone marrow mesenchymal stem cells (BMSCs) treated with different hydrogel scaffolds were determined by CCK-8 assay. (B) Live / dead staining of BMSCs after treatment with different hydrogel scaffolds. Scale bar: 200 μm. (C) Quantitative fluorescence results of live and dead cells. (D) Effect of ALP staining on osteogenic activity of BMSCs in the control group and different treatment groups (BMP-2, HA+BMP-2, HA, HA-T+BMP-2, HA-T, HA-T+BMP-2, HA-p3T). Scale bar: 400 μm (10x magnification). Scale bar: 200 μm (20x magnification). (E) Quantitative detection of ALP enzyme activity. (F) Alizarin red staining showing the formation of calcium nodules in BMSCs under different treatment groups. Scale bar: 500 μm. (G) Semi-quantitative detection of mineralization levels in calcium nodules. (H) Statistical analysis of RT-qPCR results to determine the expression levels of osteogenic genes (ALP, Runx2, BSP, OSX, OPN). (I) Schematic diagram of the effect of HA-p3T capturing BMP-2 on BMSCs. *P<0.05,**P<0.01,***P<0.001,****P<0.0001. ns: No statistically significant difference. All experiments were repeated at least three times. Data are expressed as mean ± standard deviation (SD).

[0030] Figure 5 Confirmation of BMP-2 retention of osteogenic activity on HA-p3T scaffolds. (A) Western blot results of osteogenic differentiation-related proteins (ALP, Runx2, OSX, OPN) after treatment of BMSCs in each group (Control, HA, HA-T, HA-T, BMP-2). (B) Quantitative statistical analysis of Western blot results. (CF) Immunofluorescence staining of osteogenic differentiation-related proteins (ALP, Runx2, OSX, OPN) expression after treatment in each group. Scale bar: 40 μm. (G) Quantitative analysis of the relative fluorescence intensity of ALP, Runx2, OSX, and OPN. *P<0.05,**P<0.01,***P<0.001,****P<0.0001. ns: No statistical difference. All experiments were repeated at least 3 times. Data are expressed as mean ± standard deviation (SD).

[0031] Figure 6 Efficacy of HA-p3T scaffold in capturing endogenous BMP-2. (A) Schematic diagram of rat skull defect model construction and application of hydrogel materials in local bone defect repair process. (B) In vivo imaging results of HA-ss (ssDNA-modified HAMA) and HA-p3T placed subcutaneously in rats within 10 days. All materials were labeled with Cy5 fluorescence. (C) Capture curve results showing the capture of endogenous BMP-2 in the local bone defect area of ​​each group (shame group, control group, HA, HA-p3T). #p<0.0001, n=4. (D) Quantitative statistics of BMP-2 captured by each group of materials on day 7 (n=4). (E) Immunofluorescence staining of BMP-2 captured by each group of materials 1 week after bone defect. Scale bar: 250μm. Magnification area scale bar: 60μm. (F) Statistical analysis of relative fluorescence intensity of captured BMP-2 (n=6). (G) Immunohistochemical staining showed BMP-2 expression around the bone defect 2 weeks later. Scale bar: 600 μm. Magnified area scale bar: 150 μm. (H) Statistical analysis of the relative positive area of ​​BMP-2 capture (n=6). ****p<0.0001. ns: no statistical difference. All experiments were repeated at least 3 times. Data are expressed as mean ± standard deviation (SD).

[0032] Figure 7HA-p3T captures endogenous BMP-2 to promote bone remodeling. (A) Micro-CT scans at 1 and 2 months and 3D reconstruction of skull defects. (B) Statistical analysis of bone mineral density (BMD,i), bone volume / total volume (BV / TV,ii), trabecular bone number (Tb.N,iii), and trabecular bone thickness (Tb.Th,iv) (n=6) at the bone defect site. (C,D) HE and Masson staining. Scale bar: 500 μm. Magnification area scale bar: 50 μm. Solid black lines with double arrows indicate the extent of bone defects. (E,F) Immunofluorescence staining of Col-I and Runx2 in bone defects and surrounding tissues. Scale bar: 500 μm. Magnification area scale bar: 50 μm. Dashed white lines with double arrows indicate the extent of bone defects. (G) Immunohistochemical staining images of OCN in bone defects and surrounding tissues. Scale bar: 500 μm. Magnified area scale bar: 50 μm. Solid black lines with double arrows indicate the extent of bone defects. (H) Quantitative analysis of fluorescence by Col-I(i) and Runx2(ii) immunofluorescence assays (n=6). (I) Statistical analysis of relative OCN protein expression levels (n=6). (J) Quantitative analysis of trabecular spacing (Tb.Sp) (n=6). ****p<0.0001. ns: No statistical difference. All experiments were repeated at least three times. Data are expressed as mean ± standard deviation (SD). Detailed Implementation

[0033] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.

[0034] Materials and Reagents: All DNA sequences or functionalized DNA sequences were synthesized, labeled, and purified by Shanghai Sangon Biotech Co., Ltd. The company also provided TCEP Tris-(2-carboxyethyl)-phosphate chloride. The culture media used, including α-minimum essential medium (α-MEM), penicillin-streptomycin, fetal bovine serum (FBS), trypsin-EDTA, and phosphate-buffered saline (PBS; SH30256), were purchased from Hyclone Laboratories, Inc. Polyoxymethylene (POM) was purchased from Biosharp Life Sciences. Hyaluronidase and EDTA decalcification solution were purchased from Servicebio. Gelred nucleic acid dyes were provided by Beijing Solarbio Technology Co., Ltd. Alkaline phosphatase staining kit, Alizarin Red S staining kit, 10×TBE, 50×TAE, and Calcein / PI cell viability and cytotoxicity assay kit (Beyotime, C2015S) were purchased from Beyotime Biotechnology Co., Ltd. Human recombinant BMP-2 (rhBMP-2) solution, RT-qPCR kit, TRIzol, etc., were provided by ThermoFisher Scientific. 488 secondary antibodies, Alexa 594 secondary antibodies, Alexa All 561 secondary antibodies were purchased from Sigma-Aldrich Merck. The photoinitiator lithium phenolphthalein diacetate (LAP) was purchased from Suzhou Yongqunquan Intelligent Equipment Co., Ltd.

[0035] TM buffer: 50 mM magnesium chloride, 20 mM Tris(hydroxymethyl)aminomethane, pH adjusted to 8.0. Polyacrylamide gel electrophoresis (PAGE) buffer: 1×TBE, composed of: 1 mM disodium ethylenediaminetetraacetate (EDTA), 12.5 mM magnesium acetate, 40 mM Tris(hydroxymethyl)aminomethane, 40 mM boric acid, pH adjusted to 8.0. Binding buffer: (10 mM MgCl2 in DPBS, pH = 7.4).

[0036] The modified or unmodified single-stranded DNA sequences and peptide-related amino acid series involved in the embodiments and experimental examples of this invention are as follows:

[0037] The amino acid sequence of BBP (SEQ ID NO.1) is as follows:

[0038] KGYPVHPST

[0039] The BBP-pra sequence, modified with propargylglycine (pra) at the lysine residue end of BBP, is as follows:

[0040] propargylglycine-KGYPVHPST

[0041] The nucleotide sequences of the four single-stranded DNA strands are as follows:

[0042] S1 (SEQ ID NO.2):

[0043] ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACG AAATTCCTAAGTCTGAA;

[0044] S2 (SEQ ID NO.3):

[0045] ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATT CAGACTTAGGAATGTTCG;

[0046] S3 (SEQ ID NO.4):

[0047] ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACG GGAAGAGCATGCCCATCC;

[0048] S4 (SEQ ID NO.5):

[0049] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGG ATGGGCATGCTCTTCCCG;

[0050] The S1 5' end of the tetrahedral framework structure used to prepare thiol-functionalized DNA is chemically linked with a thiol group (SHC6, which is n-hexylthiool).

[0051] SH-S1:

[0052] 5'-SHC6-ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA-3';

[0053] After S2-S4 is joined to the aptamer via complementary binding of the sticky ends bb*, the nucleotide sequence of bS2-bS4 is as follows:

[0054] bS2 (SEQ ID NO.6):

[0055] ACCCAACAACCACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG;

[0056] bS3 (SEQ ID NO.7):

[0057] ACCCAACAACCACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC;

[0058] bS4 (SEQ ID NO.8):

[0059] ACCCAACAACCACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG;

[0060] The nucleotide sequence of the sticky terminator (b*-N3) modified with azide (N3) and the nucleotide sequence of the polypeptide BBP after linking the sticky terminator is as follows, wherein the nucleotide sequence of the sticky terminator (SEQ ID NO.9) is GGTTGTTGGGT:

[0061] b*-N3:5'-GGTTGTTGGGT-N3-3'

[0062] b*-BBP:5'-GGTTGTTGGGT-BBP-3'

[0063] In this invention, "room temperature" means 25±10℃ and "overnight" means 12±5 hours.

[0064] Example 1: Construction of a functionalized DNA tetrahedral framework structure

[0065] First, BBP-pra and b*-N3 were chemically clicked together in a 1:1 molar ratio under the catalysis of monovalent copper ions, and then further purified to obtain b*-BBP.

[0066] SH-S1, S2, S3, bS4, and b*-BBP single-chain systems were prepared at a concentration of 1 μM. 1 μL of each single chain was added to 95 μL of TM buffer, and after thorough mixing, the mixture was synthesized by a one-step method (incubated at 95℃ for 10 minutes, then cooled to 4℃ and incubated for 20 minutes). The mixture was stored at 4℃ to obtain a functionalized DNA tetrahedral framework structure (named p1T), which was modified with one BBP polypeptide.

[0067] Example 2: Construction of a functionalized DNA tetrahedral framework structure

[0068] The method described in Example 1 is the same, except that 1 μL of SH-S1, S2, bS3, and bS4 single strands and 2 μL of b*-BBP are added to 94 μL of TM buffer to obtain a functionalized DNA tetrahedral framework structure (named p2T), which is modified with two BBP peptides.

[0069] Example 3: Construction of a functionalized DNA tetrahedral framework structure

[0070] Referring to the method in Example 1, the only difference is that 1 μL of SH-S1, bS2, bS3, and bS4 single strands and 3 μL of b*-BBP were added to 93 μL of TM buffer to obtain a functionalized DNA tetrahedral framework structure (named p3T), which is modified with three BBP peptides. Figure 1 A).

[0071] Example 4: Construction of a composite hydrogel scaffold

[0072] The composite hydrogel was prepared using the following method:

[0073] 5 g of hyaluronic acid (MW = 94 wDa) and 8.32 g of methacrylic anhydride were dissolved in 50 mL of deionized water. The pH of the mixture was adjusted to 8.0 using NaOH. The solution was continuously stirred on ice overnight. Afterward, all reaction solutions were dialyzed for 3 days, and the dried product was collected by lyophilization to obtain methacryloyl hyaluronic acid (HAMA).

[0074] The functionalized DNA tetrahedral framework structure (p1T, 1 μM) prepared in Example 1 was mixed with HAMA to obtain a mixture (containing 1 wt.% HAMA). For every 100 μL of the mixture, 5 μL of phenyl (2,4,6-trimethylbenzoyl) lithium phosphate photoinitiator (255 mM) was added. The mixture was then exposed to a 365 nm light curing lamp for 30 seconds for curing. After curing, the mixture was washed three times with TM buffer (10 mM Tris-HCl, 10 mM MgCl2, pH = 8.0) to remove any unreacted material. The resulting sample was designated HA-p1T.

[0075] Example 5: Construction of a composite hydrogel scaffold

[0076] The method described in Example 4 is the same, except that p1T is replaced with p2T. The resulting sample is denoted as HA-p2T.

[0077] Example 6: Construction of a composite hydrogel scaffold

[0078] The method described in Example 4 is the same, except that p1T is replaced with p3T. The resulting sample is denoted as HA-p3T.

[0079] The following describes the preparation of control samples using control examples.

[0080] Comparative Example 1: Preparation of a nonfunctionalized DNA tetrahedral framework structure

[0081] Quantitatively prepare SH-S1, S2, S3, and S4 into a 1 μM system. Add 1 μL of each single strand to 96 μL of TM buffer, mix thoroughly, and synthesize by a one-step method (react at 95℃ for 10 minutes, then cool to 4℃ and react for 20 minutes). Store at 4℃ to obtain a nonfunctional DNA tetrahedral framework structure (named T). This structure is not modified with BBP peptide.

[0082] Compare with Example 2, constructing HA-T composite hydrogel scaffolds

[0083] The method described in Example 4 is the same, except that p1T is replaced with T. The resulting sample is denoted as HA-T.

[0084] Compare with Example 3, Preparation of HA

[0085] HAMA was dissolved in TM buffer at a concentration of 1% wt to obtain a HAMA solution. For every 100 μL of HAMA solution, 5 μL of phenyl (2,4,6-trimethylbenzoyl)lithium phosphate photoinitiator (255 mM) was added. The mixture was then exposed to a 365 nm curing lamp for 30 seconds for curing. After curing, the mixture was washed three times with TM buffer ((10 mM Tris-HCl, 10 mM MgCl2, pH = 8.0)) to remove any unreacted material, and the resulting hydrogel was named HA.

[0086] Comparative Example 4: Preparation of HA-3pS

[0087] Preparation of SH-ssDNA-BBP: bS2-SH (the 3' end of the above bS2 is modified with an SH bond) is synthesized with the above-synthesized b*-BBP in a 1:1 ratio to form BBP-S2-SH (represented as SH-ssDNA-BBP).

[0088] HA-3pS: SH-ssDNA-BBP (3 μM) was mixed with 1% HAMA. For every 100 μL of the mixture, 5 μL of phenyl (2,4,6-trimethylbenzoyl) lithium phosphate photoinitiator (255 mM) was added. The mixture was then exposed to a 365 nm light curing lamp for 30 seconds for curing. After curing, the mixture was washed three times with TM buffer (10 mM Tris-HCl, 10 mM MgCl2, pH 8.0) to remove any unreacted material. The resulting hydrogel was named HA-3pS.

[0089] The following experimental examples demonstrate the beneficial effects of the present invention. All samples used in the following experiments were prepared according to the methods described in the above embodiments or comparative examples.

[0090] Experiment 1: Structural Characterization and Performance Testing

[0091] I. Experimental Methods

[0092] 1. Synthesis and characterization of functionalized DNA tetrahedral framework structures (BBPs-tFNA)

[0093] 1.1 Synthesize functionalized tFNA trapping structures and use characterization techniques such as atomic force microscopy, transmission electron microscopy, gel electrophoresis, and capillary electrophoresis to clarify the structural chemical properties such as yield and stability of tFNA structures at different scales and with design details.

[0094] 1.2 Serum, enzyme, and storage stability of functionalized DNA tetrahedral framework (p3T): First, p3T structures were labeled with Cy5, and their stability was determined under different reaction conditions (10% FBS, 5% FBS, 1 U / mL Dnase I), different incubation environments (37℃, room temperature, 4℃), and different reaction times (0-48h, 0-7d). The obtained products were detected by 2% agarose gel staining (AGE) in 0.5x TAE buffer, and the results were analyzed using a Bio-Rad electrophoresis system and visualized using a gel-blotting imaging system (ibright FL 1500, Thermo Fisher Scientific).

[0095] 2. Synthesis and characterization of BBPs-tFNA modified HAMA scaffolds

[0096] 2.1 BBPs-tFNA were modified onto the HAMA scaffold as described above to obtain the complexes HA-p1T, HA-p2T, and HA-p3T for BMP-2 enrichment. Their surface morphology was observed by scanning electron microscopy (SEM).

[0097] 2.2 Mechanical properties of the HA-p3T support: Young's modulus was measured using an MCR 302e rheometer (Anton Paar), and stress-time curves, stress-strain curves, stress-ω curves, and stress-temperature curves were obtained.

[0098] 2.3 Detection and verification of the chemical modification of the HA-p3T scaffold: The chemical shifts of hydrogen bonds in HA and HA-p3T were detected using an Avance NMR spectrometer (Bruker); the differences in composition and chemical bonds between HA and HA-p3T were measured using a K-Alpha x-ray photoelectron spectroscopy (XPS) system (Thermo Fisher Scientific).

[0099] 2.4 Determination of surface wettability: The wettability of the HA and HA-p3T support surfaces was determined using a contact angle tester (JC2000D2H), and the contact angle was measured and calculated using Drop analysis software.

[0100] 3. Performance verification of BBPs-tFNA-functionalized HAMA for enriching BMP-2

[0101] 3.1 The affinity and specificity of BBPs-tFNA-functionalized HAMA for binding to BMP-2 were detected by PAGE assay.

[0102] 3.2 The content of BMP-2 retained on the HA-p3T scaffold was indirectly detected by immunofluorescence.

[0103] Treatment of the HA-p3T scaffold: The scaffold material was incubated with 1 μg / mL rhBMP-2 in PBS with gentle shaking for 1 hour. It was then washed three times with PBS solution (10 minutes each time), followed by blocking with PBS containing 1% (w / v) bovine serum albumin (BSA) for 1 hour, and the washing process was repeated. The scaffold material was then incubated with 2 μg / mL primary antibody (Rabbit Anti-BMP2 antibody, Bioss) in blocking buffer with gentle shaking for 1 hour. After washing as described above, 8 μg / mL secondary antibody (Goat anti-rabbit Alexa Fluor 488, Invitgen) was added, and the scaffold was incubated for 0.5–1 hour in the same manner, followed by washing. After thorough drying, the scaffold was detected and analyzed using a fluorescence microscope.

[0104] 3.3 ELISA was used to quantitatively detect BMP-2 captured on the composite hydrogel scaffolds (HA, HA-T, HA-p1T, HA-p2T, HA-p3T) in vitro, quantifying the material’s capture efficiency for BMP-2 and the amount released in 10% FBS.

[0105] Treatment of the composite hydrogel scaffold: The composite hydrogel scaffold was co-incubated with 500 μL of 1 μg / mL rhBMP-2 in PBS with gentle stirring for 1 hour. The supernatant from each group was then collected and washed three times (10 minutes each) with PBS solution to remove unbound residual rhBMP-2. The washings were then mixed with the supernatant collected in the previous step. The amount of unbound rhBMP-2 was detected and analyzed using a BMP-2 ELISA kit (Elabscience Biotechnology) according to the reagent manufacturer's instructions. The amount of rhBMP-2 immobilized on the composite hydrogel scaffold and the capture efficiency were calculated based on the difference between the original incubation solution and the unbound rhBMP-2.

[0106] 4. Validation of the bioactivity of BMP-2 enriched in HA-p3T scaffold

[0107] 4.1 Experimental procedures involving animal surgery were performed in accordance with the requirements of the ethics committee. This invention extracts rat bone marrow mesenchymal stem cells (BMSCs) from the long bone marrow of 2-week-old SD rats for studying cell proliferation and differentiation, and evaluating the biocompatibility of hydrogel scaffold materials.

[0108] 4.2 The effect of each hydrogel scaffold material on the proliferation of BMSCs was evaluated by CCK-8 assay. Immunofluorescence staining was performed on live and dead cells on the hydrogel scaffold material. Cell distribution on the hydrogel scaffold was observed and statistically analyzed under a laser confocal microscope (CLSM).

[0109] 4.3 ALP staining and ALP enzyme activity detection: Following the same pretreatment methods as described above, 500 μL of 1 μg / mL rhBMP-2 was incubated with the composite hydrogel scaffold in PBS for 1 hour, followed by washing three times with PBS for 10 minutes each time. BMSCs were then stained at a rate of 2 x 10⁻⁶. 4 After seeding at a density of 0.5 g / cm² in 24-well plates and incubating overnight, BMSCs were cultured using a tissue culture plate insert (Labselect) with a composite hydrogel scaffold. After 7 days of co-culture, adherent cells were fixed with 4% paraformaldehyde. ALP levels were qualitatively detected by staining with a BCIP / NBT kit (Beyotime). Simultaneously, the BMSCs were lysed, and ALP activity was quantitatively measured in each group using an ALP enzyme activity assay kit (Beyotime). The measured ALP activity was normalized to the total protein content based on the alkaline phosphatase activity units.

[0110] 4.4 Alizarin Red Staining and Semi-Quantitative Analysis of Calcium Nodules: The effect of rhBMP-2 pretreated HA-p3T scaffold material on the osteogenic differentiation capacity of BMSCs was detected using the OriCell rat BMSCs osteogenic induction differentiation kit. BMSCs were treated under the same conditions as described above, and osteogenic induction was performed in different treatment groups using complete rat BMSCs culture medium instead of α-medium. After 15 days of culture, alizarin red staining was performed, and the stained calcium nodules were observed and images were acquired under a microscope. Semi-quantitative analysis of the mineralized nodules formed under each culture condition was performed using hexadecylpyridine chloride (CPC).

[0111] 5. Confirmation of BMP-2 retention of osteogenic activity on HA-p3T scaffolds

[0112] Detection of osteogenic gene expression: BMSCs were cultured under the same conditions as the above-mentioned treatment of composite materials. At 1 week and 2 weeks of treatment, the expression levels of the corresponding early osteogenic (ALP, Runx2, OSX) and mid-to-late osteogenic genes (BSP, OPN) were detected by real-time quantitative polymerase chain reaction (RT-qPCR).

[0113] Subsequently, Western blotting (WB) and immunofluorescence techniques were used to detect the expression levels of the corresponding osteogenic-related proteins (ALP (anti-ALP antibody, ET1601-21), Runx2 (anti-Runx2 antibody, ET1612-47), OSX (anti-OSX antibody, ER1914-47), OPN (anti-OPN antibody, 22952-1-AP)).

[0114] 6. Validation of the efficacy of the HA-p3T stent in capturing endogenous BMP-2

[0115] 6.1 The retention of active ingredients in subcutaneously implanted HA-p3T (BBP-tFNA-modified HAMA) and HA-ss (BBP-ssDNA-modified HAMA) hydrogel scaffolds was continuously monitored using in vivo imaging technology.

[0116] 6.2 Construction of a rat skull defect model: Six-week-old rats were randomly divided into four groups: a blank control group (Sham group), a control group (Control group), a HA group, and a HA-p3T group. After exposing the rat skull, circular defects with a diameter of 4 mm were created on both sides of the midline using a drill of specified size. Subsequently, under ultraviolet light irradiation for 20 seconds, the hydrogel material of each group was pre-cured into scaffold material of the corresponding size using a mold, and then placed at the defect site. Finally, the periosteum and skin tissue were tightly sutured sequentially. All rats received penicillin injections for 3 consecutive days to prevent infection.

[0117] 6.3 Testing the Capture Efficiency of Composite Hydrogel Scaffolds for Endogenous BMP-2: First, the capture amount of endogenous BMP-2 by each group of hydrogel scaffolds at the bone defect site was quantitatively detected to obtain capture curves at 1, 3, 5, 7, 10, and 14 days postoperatively (n=4). Subsequently, based on the results of the quantitative detection of the above capture curves, immunofluorescence staining and immunohistochemical experiments were performed on the defect tissue at 7 and 14 days to verify the BMP-2 content in the tissue surrounding the bone defect in each group (n=6).

[0118] 7. Verification of the role of HA-p3T in capturing endogenous BMP-2 and promoting bone remodeling

[0119] 7.1 Three-dimensional detection of long-term osteogenic efficacy in each group: At 1 month and 2 months post-surgery, the skull defect sites of rats in each group were scanned using Micro CT (TD-273 Micro CT 50 / 100 Version 1.3) and three-dimensional reconstruction was performed. Furthermore, the results of the Micro CT were quantitatively analyzed using SCANCO medical evaluation software to assess the new bone formation at the skull defect sites in each group (n=6), and the bone volume / total volume (BV / TV), bone mineral density (BMD), trabecular thickness (Tb.Th), total number of trabeculae (Tb.N), and trabecular spacing (Tb.Sp) were analyzed.

[0120] 7.2 Histological, immunofluorescence staining, and immunohistochemical evaluation: Rat skull samples were decalcified by immersing them in formalin-EDTA solution, with the decalcification solution changed every other day until the fourth week. The samples were then embedded in paraffin and sectioned. HE and Masson staining were performed, and the degree of tissue repair was analyzed by microscopic scanning.

[0121] Subsequently, immunofluorescence staining was used to detect the relative expression levels of OCN (anti-OCN antibody, GB11233) in bone tissue of each group to evaluate long-term osteogenic capacity. Immunohistochemistry was used to assess the relative expression levels of Col-I (anti-Col-I antibody, GB11022-3) and Runx2 (anti-Runx2 antibody, bs-1134R) to further evaluate collagen expression and osteogenic effects in each group. Specimen results were observed using a tissue section scanner, and data were analyzed using ImageJ analysis software.

[0122] II. Experimental Results

[0123] 1. Characterization of BBPs-tFNA

[0124] Figure 1 A is a schematic diagram of the preparation of functionalized DNA tetrahedral framework (p3T).

[0125] The successful and efficient stepwise synthesis of BBPs and tFNA was verified by polyacrylamide gel electrophoresis (PAGE). Figure 1 B), as shown in the figure, from left to right are T, S1+S2+S3, S1+S2, S1, S1+pS2, S1+pS2+pS3, p3T, and pb*(b*-BBP) within the red dashed box. Simultaneously, FITC-labeled BBP showed green fluorescence expression of the corresponding band at the same location. High-performance capillary electrophoresis (HPCE) also verified the stable connection between the peptide and the nucleic acid backbone. Figure 1 C). After BBPs bind to tFNA, the total molecular weight increases significantly from nearly 210 bp of tFNA to nearly 280 bp of p3T.

[0126] To visually confirm the precise synthesis of BBPs and tFNA at different ratios, this invention uses Cy5 fluorescence (red) and FITC fluorescence (green) to label the S1 strand and BBP in the framework nucleic acid structure, respectively. The co-localization results of yellow fluorescence confirm that BBPs were successfully loaded onto tFNA. Figure 1 D). The four lanes from left to right represent T, p1T, p2T, and p3T, respectively. The relative intensities of the corresponding red fluorescence show no significant difference, indicating that the concentrations of the four groups are consistent. While the relative intensities of the green fluorescence of p1T, p2T, and p3T are approximately 1:2:3, this matches the precise binding ratio of the three groups of BBPs to tFNA.

[0127] Further analysis was conducted using dynamic light scattering (DLS) to detect hydrodynamic dimensions and zeta potential. Figure 1E, F). Compared to tFNA (15.96±3.05nm), p3T (26.60±6.01nm) exhibits a larger size. Due to the positive charge of BBPs, p3T (-4.18±2.34mV) has less negative charge than tFNA (-13.78±4.31mV).

[0128] Subsequently, to observe their morphological characteristics, tFNA and p3T were analyzed using transmission electron microscopy (TEM) and atomic force microscopy (AFM), respectively. Figure 1 G, H). Both TEM and AFM images show that p3T exhibits a tetrahedral structure with three chains at the top, and is uniformly dispersed and sized (approximately 30 nm). This further clarifies the morphology of p3T and is consistent with the DLS results.

[0129] This invention used agarose gel electrophoresis (AGE) to perform drug serum stability and enzyme stability experiments. For example... Figure 1 As shown in Figure I, p3T gradually degrades over time at 37°C and in the presence of 1 U / mL DNase I, but its band can still be retained for 12 hours. To simulate the in vivo environment and ideal cell growth conditions, this invention further investigated the degradation curves of p3T over time in 10% FBS, 5% FBS, and fetal bovine serum-free environments. Figure 1 As shown in J-1L, based on the detected gelred signal and Cy5 fluorescence signal, it can be seen that under incubation conditions of 10% FBS, the band showed signs of degradation after 6 hours; in the presence of 5% FBS, p3T remained stable for up to 9 hours; while at room temperature without serum, p3T showed high stability and remained stable for at least 7 days.

[0130] In summary, this invention successfully chemically links polypeptides to a specific sequence of DNA single strands, and further synthesizes a stable framework nucleic acid-polypeptide structure p3T, providing a theoretical basis for its effective biological function.

[0131] 2. Characterization of BBPs-tFNA-modified HAMA scaffolds

[0132] Figure 2 A is a schematic diagram of the fabrication of the BBPs-tFNA modified HAMA scaffold. Scanning electron microscopy (SEM) analysis shows that the functionalized hydrogel scaffold has a porous structure. Figure 2 B). To test the mechanical properties of this solidified gel structure, rheological and compressive property analyses were performed in this invention. Figure 2C). The results show that, under changes in time and temperature (i & iv), the storage modulus (G') of the composite hydrogel is consistently greater than the loss modulus (G”), indicating that its stable gel structure has good mechanical strength. Moreover, both the stress-strain curve (ii) and the stress-ω curve (iii) show that the composite hydrogel structure can resist large mechanical stresses and maintain stable elastic properties.

[0133] Subsequently, liquid nuclear magnetic resonance (NMR) Figure 2 D) and X-ray photoelectron spectroscopy (XPS, Figure 2 F) Measurements were used to evaluate the occurrence of chemical modifications in the p3T-functionalized HAMA hydrogel scaffold (HA-p3T). In NMR measurements, this manifested as the chemical shift of hydrogen bonds adjacent to the CS position, while XPS partial and full-spectrum analyses revealed the formation of specific CS bonds in the HA-p3T material. Furthermore, the changes in surface wettability of the composite hydrogel material were verified by measuring the water contact angle. Figure 2 E). The results showed that although both hydrogel materials exhibited good hydrophilicity, the wettability of HA-p3T hydrogel was 12.34°±0.60°, which was less than that of HAMA hydrogel (15.11°±0.66°, p<0.0001), indicating that p3T was chemically linked and fixed in HAMA hydrogel.

[0134] To verify the stability of this chemical linkage, this invention compared the elution of HAMA hydrogels containing physically adsorbed BBPs. For example... Figure 2 G, Figure 2 As shown in Figure H, after four thorough washes, different high concentrations of BBPs-FITC were significantly eluted; however, the chemically bound polypeptide-nucleic acid framework modified hydrogel did not exhibit significant fluorescence attenuation (p>0.05). Quantitative statistical results also confirmed this phenomenon.

[0135] Therefore, the mechanical strength of HAMA and its chemical connection with BBPs-tFNA are conducive to the stable realization of biological efficacy of the scaffold, providing feasibility for achieving the capture of specific proteins.

[0136] 3. The efficacy of BBPs-tFNA-functionalized HAMA for enriching BMP-2

[0137] To verify the affinity and specificity of BBPs-tFNA for BMP-2 in vitro, polyacrylamide gel electrophoresis (PAGE) was used to compare the binding amounts of BBPs-tFNA with equal concentrations of rhBMP-2 and FBS after 1 hour of incubation. Figure 3As shown in Figure A, p1T, p2T, and p3T can all bind to rhBMP-2. Furthermore, due to the increased molecular weight after binding to the large protein molecule, lighter bands were observed at the corresponding original BBPs-tFNA positions. Based on the comparison of retention amount and original band signal intensity, the binding efficiency of p1T, p2T, and p3T to rhBMP-2 increased sequentially, with p3T reaching 72.95% ± 4.08%. However, p1T, p2T, and p3T did not show significant binding activity with protein-rich FBS, with binding rates less than 5%. Similarly, tFNA did not show affinity for either rhBMP-2 or FBS.

[0138] Furthermore, this invention utilizes a reGFP protein, similar in size to rhBMP-2 and exhibiting green fluorescence, to verify the specificity of HA-p3T binding to BMP-2. Data shows ( Figure 3 B) After chemically ligating p3T with the cy5 fluorescent label to HAMA, it was almost not eluted (p>0.05). However, both HA and HA-p3T were largely eluted after incubation with 1 μg / mL reGFP for 1 hour, leaving very little green fluorescence signal (p<0.0001). This demonstrates that HA-p3T does not exhibit binding affinity for reGFP.

[0139] In contrast, HA and HA-p3T scaffolds were co-incubated with 1 μg / mL rhBMP-2 solution for 1 hour and thoroughly washed before rhBMP-2 immunostaining qualitative analysis to determine the specific binding of HA-p3T to rhBMP-2. The results showed ( Figure 3 C) Maximum fluorescence intensity was observed only when the HA-p3T scaffold was incubated with rhBMP-2 (p<0.0001). The amount of rhBMP-2 captured and retained on the scaffold was quantitatively analyzed using ELISA. Figure 3 D) The results of this invention indicate that the HAMA hydrogel scaffold captured more rhBMP-2 in the presence of BBPs-tFNA, consistent with the results of immunofluorescence staining. The capture efficiency of HA-p3T was as high as 89.14% ± 4.24%, which was statistically significantly different from that of HA-p1T (78.24% ± 1.48%) and HA-p2T (83.05% ± 1.58%). However, the capture efficiencies of both HA and HA-T were much lower than those of the BBPs-tFNA-functionalized HAMA scaffold. Furthermore, there was no statistically significant difference in capture efficiency between the HA and HA-T groups (P = 0.1953).

[0140] In addition, to investigate the effect of tetrahedral structure on capture efficiency, this invention compares BBP and DNA single-stranded linkage (pS) with p3T structure, and modifies HAMA in a 3:1 ratio to obtain HA-3pS. Figure 3 E(i) and confirmed that HA-3pS and HA-p3T have the same BBP content at the same synthesis concentration, and there is no statistical difference. Figure 3 E(ii) results showed that HA-p3T retained more rhBMP-2 on the scaffold and had a higher capture efficiency than HA-3pS of the same concentration (p<0.0001). This indicates that compared with HA-3pS, HA-p3T prepared by a specific method significantly improved the rhBMP-2 capture efficiency (p<0.0001) with the same BBP content, achieving an unexpected technical effect.

[0141] This invention investigated the capture intensity of HA-p3T treated with rhBMP-2 solutions of different concentration gradients. For example... Figure 3 As shown in Figure F, the efficiency of HA-p3T scaffold binding to rhBMP-2 gradually increased with increasing concentration, reaching its highest efficiency at a concentration of 1 μg / mL. At rhBMP-2 concentrations above 1 μg / mL, the retention efficiency of HA-p3T decreased slightly (p>0.05). Therefore, 1 μg / mL of rhBMP-2 was chosen as the condition for treating HA-p3T in in vitro experiments. To simulate cell culture conditions, this invention further investigated the release curve of the rhBMP-2-treated HA-p3T scaffold in 10% FBS (…). Figure 3 G). The results showed sustained release of rhBMP-2 bound to the HA-p3T scaffold over 72 hours, with a release rate of 97.59% ± 1.09% at 72 hours.

[0142] In summary, the high affinity and specific binding of BBPs to rhBMP-2, along with the topological conformation of the trivalent ligand binding provided by p3T, facilitates the efficient capture and immobilization of BMP-2 by the HA-p3T scaffold in vitro and in vivo.

[0143] 4. Validation of the bioactivity of BMP-2 enriched in HA-p3T scaffold

[0144] This invention uses rat-derived bone marrow-derived mesenchymal stem cells (BMSCs) to study the biocompatibility of HA-p3T and its osteogenic differentiation activity under the influence of BMP-2 captured by HA-p3T scaffolds.

[0145] First, the Cell Count Kit-8 (CCK-8) assay was used to evaluate the effects of different groups on the cell viability and proliferation of BMSCs at different time points. Figure 4A). The results showed that although cell viability decreased slightly with increasing culture time, more than 90% of the cells survived within the 72-hour culture period, and there were no significant differences between the groups at 12, 48, and 72 hours. Data at 24 hours showed slightly higher cell viability on HA-T and HA-p3T scaffolds (P<0.05), suggesting that both groups may have slightly promoted cell growth. Consistent with the CCK-8 assay results, the live-death assay... Figure 4 B) shows that there was no significant difference in cell numbers among the groups after 72 hours of co-culture (p>0.05). The cell numbers in the groups with HAMA were slightly higher than those in the control group. These results indicate that HAMA has good biocompatibility, and that modifications with tFNA and p3T have almost no effect on the growth of BMSCs on the scaffold.

[0146] In this invention, a hydrogel scaffold was co-cultured with rhBMP-2 solution under the above conditions and then washed extensively before being transplanted into the upper layer of a cell culture chamber. The aim was to further investigate the osteogenic differentiation effect and mechanism of the continuously released active ingredients from the hydrogel scaffold on BMSCs in the lower layer via the microporous membrane. Figure 4 H).

[0147] It is known that BMP-2 can induce BMSCs to differentiate into osteoblasts, and alkaline phosphatase (ALP) is one of the characteristic markers of early osteogenic differentiation. Therefore, this invention uses the BCIP / NBT alkaline phosphatase colorimetric kit to detect ALP activity 7 days after BMSC seeding. Figure 4 C staining images showed that the HA-p3T scaffold treated with rhBMP-2 solution exhibited more ALP-positive cells (purple), similar to the positive control group incubated with an equal concentration of soluble rhBMP-2. Consistent with the staining results, quantitative measurements indicated ( Figure 4 E) The HA-p3T scaffold preloaded with rhBMP-2 (HA-p3T+BMP-2 group) showed significantly higher ALP activity in cultured BMSCs compared to the untreated group before cell seeding (HA-p3T group) (p<0.0001). Neither the HA nor the HA-T scaffolds, regardless of rhBMP-2 pretreatment, exhibited significant ALP activity (p>0.05), indirectly demonstrating that the HA and HA-T scaffolds did not demonstrate the ability to specifically capture and immobilize BMP-2.

[0148] In addition, calcium nodules are considered an important late marker of osteogenic differentiation of mesenchymal stem cells. Therefore, to further investigate the late-stage effect of HA-p3T scaffolds preloaded with rhBMP-2 on promoting osteogenic differentiation of BMSCs, this invention used alizarin red staining to detect calcium nodules secreted by osteoblasts 15 days after osteogenic induction. Figure 4D). The results showed that the HA-p3T+BMP-2 group and the positive control group had stronger staining than other groups, indicating the presence of more calcium salts or calcium nodules. Further semi-quantitative analysis was performed on the formed mineralized nodules. Figure 4 The results of F showed that the relative mineralization levels of the HA-p3T group preloaded with rhBMP-2 and the positive control group were much higher than those of other groups, consistent with the results of ALP enzyme activity detection.

[0149] The active ingredient BMP-2, continuously released in the HA-p3T capture system, has a certain influence on the expression of early and late osteogenic differentiation markers of bone marrow mesenchymal stem cells (BMSCs). To further confirm its effect on the osteogenic differentiation capacity of BMSCs, this invention detected the expression levels of osteogenic differentiation-specific genes in different treatment groups after 1 and 2 weeks of co-culture. Among them, ALP, Runx2, and OSX are marker genes for early osteogenic differentiation, while BSP and OPN represent the intermediate and late stages of osteoblast differentiation. In addition, the study also confirmed the key role of Runx2 and OSX gene expression in BMP-2-induced differentiation of bone marrow mesenchymal stem cells into osteoblasts.

[0150] like Figure 4 As shown in G, after 1 and 2 weeks of treatment with HA-p3T that specifically binds to rhBMP-2, the expression of the above-mentioned specific osteogenic differentiation genes was significantly upregulated, and was significantly higher than that of the control group and the HA and HA-T treatment groups that did not specifically adsorb rhBMP-2, and there was no statistical difference compared with the positive control group treated with rhBMP-2.

[0151] In addition to detecting osteogenic differentiation-related genes in BMSCs, this invention also detected the expression levels of corresponding osteogenic differentiation-related proteins using Western blot (WB) and immunofluorescence techniques. Figure 5 As shown in Figure A, the expression levels of ALP, Runx2, OSX, and OPN proteins were significantly enhanced after treatment with the HA-p3T scaffold group and the BMP-2 group, and were all higher than those in the other three groups. Statistical analysis further confirmed this conclusion. Figure 5 B). The expression levels of Runx2 and OSX proteins in the HA-p3T scaffold group were slightly lower than those in the positive control group. Furthermore, analysis using laser confocal microscopy (...) Figure 5 (C,D) The present invention detected that the fluorescence signals of ALP, Runx2, OSX, and OPN in the HA-p3T scaffold group were significantly stronger than those in the control group, HA and HA-T groups, and there was no significant difference in intensity compared with the above positive control group. Further statistical analysis was also consistent with the conclusions of RT-qPCR.

[0152] In summary, the capture system constructed in this invention can continuously release effective BMP-2 components in the BMSCs culture environment, promote osteogenic differentiation of BMSCs, and significantly upregulate the expression of osteogenic differentiation-specific proteins and genes.

[0153] 5. The efficacy of the HA-p3T stent in capturing endogenous BMP-2

[0154] Studies have confirmed that BMP-2 plays an important role in early bone formation. To evaluate the early capture efficacy of HA-p3T, this invention first performed in vivo real-time imaging. p3T-modified HAMA scaffolds and S2 chain-modified HAMA scaffolds were implanted subcutaneously, respectively. Figure 6 A). The results showed that a significant Cy5 signal was still visible in the HA-p3T implantation site for the first 10 days, with the fluorescence intensity slowly decreasing. Meanwhile, the fluorescence signal in the HA-ss group was rapidly depleted within 3 days, indicating that its stability was significantly lower than that of the HA-p3T group. Therefore, the HA-p3T scaffold exhibits good structural stability and local preservation capabilities in vivo, supporting its early capture of BMP-2.

[0155] This invention constructs a rat skull defect model and places a pre-formed HA-p3T scaffold at the defect site to achieve early capture of endogenous BMP-2, osteogenic induction, and bone defect repair. Figure 6 B). First, ELISA was used to quantitatively analyze the amount of BMP-2 captured by different scaffold materials in vivo. Based on... Figure 6 The capture curve results for C showed that the amount of BMP-2 detected in each treatment group was significantly higher than that in the blank control group (Sham group). Specifically, the amount of BMP-2 specifically captured by the HA-p3T stent was significantly higher than that in other groups. Over time, the amount of BMP-2 captured on the HA-p3T stent gradually increased, reaching its peak on day seven and then slightly decreasing. Statistical analysis was performed on the BMP-2 capture amount on day seven. Figure 6 D) There was no significant difference between the HA group and the control group, which further confirmed the role of the HA stent in non-targeted capture of endogenous BMP-2.

[0156] This invention qualitatively analyzed the expression level of BMP-2 protein in the bone fragment tissue one week after bone defect in different treatment groups using immunofluorescence, and compared it with the blank group. Figure 6 E). The HA-p3T group showed the highest fluorescence intensity, and its relative expression level of targeted BMP-2 was significantly stronger than that of the other three groups (p<0.0001). Further statistical analysis ( Figure 6 F) was consistent with the quantitative detection results described above. Next, this invention analyzed, using immunohistochemistry, whether early bone remodeling in the HA-p3T group was caused by the capture of endogenous BMP-2 by the functionalized hydrogel scaffold. Positive expression of BMP-2 protein was observed in the tissue surrounding the bone defect at week 2 after skull defect reconstruction. Figure 6 G). Statistical analysis of the relative positive area in each group ( Figure 6H), the BMP-2 content in the bone matrix and surrounding connective tissue of the HA-p3T group was much higher than that in other groups.

[0157] The above results indicate that the p3T-functionalized bioscaffold material HA-p3T can specifically capture a large amount of endogenous BMP-2 in the early stage of bone defects, which is expected to promote early bone formation and accelerate bone defect healing.

[0158] 6. HA-p3T captures endogenous BMP-2 to promote bone remodeling.

[0159] To verify the efficacy of endogenous BMP-2 captured by the HA-p3T scaffold in promoting in situ bone regeneration, micro-CT was used to monitor osteogenic activity in the bone defect area. Figure 7 As shown in Figure A, the control group and the HA scaffold group showed the least new bone growth, and the skull defect was still clearly visible two months later. The HA-p3T scaffold group showed the largest proportion of new bone tissue in the region of interest at both one and two months. Further quantitative analysis was performed on the bone volume / total volume (BV / TV), bone mineral density (BMD), trabecular thickness (Tb.Th), total number of trabeculae (Tb.N), and intertrabecular spacing (Tb.Sp) at the skull defect. Figure 7 (B and 7J). The results showed that the HA-p3T scaffold group had the highest expression of BV / TV, BMD, Tb.Th, and Tb.N in the region of interest, while Tb.Sp expression was the lowest at one and two months, with statistically significant differences (p<0.001). This demonstrates that the HA-p3T scaffold group has a better effect on bone defect repair and healing than other groups.

[0160] In addition, HE and Masson staining results further highlight the potential of HA-p3T in bone regeneration. Figure 7 (C and 7D). In both the control and HA groups, inflammatory cells, thin connective tissue, and collagen fibers were observed at the defect sites, along with a small amount of osteoid formation. Compared to the other two groups, the HA-p3T scaffold group showed significantly greater new bone formation and increased bone density at 1 and 2 months after bone defect treatment. At 2 months, the HA-p3T scaffold treatment group showed blurred fracture lines at the defect ends, indicating good osteogenesis. Masson staining further confirmed a significant increase in collagen fiber content in the bone defect area after HA-p3T scaffold treatment at 1 and 2 months.

[0161] To further evaluate the effectiveness of HA-p3T in promoting bone regeneration and repair, this invention performed tissue immunofluorescence staining to detect the expression levels of specific proteins related to bone tissue development. Type I collagen (Col-I) and Runx2 are considered to play key roles in BMP-2-induced osteogenic differentiation and bone formation. Therefore, this invention confirmed the specific advantages of HA-p3T in stimulating bone regeneration and repair by detecting the relative expression levels of Col-I and Runx2. Compared with the control group and the HA scaffold group, the HA-p3T group showed significantly higher levels of osteogenic specific proteins, namely Col-I and Runx2, at both 1 and 2 months after bone defect. Figure 7 E and 7F). Meanwhile, quantitative statistical analysis of relative fluorescence intensity further confirmed the significant differences in the above protein levels (E and 7F). Figure 7 In addition, osteocalcin (OCN) is considered a typical marker of late osteogenic differentiation. Further immunohistochemical analysis confirmed that HA-p3T scaffold application significantly enhanced OCN expression in bone defect sites at both 1 and 2 months. Figure 7 (G and 7I). In contrast, the control group and HA group showed lower OCN expression signals in the bone matrix and connective tissue surrounding the defect, and the differences were statistically significant.

[0162] Therefore, HA-p3T scaffolds with the ability to specifically capture endogenous BMP-2 can efficiently promote bone regeneration and reconstruction, ultimately accelerating the bone healing process after bone defects, confirming that HA-p3T is a better candidate for potential clinical application in bone defect repair.

[0163] In summary, this invention provides a DNA tetrahedral-based complex, its preparation method, and its applications. This invention designs a bioactive composite hydrogel scaffold modified with a functionalized DNA tetrahedral complex containing BMP-2. The functionalized BMP-2 binding peptide is stably bound to a tetrahedral framework structure with a unique three-dimensional spatial structure and fine programmability via chemical click, and then further prepared with methacryloyl hyaluronic acid (HAMA) to obtain the composite hydrogel scaffold. A strategy for immobilizing BMP-2 through specific and high-affinity binding to the BMP-2 binding peptide is proposed, achieving efficient capture of BMP-2 by the functionalized DNA tetrahedral complex in an ordered and stable topological conformation. The functionalized composite hydrogel scaffold enables targeted capture of endogenous BMP-2 in the early stages of bone defects, stimulating osteogenic differentiation of stem cells and promoting in situ osteoogenesis. This avoids the complications, poor in vivo stability, safety issues, and high costs associated with delivering exogenous bone morphogenetic protein-2, and shows promising application prospects.

Claims

1. A composite hydrogel, characterized in that, It is mixed by BMP-2 binding peptide modified DNA tetrahedral complex, hydrogel monomer and photo initiator, solidified, and the obtained; The BMP-2 binding peptide modified DNA tetrahedral complex is self-assembled by SH-S1, bS2, bS3, bS4 and b*-BBP single strands; SH-S1 is a thiol-modified S1 single strand, b*-BBP is obtained by reacting propargyl-modified BBP with azide-modified sticky ends under the action of a catalyst, purification, and the like; The sequence of S1 is shown as SEQ ID NO. 2, and the sequences of bS2, bS3, bS4, BBP and sticky ends are shown as SEQ ID NO. 6, SEQ ID NO. 7, SEQ ID NO. 8, SEQ ID NO. 1 and SEQ ID NO. 9 respectively.

2. The composite hydrogel of claim 1, wherein, The mass of the hydrogel monomer accounts for 0.5-1.5 wt.% of the total mass of the BMP-2 binding peptide modified DNA tetrahedral complex and the hydrogel monomer; the molar ratio of the BMP-2 binding peptide modified DNA tetrahedral complex to the photoinitiator is 1:200-300 x 10 3 .

3. The composite hydrogel of claim 2, wherein, The mass of the hydrogel monomer is 1 wt.% of the total mass of the BMP-2 binding peptide modified DNA tetrahedral complex and the hydrogel monomer; the molar ratio of the BMP-2 binding peptide modified DNA tetrahedral complex to the photoinitiator is 1:255 x 10 3 .

4. The composite hydrogel of claim 1, wherein, In the BMP-2 binding peptide modified DNA tetrahedral complex, 1-3 single strands in the BMP-2 binding peptide modified DNA tetrahedron are modified by BMP-2 binding peptides.

5. The composite hydrogel of claim 4, wherein, In the BMP-2 binding peptide modified DNA tetrahedral complex, 3 single strands in the BMP-2 binding peptide modified DNA tetrahedron are modified by BMP-2 binding peptides.

6. The composite hydrogel according to any one of claims 1 to 5, wherein, The hydrogel monomer is methacrylated hyaluronic acid; and the photo initiator is lithium phenyl (2, 4, 6-trimethylbenzoyl) phosphate.

7. A method of preparing the composite hydrogel of any one of claims 1-6, wherein, The method comprises the following steps: mixing the BMP-2 binding peptide modified DNA tetrahedral complex, the hydrogel monomer and the photo initiator, and solidifying, thereby obtaining.

8. The method of claim 7, wherein, The wavelength of the solidification is 350-400 nm, and the time is 20-40 seconds.

9. The method of claim 8, wherein, The wavelength of the solidification is 365 nm, and the time is 30 seconds.

10. Use of the composite hydrogel in any one of claims 1-6 in the preparation of a biological scaffold material for repairing bone defects.

Images