Sandalwood SaERF33 protein and / or SaERF33 gene and their application in promoting the synthesis of sandalwood essential oil

Abstract

The present invention discloses a sandalwood SaERF33 protein and / or a SaERF33 gene and an application thereof in promoting the synthesis of sandalwood essential oil. The amino acid sequence of the sandalwood SaERF33 protein is shown in SEQ ID NO.2. The present invention obtains the SaERF33 gene in sandalwood for the first time. Overexpression of the SaERF33 gene in sandalwood can significantly promote the synthesis of sandalwood essential oil without affecting the normal growth of the plant. The present invention provides a new genetic resource for cultivating a new sandalwood variety with high essential oil synthesis efficiency, and has important promotion and application value in the cultivation of sandalwood varieties and the production of sandalwood essential oil.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to a sandalwood SaERF33 protein and / or a SaERF33 gene and an application thereof in promoting the synthesis of sandalwood essential oil. Background Art

[0002] sandalwood( Santalum album L.) is a precious wood with a unique aroma and is widely used in religious ceremonies, perfume making, and traditional medicine. Sandalwood essential oil is a natural essential oil extracted from sandalwood. It is known for its pleasant aroma and various health benefits, such as promoting relaxation, relieving stress, and improving sleep quality. In addition, sandalwood essential oil also has certain antibacterial and anti-inflammatory effects and is widely used in aromatherapy and skin care products. However, sandalwood has a long growth cycle and low oil yield. The supply of high-quality sandalwood essential oil on the market is tight and expensive, which limits the further development and application of sandalwood essential oil.

[0003] The main components of sandalwood essential oil include santalene and santalol, which give sandalwood its signature fragrance and play a key role in the various biological activities of sandalwood essential oil. Santalene includes α-santalene, β-santalene and epi-β-santalene, and santalol includes α-santalol and β-santalol. Sandalwood converts acaciasyl diphosphate (FPP) into santalene through santalene synthase SaSSY (a member of the terpene synthase TPS family), which is then catalyzed into santalol by P450 oxidase SaCYP736A167. It is a new challenge for technicians in this field to obtain new sandalwood varieties with higher essential oil synthesis efficiency through advanced genetic engineering technology and to efficiently and stably increase the yield of sandalwood essential oil. Summary of the invention

[0004] In order to solve the above problems existing in the prior art, the present invention provides a sandalwood SaERF33 protein and / or a SaERF33 gene and use thereof in promoting the synthesis of sandalwood essential oil.

[0005] The first object of the present invention is to provide sandalwood SaERF33 protein.

[0006] The second object of the present invention is to provide the use of sandalwood SaERF33 protein and / or SaERF33 gene in promoting the synthesis of sandalwood essential oil.

[0007] The third object of the present invention is to provide the use of sandalwood SaERF33 protein and / or SaERF33 gene in promoting the synthesis of santalene and / or santalol.

[0008] The fourth object of the present invention is to provide an agent for promoting the expression of sandalwood SaERF33 protein and / or SaERF33 gene for use in promoting the synthesis of sandalwood essential oil.

[0009] The fifth object of the present invention is to provide an agent for promoting the expression of sandalwood SaERF33 protein and / or SaERF33 gene for use in promoting the synthesis of santalene and / or santalol.

[0010] The sixth object of the present invention is to provide a biomaterial for promoting the synthesis of sandalwood essential oil.

[0011] The seventh object of the present invention is to provide the use of the biomaterial in promoting the synthesis of sandalwood essential oil.

[0012] The eighth object of the present invention is to provide a product for promoting the synthesis of sandalwood essential oil.

[0013] A ninth object of the present invention is to provide a method for promoting the synthesis of sandalwood essential oil.

[0014] In order to achieve the above object, the present invention is implemented by the following scheme:

[0015] The present invention finds SaERF33 gene in sandalwood, which encodes SaERF33 protein, and clarifies its important function in regulating the synthesis of sandalwood essential oil through tissue culture and genetic engineering technology.

[0016] The present invention requests protection for the following contents:

[0017] The amino acid sequence of the sandalwood SaERF33 protein is shown in SEQ ID NO.2.

[0018] Application of sandalwood SaERF33 protein and / or SaERF33 gene in promoting the synthesis of sandalwood essential oil, wherein the amino acid sequence of the sandalwood SaERF33 protein is shown in SEQ ID NO.2.

[0019] Preferably, the sandalwood essential oil is sandalwood essential oil from Indian old mountain sandalwood.

[0020] Application of sandalwood SaERF33 protein and / or SaERF33 gene in promoting the synthesis of santalene and / or santalol, wherein the amino acid sequence of the sandalwood SaERF33 protein is shown in SEQ ID NO.2.

[0021] Preferably, the santalene and / or santalol are santalene and / or santalol of Indian sandalwood.

[0022] Preferably, the santalene includes any one or more of α-santalene, β-santalene and epi-β-santalene.

[0023] Preferably, the santalol comprises α-santalol.

[0024] Application of an agent for promoting the expression of sandalwood SaERF33 protein and / or SaERF33 gene in promoting the synthesis of sandalwood essential oil, wherein the amino acid sequence of the sandalwood SaERF33 protein is shown in SEQ ID NO.2.

[0025] Preferably, the sandalwood essential oil is sandalwood essential oil from Indian old mountain sandalwood.

[0026] The use of an agent for promoting the expression of sandalwood SaERF33 protein and / or SaERF33 gene in promoting the synthesis of santalene and / or santalol, wherein the amino acid sequence of the sandalwood SaERF33 protein is shown in SEQ ID NO.2.

[0027] Preferably, the santalene and / or santalol are santalene and / or santalol of Indian sandalwood.

[0028] Preferably, the santalene includes any one or more of α-santalene, β-santalene and epi-β-santalene.

[0029] Preferably, the santalol comprises α-santalol.

[0030] A biomaterial for promoting the synthesis of sandalwood essential oil, which is any one of the following (1) to (4):

[0031] (1) a nucleic acid molecule encoding a sandalwood SaERF33 protein, wherein the amino acid sequence of the sandalwood SaERF33 protein is shown in SEQ ID NO.2;

[0032] (2) an expression cassette containing the nucleic acid molecule described in (1);

[0033] (3) a recombinant expression vector containing the nucleic acid molecule described in (1);

[0034] (4) A microorganism containing the recombinant expression vector described in (3).

[0035] Preferably, the nucleotide sequence of the nucleic acid molecule in (1) is as shown in SEQ ID NO.1 or as shown in the completely complementary sequence of the sequence shown in SEQ ID NO:1.

[0036] Preferably, the recombinant expression vector described in (3) uses the PBWA(V)HS-GFP vector as its backbone.

[0037] More preferably, the recombinant expression vector in (3) uses the PBWA(V)HS-GFP vector as a backbone, and the nucleic acid molecule in (1) is located between the SmaI site and the XbaI site.

[0038] The present invention has no particular limitation on the source and type of the microorganisms described in (4), and any conventional microorganisms that can carry the recombinant expression vector, such as Escherichia coli and Agrobacterium, can achieve the purpose of the present invention.

[0039] Preferably, the microorganism in (4) is Agrobacterium.

[0040] More preferably, the Agrobacterium is Agrobacterium tumefaciens.

[0041] Further preferably, the Agrobacterium tumefaciens is strain LBA4404.

[0042] Application of any of the above biological materials in promoting the synthesis of sandalwood essential oil.

[0043] Preferably, the sandalwood essential oil is sandalwood essential oil from Indian old mountain sandalwood.

[0044] Use of any of the above biological materials in promoting the synthesis of santalene and / or santalol.

[0045] Preferably, the sandalwood essential oil is santalene and / or santalol of Indian sandalwood.

[0046] Preferably, the santalene includes any one or more of α-santalene, β-santalene and epi-β-santalene.

[0047] Preferably, the santalol comprises α-santalol.

[0048] A product for promoting the synthesis of sandalwood essential oil, comprising a biological material for promoting the synthesis of sandalwood essential oil, wherein the biological material is any one of the following (1) to (4):

[0049] (1) a nucleic acid molecule encoding a sandalwood SaERF33 protein, wherein the amino acid sequence of the sandalwood SaERF33 protein is shown in SEQ ID NO.2;

[0050] (2) an expression cassette containing the nucleic acid molecule described in (1);

[0051] (3) a recombinant expression vector containing the nucleic acid molecule described in (1);

[0052] (4) A microorganism containing the recombinant expression vector described in (3).

[0053] Preferably, the nucleotide sequence of the nucleic acid molecule in (1) is as shown in SEQ ID NO.1 or as shown in the completely complementary sequence of the sequence shown in SEQ ID NO:1.

[0054] Preferably, the recombinant expression vector described in (3) uses the PBWA(V)HS-GFP vector as its backbone.

[0055] More preferably, the recombinant expression vector in (3) uses the PBWA(V)HS-GFP vector as a backbone, and the nucleic acid molecule in (1) is located between the SmaI site and the XbaI site.

[0056] The present invention has no particular limitation on the source and type of the microorganisms described in (4), and any conventional microorganisms that can carry the recombinant expression vector, such as Escherichia coli and Agrobacterium, can achieve the purpose of the present invention.

[0057] Preferably, the microorganism in (4) is Agrobacterium.

[0058] More preferably, the Agrobacterium is Agrobacterium tumefaciens.

[0059] Further preferably, the Agrobacterium tumefaciens is strain LBA4404.

[0060] Application of any of the products in promoting the synthesis of sandalwood essential oil.

[0061] Preferably, the sandalwood essential oil is sandalwood essential oil from Indian old mountain sandalwood.

[0062] Use of any of the products in promoting the synthesis of santalene and / or santalol.

[0063] Preferably, the sandalwood essential oil is santalene and / or santalol of Indian sandalwood.

[0064] Preferably, the santalene includes any one or more of α-santalene, β-santalene and epi-β-santalene.

[0065] Preferably, the santalol comprises α-santalol.

[0066] A method for promoting the synthesis of sandalwood essential oil, which increases the expression level of sandalwood SaERF33 protein and / or SaERF33 gene in sandalwood.

[0067] Preferably, the expression level of the sandalwood SaERF33 protein and / or SaERF33 gene in the sandalwood is increased by treating sandalwood with any of the above-mentioned biological materials or any of the above-mentioned products.

[0068] Preferably, the promoting the synthesis of sandalwood essential oil includes promoting the synthesis of santalene and / or santalol.

[0069] More preferably, the santalene includes any one or more of α-santalene, β-santalene and epi-β-santalene.

[0070] More preferably, the santalol comprises α-santalol.

[0071] Preferably, the sandalwood is Indian old mountain sandalwood.

[0072] Compared with the prior art, the present invention has the following beneficial effects:

[0073] The present invention obtains the SaERF33 gene in sandalwood for the first time, and overexpressing the SaERF33 gene in sandalwood can significantly promote the synthesis of sandalwood essential oil without affecting the normal growth of the plant. The present invention provides a new genetic resource for cultivating new sandalwood varieties with high essential oil synthesis efficiency, and has important promotion and application value in the cultivation of sandalwood varieties and the production of sandalwood essential oil. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1 This is the electrophoresis detection result of the CDS region (SEQ ID NO.1) of the PCR amplified SaERF33 gene. M represents DNA Marker (from small to large: 100 bp, 200 bp, 500 bp, 750 bp, 1000 bp, 1500 bp, 2000 bp, 3000 bp and 5000 bp).

[0075] Figure 2 The numbers 1 to 3 represent three single clones, and M represents DNA Marker (from small to large: 100 bp, 200 bp, 500 bp, 750 bp, 1000 bp, 1500 bp, 2000 bp, 3000 bp and 5000 bp).

[0076] Figure 3 This is a map of the sandalwood SaERF33 overexpression vector.

[0077] Figure 4 These are photos of positive callus tissue transformed with LBA4404-SaERF33 Agrobacterium under fluorescent field and bright field.

[0078] Figure 5 The photos are of WT plants and OE plants. #16, #37, #41 and #42 are all OE plants.

[0079] Figure 6 The statistical results of the relative expression of SaERF33 mRNA in transgenic plants. WT represents WT plants. Different lowercase letters indicate significant differences among groups (p<0.05), and the same lowercase letters indicate no significant differences among groups (p≥0.05).

[0080] Figure 7 The statistical results of the relative expression levels of SaSSY and SaCYP736A167 mRNA in transgenic plants. WT represents WT plants. Different lowercase letters indicate significant differences among groups (p<0.05), and the same lowercase letters indicate no significant differences among groups (p≥0.05).

[0081] Figure 8 The statistical results of the content of sandalwood essential oil components in transgenic plants, A represents the content of α-santalene, B represents the content of β-santalene, C represents the content of epi-β-santalene, D represents the content of α-santalol, WT represents WT plants, different lowercase letters represent significant differences among groups (p<0.05), and the same lowercase letters represent insignificant differences among groups (p≥0.05). DETAILED DESCRIPTION

[0082] The present invention is further described in detail below in conjunction with the accompanying drawings and specific examples of the specification. The examples are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following examples are conventional methods unless otherwise specified; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0083] Example 1 Construction of Santalum album SaERF33 overexpression vector

[0084] 1. Amplification of target fragment

[0085] The SaERF33 gene was discovered based on the genomic sequencing data of sandalwood (variety: Indian old mountain sandalwood), and its CDS region sequence is: ATGTCTGCAATGGTTTCTTCTCTGACTCAAGTTATTGGAACCTCCTCATCCCATACTGAAAACGTCACTCCTTGTAATAAGCCATTGGCGACTCATGCCCACCATCCTCATCATCATCAGATGGTGCAATCATCGACACCTGATTCTGCCCCCACCCCGCAACCGCCTCTGCAAGATCAAGAAGGATATGCAAGGAGGCGGCACTACAGAGGAGTGAGGCAAAGGCCATGGGGGAAATGGGCGGCCGAAATTCGGGACCCGAAGAAAGGGGCCCGCGTGTGGCTGGGAACGTTCGAGACGGCCGAGGATGCTGCAGTTGCTTACGACGAAGCGGCTCTGAGGTTCAAAGGCACCAAAGCTAAGCTCAACTTCCCCGAAAGAGTACAAGGAAACACTCACTCCATTGGTTACGTGGCTCCCCCTATTAATACTACGATGAACACCATGGCTCCTCCTCCCACCAGCACCATGATTCTTCCGCCTCGACCGATGCCGTTAGCGTCTCAATTGGACCCCCACCTTCTCCAATATGCACGCCTTCTTTCTAGTAATTGCGGAGATGATGCCAATATTCCCCACATTGCTTCCACCCTCTTCAATGCTCCTACTCCTTACGGTCATCATCAAGGAATGCAGTCTTCGTTGGCGACTATATCGTCATCATCTTCTTCTTCTATGATCATGAGTTTATCATCACCAACGCAGCAACAACTTTCAATATCATCATCCTCCACGAACTCGAGTTCCTCTACTTCTCATCTCTGGGAGAACACTGAGAATTAG (SEQ ID NO.1), the gene encodes SaERF33 protein, the amino acid sequence from N-terminus to C-terminus is: N-terminus-MSAMVSSLTQVIGTSSSHTENVTPCNKPLATHAHHPHHHQMVQSSTPDSAPTPQPPLQDQEGYARRRHYRGVRQRPWGKWAAEIRDPKKGARVWLGTFETAEDAAVAYDEAALRFKGTKAKLNFPERVQGNTHSIGYVAPPINTTMNTMAPPPTSTMILPPRPMPLASQLDPHLLQYARLLSSNCGDDANIPHIASTLFNAPTPYGHHQGMQSSLATISSSSSSSMIMSLSSPTQQQLSISSSSTNSSSSTSHLWENTEN* (SEQ ID NO.2). .

[0086] Using the genomic cDNA of root tissue of sandalwood (variety: Indian sandalwood) as a template, PCR amplification was performed using the upstream cloning primer SaERF33-F (5'-ATGTCTGCAATGGTTTCTTCTCTGA-3' (SEQ ID NO.3)) and the downstream cloning primer SaERF33-R (5'-ATTCTCAGTGTTCTCCCAGAGAT-3' (SEQ ID NO.4)) using a gene cloning kit (Novozymes). The PCR reaction system was: 2×Phanta Max Master Mix, 10μL; ddH2O, 8μL; SaERF33-F (SEQID NO.3), 0.5μL; SaERF33-R (SEQ ID NO.4), 0.5μL; cDNA, 1μL.

[0087] The PCR amplification products were collected and tested by agarose gel electrophoresis. Figure 1 As shown, it can be seen that the band of the PCR amplification product is single and the size is consistent with the length of the CDS region of the SaERF33 gene (SEQ ID NO.1).

[0088] 2. Carrier connection

[0089] The CDS region of the SaERF33 gene (SEQ ID NO. 1) amplified in the previous step was connected to the pBWA(V)HS-GFP vector (expressing green fluorescence) using restriction endonucleases SmaI and XbaI by double enzyme digestion and homologous recombination. Then, the CDS region was transformed into Escherichia coli and plated on LB solid medium. A single clone was selected for expansion culture and the bacterial solution was collected for PCR identification. Figure 2 As shown in the figure, each monoclonal clone has a single band that meets the expected size, which is a positive monoclonal clone.

[0090] The plasmid of the positive single clone was extracted for sequencing identification. The sequencing results showed that the sequence was correct, indicating that the construct was successfully obtained. Figure 3 The sandalwood SaERF33 overexpression vector shown is denoted as pBWA(V)HS-SaERF33 vector.

[0091] Example 2 Construction of the Santalum album SaERF33 overexpression strain

[0092] 1. Construction of Agrobacterium

[0093] The pBWA(V)HS-SaERF33 vector obtained in Example 1 was introduced into Agrobacterium tumefaciens (LBA4404 strain) by freeze-thaw method to obtain Agrobacterium containing the sandalwood SaERF33 overexpression vector, which was recorded as LBA4404-SaERF33 Agrobacterium.

[0094] 2. Callus culture and transformation

[0095] From the explants of sandalwood (variety: Indian old mountain sandalwood) (preserved in the Tropical Forestry Research Institute of the Chinese Academy of Forestry, the public can obtain this biological material from the applicant), young stem segments with a length of about 1.0 cm were selected and inoculated into callus induction medium (MS medium containing 1.0 mg / L 2,4-dichlorophenoxyacetic acid (2,4-D), pH 5.8), and then subcultured to 4 weeks of age.

[0096] Four-week-old sandalwood callus was co-cultured with LBA4404-SaERF33 Agrobacterium for 20 minutes, and then transferred to callus induction medium for further culture; after one week, the callus was transferred to selection medium (MS medium containing 40 mg / L hygromycin, pH 5.8) for screening. Under the irradiation of excitation light, the wild-type callus had no green fluorescence. Figure 4 As shown, under the irradiation of excitation light, the callus containing the pBWA(V)HS-SaERF33 vector expressed green fluorescence, indicating that the positive callus of LBA4404-SaERF33 Agrobacterium was successfully transformed and recorded as OE callus.

[0097] 3. Cultivation and identification of transgenic plants

[0098] OE callus and wild type (WT) callus of the same age were transferred to shoot induction medium (MS medium containing 0.1 mg / L 6BA and 0.1 mg / L IBA, pH 5.8), and then transferred to rooting medium (MS medium containing 0.2 mg / L IBA and 0.2 mg / L NNA, pH 5.8) for further culture after 2 months. Transgenic plants obtained from OE callus culture were recorded as OE plants, and plants obtained from WT callus culture were recorded as WT plants. The growth status of OE plants (#16, #37, #41 and #42) and WT plants after 1 month are shown in Figure 2. Figure 5 As shown, there is no obvious difference in appearance and growth.

[0099] Root tissues of OE plants and WT plants were cultured, RNA was extracted, and cDNA was obtained by reverse transcription. Using cDNA as a template, the mRNA expression of related genes was detected using primers and fluorescence quantitative PCR technology as shown in Table 1. The fluorescence quantitative PCR reaction system was: 2 × SYBR Green qPCR Mix, 10μL; RNase Free delH2O, 8μL; cDNA, 1μL; upstream quantitative primer (F), 0.5μL; downstream quantitative primer (F), 0.5μL.

[0100] Table 1 Fluorescence quantitative PCR primers

[0101]

[0102] like Figure 6 As shown in the figure, compared with the WT plants, the transcription level of SaERF33 in 4 OE plants (#16, #37, #41 and #42) increased significantly, among which #37 had the highest SaERF33 transcription level, indicating that the sandalwood SaERF33 overexpression strain was successfully constructed.

[0103] like Figure 7 As shown in the figure, compared with the WT plant, the transcription levels of SaSSY and SaCYP736A167 in #37 were significantly increased. Similar detection results were also found in the other three OE plants (#16, #41 and #42). This indicates that overexpression of the SaERF33 gene in sandalwood can upregulate the terpene biosynthesis pathway related to sandalwood essential oil.

[0104] Example 3 Synthesis of sandalwood essential oil by the SaERF33 overexpression strain

[0105] 1. Determination of sandalwood essential oil

[0106] Root tissues were collected from the WT plants and four OE plants (#16, #37, #41, and #42) in Example 2 and tested as follows: 0.1 g of ground and dried sandalwood roots were used to extract metabolites using 1 ml of hexane by repeated shaking and inversion for 3 days. The extract was centrifuged at 2000 rpm for 5 minutes, and the supernatant was evaporated to dryness with nitrogen. The dried residue was redissolved in 50 μl of hexane and dodecane (0.1 mg / ml) was added as an internal standard. Testing was performed as follows: A GC-2010 gas chromatograph (Shimadzu, Suzhou, China) system was operated in electron ionization selected ion monitoring mode. Sandalwood essential oil samples were analyzed on a DB Wax fused silica column (Agilent Technologies) (30 m long, 250 μm inner diameter, 0.25 μm film thickness). The injector was operated in pulsed splitless mode and the injector temperature was maintained at 250°C. Helium was used as carrier gas with a flow rate of 0.8 ml / min and a pulse pressure setting of 25 psi for 0.5 min. Scan range: m / z 40-500; SIM: m / z 93, 94, 105, 107, 119, 122, and 202. The dwell time was 50 ms. The oven program included: 50°C for 3 min; 5°C / min ramp to 250°C for 2 min; then 5°C / min ramp to 300°C for 15 min. Data acquisition and processing were performed using ChemStation software (Agilent Technologies). Compounds were identified by comparing mass spectra with the NIST / EPA / NIH Mass Spectral Library Version 2.0 (http: / / chemdata.nist.gov / ). The relative abundance of each component of the essential oil was calculated by manually integrating the peak areas and normalizing with internal standards and the amount of tissue used (dry weight). The analysis was performed using three biological replicates, each containing two technical replicates.

[0107] 2. Measurement results

[0108] like Figure 8 As shown in A to D in Figure , the contents of α-santalene, β-santalene, epi-β-santalene and α-santalol in the four OE plants (#16, #37, #41 and #42) were significantly increased compared with those in the WT plants, indicating that overexpression of the SaERF33 gene in sandalwood can promote the synthesis of sandalwood essential oil.

[0109] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. For ordinary technicians in this field, other different forms of changes or modifications can be made based on the above descriptions and ideas. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. Sandalwood SaERF33 protein, characterized in that Its amino acid sequence is shown in SEQ ID NO.

2.

2. Application of sandalwood SaERF33 protein and / or SaERF33 gene in promoting the synthesis of sandalwood essential oil, characterized in that: The amino acid sequence of the sandalwood SaERF33 protein is shown in SEQ ID NO.

2.

3. Use of sandalwood SaERF33 protein and / or SaERF33 gene in promoting the synthesis of santalene and / or santalol, characterized in that: The amino acid sequence of the sandalwood SaERF33 protein is shown in SEQ ID NO.

2.

4. A biomaterial for promoting the synthesis of sandalwood essential oil, characterized in that: It is any one of the following (1) to (4): (1) A nucleic acid molecule encoding the sandalwood SaERF33 protein according to claim 1; (2) an expression cassette containing the nucleic acid molecule described in (1); (3) a recombinant expression vector containing the nucleic acid molecule described in (1); (4) A microorganism containing the recombinant expression vector described in (3).

5. The biomaterial according to claim 4, characterized in that The nucleotide sequence of the nucleic acid molecule described in (1) is shown in SEQ ID NO.

1.

6. Use of the biomaterial according to claim 4 in promoting the synthesis of sandalwood essential oil.

7. A product for promoting the synthesis of sandalwood essential oil, characterized in that: Comprising the biological material according to claim 4.

8. A method for promoting the synthesis of sandalwood essential oil, characterized in that: The expression level of the sandalwood SaERF33 protein and / or the SaERF33 gene in sandalwood is increased, and the amino acid sequence of the sandalwood SaERF33 protein is shown in SEQ ID NO.2.

Images