Pro.ALP Conus Peptide for Instant Anti-Wrinkle and Fine Line Reduction, Its Biosynthesis Method and Application

Abstract

The present invention discloses a Pro.ALP conotoxin peptide for immediate anti-wrinkle and fine line reduction, and the amino acid sequence of the conotoxin peptide is shown as any one of SEQ ID No.1-3. It also discloses its encoding gene, expression vector, host bacterium, biosynthesis method and applications. The present invention uses a prokaryotic system for expression, with a simple system, high yield and low cost. The conotoxin peptides disclosed in the present invention can all be highly expressed in the prokaryotic system, solving the drawbacks of chemical synthesis and reducing the purification difficulty; the biosynthesized conotoxin peptides have the efficacy of stable quality, immediate skin tightening and good solubility, and have good applications in the cosmetic field.

Description

Technical Field

[0001] The present invention relates to a Pro.ALP conotoxin for immediate anti-wrinkle and fine line reduction, its biosynthesis method and application, and belongs to the technical field of protein expression. Background Art

[0002] Conotoxins are a class of bioactive peptide toxins extracted from marine organisms Conus, also known as arginine / lysine polypeptides. They are a special type of polypeptide venom secreted by Conus through venom ducts, mainly used for predation and defense. They are divided into multiple superfamilies and subtypes according to their structures and action mechanisms. These superfamilies include A, O, T, M, P, I, etc., and each superfamily is further divided into subtypes such as α, ω, μ, δ, etc. according to their different action targets and pharmacological activities on organisms. Currently, more than 2,000 conotoxins are known. These small peptide toxins are generally composed of 10-46 amino acids, rich in disulfide bonds, have special structures, can specifically act on receptors or ion channels, thereby paralyzing muscles and making them relax, helping to soothe wrinkles in a short time, and retaining 5% of the neuromuscular current conduction of the muscles, so a very natural anti-wrinkle effect can be provided.

[0003] At present, there are mainly three ways to synthesize conotoxin peptides: extraction from natural cone snails, genetic engineering synthesis, and artificial chemical synthesis. Extracting from natural cone snails is the most primitive method, but the amount of conotoxin peptides obtained is very small. Due to the destruction of the marine ecosystem, the number of wild cone snails has decreased sharply. This method is not only inefficient but also may exacerbate environmental deterioration. Chemical synthesis is widely used in the synthesis of short peptides with a short length (the number of amino acids ≤ 10). Although the chemical synthesis process is mature and easy to industrialize, conotoxin has more amino acid residues, and the yield and purity of artificial synthesis are low. Moreover, the synthesized peptide needs to be oxidized and folded to obtain an active conformation. Chemical synthesis also faces the disadvantage of a sharp increase in production costs. Such long peptides are often difficult to mass-produce in industry. For example, in the patent publication number CN110894225A, the preparation and purification method of conotoxin peptides includes steps such as the preparation of linear peptide amino resin, cleavage, linear peptide folding, and crude peptide purification, which are very complicated and the cost is also high. Genetic engineering synthesis refers to transforming the gene of conotoxin into microorganisms to make it naturally express, and then separating and purifying it. However, the conotoxin peptides synthesized by genetic engineering have poor stability due to their small molecular weight and lack of some base modifications, and are easy to degrade. For example, in the patent publication number CN104334155A, when chemically synthesizing conotoxin peptides, glutamine at the N-terminus of conotoxin peptides is converted into pyroglutamic acid, which blocks protein degradation and reduces its sensitivity to aminopeptidase degradation. The carboxyl group at the C-terminus is amidated to change the charge property of the carboxyl group, converting the originally negatively charged carboxyl group into an amide group close to neutral, thus improving the stability of proteins or peptides to some extent. Therefore, it is of great application value to provide a preparation method with low cost and capable of large-scale production, as well as conotoxin peptide proteins with high biological activity, instant anti-wrinkle and long-term repair effects. Summary of the Invention

[0004] The object of the present invention is to provide a biosynthetic method for Pro.ALP conotoxin peptides for instant anti-wrinkle and reducing fine lines in view of the poor stability of conotoxin peptides synthesized by genetic engineering currently.

[0005] The technical solution adopted by the present invention is as follows:

[0006] A Pro.ALP conotoxin peptide for instant anti-wrinkle and reducing fine lines, whose amino acid sequence is shown in SEQ ID No.1-3.

[0007] The coding gene of the above-mentioned conotoxin peptide.

[0008] Preferably, its base sequence is shown in SEQ ID No.5-8.

[0009] An expression vector expressing the above-mentioned conotoxin peptide.

[0010] Preferably, the expression vector is pET32a or pET30a.

[0011] A host bacterium expressing the above-mentioned conotoxin.

[0012] Preferably, the host bacterium is Escherichia coli.

[0013] The above-mentioned biosynthetic preparation method of conotoxin is characterized in that its steps include:

[0014] (1) Construct the plasmid expression vector of the above-mentioned conotoxin and transform it into the host bacterium;

[0015] (2) Culture the host bacterium for expression and induce protein expression;

[0016] (3) Purify the expression product to obtain conotoxin.

[0017] A conotoxin with anti-wrinkle efficacy is prepared by the above-mentioned biosynthetic method.

[0018] The application of the above-mentioned conotoxin in the preparation of anti-wrinkle products.

[0019] Advantages of the present invention:

[0020] The present invention provides a biosynthetic method of conotoxin, which has stable quality and low cost. The conotoxin synthesized by the present invention has high stability, the efficacy of immediate skin tightening and good solubility. It can be expressed by a prokaryotic system, with a simple system, high yield and low cost. It has anti-wrinkle efficacy and can be used in the preparation of anti-wrinkle products. Brief Description of the Drawings

[0021] Figure 1 The map of the expression vector pET32a-conotoxin of the present invention.

[0022] Figure 2 The stability of the conotoxin liquid of the present invention at different temperatures, where the left figure is at 25 °C and the right figure is at 45 °C.

[0023] Figure 3 The test photos of the wrinkle-removing efficacy of the conotoxin of the present invention. Detailed Embodiments

[0024] The present invention is further illustrated by the following examples, but is not limited to the present invention. The following provides the specific materials used in the embodiments of the present invention and their sources. However, it should be understood that these are merely exemplary and are not intended to limit the present invention. Materials with the same or similar types, models, qualities, properties or functions as the following reagents and instruments can be used to implement the present invention. The experimental methods used in the following examples are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0025] Example 1: Preparation of Conopeptide Expression Vector

[0026] (1) Gene Design and Synthesis

[0027] In the present invention, an expression vector for conopeptide was constructed. The amino acid sequences designed for conopeptide expression are shown in SEQ ID No. 1-4. The amino acid sequence shown in SEQ ID No. 1 includes linker, conopeptide, and 6*His connected in sequence. SEQ ID No. 2 and SEQ ID No. 3 are based on SEQ ID No. 1 with the amino acid sequence of the linker replaced to improve the protein expression level. SEQ ID No. 4 has no linker at the N-terminus and only a 6*His purification tag at the C-terminus of the conopeptide. The corresponding coding genes are shown in SEQ ID No. 5-8. At the same time, a control plasmid was constructed. SEQ ID No. 4-6 were designed into the primers, and the primer synthesis was entrusted to Sangon Biotech (Shanghai) Co., Ltd.

[0028] Table 1: Primer Design

[0029] Primer Name Primer Sequence Backbone-F GATCCGGCTGCTAACAAAG(SEQ ID No.9) Backbone-R ATGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCT(SEQ ID No.10) Conopeptide-1-F TAAGAAGGAGATATACATATGCCGACGCCGACCCCAC(SEQ ID No.11) Conopeptide-1-R CTTTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTGGCA(SEQ ID No.12) Conopeptide-2-F TAAGAAGGAGATATACATATGGAAGCAGCAGCAAAACAGGGTT(SEQ ID No.13) Conopeptide-2-R CTTTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTGGCA(SEQ ID No.12) Conopeptide-3-F TAAGAAGGAGATATACATATGGAAGCAGCAGCAAAACAGGGTT(SEQ ID No.14) Conopeptide-3-R CTTTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTGGCA(SEQ ID No.12) Conopeptide-4-F TAAGAAGGAGATATACATATGCAGGGTTGCTGCAACGGT(SEQ ID No.15) Conopeptide-4-R CTTTGTTAGCAGCCGGATCTCAGTGGTGGTGGTGGTGGTGGCA(SEQ ID No.12)

[0030] (2) Construction of Expression Vector

[0031] Using the above primers, PCR amplification was performed. The amplified product was subjected to gel extraction, and the recovered product was subjected to blunt-end T4 ligation to obtain the corresponding plasmid.

[0032] Table 2: PCR Amplification System

[0033] System Components Component Volume Primer F 2.5 μL Primer R 2.5 μL 2xSuperNova PCR Mix (Dye) 25 μL pET32a Plasmid 1 μL <![CDATA[ddH 2 O]]> To 50 μL

[0034] After preparing the PCR system, it was mixed well and centrifuged. The PCR amplification conditions were as follows: the first stage was pre-denaturation at 98°C for 30 s; the second stage was denaturation at 98°C for 10 s, annealing at 50-72°C for 30 s, extension at 72°C for 30 s / kb, with 33 cycles; the third stage was final extension at 72°C for 2 min. The above PCR product was recovered using a universal DNA purification kit (Tiangen Biochemical Technology Co., Ltd.) according to the operating steps of the product manual.

[0035] Table 3: Gibson Ligation System

[0036]

[0037]

[0038] After mixing the above components on ice, they were placed in a 50°C water bath for 60 min. The obtained ligation product was stored on ice or at -20°C for subsequent competent cell transformation.

[0039] The ligation product was transformed into the host bacterium E. coli - DH5α by heat shock method, spread on an LB culture resistance plate, incubated overnight at 37°C. Positive clones were randomly picked and cultured in LB liquid medium overnight at 37°C with 220 rpm shaking. Plasmids were extracted using a plasmid rapid extraction kit, and the successfully constructed plasmids pET32a - conotoxin - 1, pET32a - conotoxin - 2, and pET32a - conotoxin - 3 were obtained. Their plasmid maps are shown in Figure 1 .

[0040] (3) Construction of engineered bacteria

[0041] The above - obtained recombinant expression plasmids were transferred into Escherichia coli competent cells Origami B(DE3) by heat shock method, and positive Escherichia coli genetic engineering bacteria were screened. The specific process was as follows: ① Take 5 μL of the recombinant expression plasmid and add it to 100 μL of Escherichia coli competent cells Origami(DE3), and let it stand on ice for 30 min; ② Heat - shock the mixture in a 42°C water bath for 90 s, and then quickly place it on ice for 2 min; ③ Add 500 μL of antibiotic - free LB liquid medium (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride) to the mixture and culture it at 37°C with 220 rpm for 0.5 h; ④ Take 200 μL of the bacterial solution and evenly spread it on an LB solid medium plate containing ampicillin resistance (10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar, 50 μg / mL ampicillin); ⑤ Invert the plate and culture it in a 37°C incubator for about 16 h until clear colonies grow, and the corresponding engineered bacteria DE3 - pET32a - conotoxin - 1, DE3 - pET32a - conotoxin - 2, DE3 - pET32a - conotoxin - 3, and DE3 - pET32a - conotoxin - 4 were obtained.

[0042] Example 2: Induced expression of recombinant conotoxin

[0043] The single colonies on the above - mentioned plate were placed in an LB liquid medium containing ampicillin antibiotic and cultured at 37°C with 220 rpm for 12 h. This was the primary seed liquid. It was inoculated into a new LB medium at an inoculation amount of 1%, and cultured overnight at 37°C. This was the secondary seed liquid. Then it was inoculated into a new LB medium at an inoculation amount of 5% and cultured at 37°C until the OD 600 was 0.6 - 0.8. IPTG with a final concentration of 0.5 mM was added, and induction expression was carried out at 18°C for 20 h. Centrifuge at 4000 g and 4°C for 20 min to collect the bacterial cells.

[0044] The bacterial cells were resuspended in lysis buffer (20 mM Tris-HCl, 1 mM EDTA, 500 mM NaCl, pH 8.5), 100X protease inhibitor PMSF was added, and then the cells were disrupted by sonication for 30 min (sonication for 3 s with a 6-s interval) using a 360 W sonicator. After that, 1 mL of the disrupted solution was centrifuged at 4 °C and 10,000 g for 10 min. 80 μL of the supernatant was taken, the precipitate was resuspended in 1000 μL of lysis buffer, 80 μL of the resuspended solution was taken, and 20 μL of 5X protein loading buffer was added to both the supernatant and the precipitate. After mixing, they were heated in a boiling water bath for 10 min for SDS-PAGE electrophoresis, stained with Coomassie Brilliant Blue, decolorized, and the protein expression was observed. The results are shown in Table 3. Under the induction condition, the engineered bacteria DE3-pET32a-conopeptide-1, DE3-pET32a-conopeptide-2, DE3-pET32a-conopeptide-3, and DE3-pET32a-conopeptide-4 all had protein expression. According to the gray-scale analysis of the SDS-PAGE gel, the percentage of DE3-pET32a-conopeptide-1 in the total bacterial protein was 40%, and the protein expression level of DE3-pET32a-conopeptide-1 was higher than that of DE3-pET32a-conopeptide-2, DE3-pET32a-conopeptide-3, and DE3-pET32a-conopeptide-4.

[0045] Table 3: Results of Protein Expression Test

[0046] Conopeptide-1 Conopeptide-2 Conopeptide-3 Conopeptide-4 Amino Acid Length (AA) 34 34 34 29 Molecular Weight (kD) 3.8 3.7 3.8 3.4 Percentage of Total Bacterial Protein (%) 40 36 35 30 Soluble Expression Yes Yes Yes Yes

[0047] Example 3: Purification of Recombinant Conopeptide Expression Product

[0048] The disrupted solution obtained in Example 2 was centrifuged at 10,000 g and 4 °C for 30 min, and the supernatant was collected. The Ni affinity column material was washed with distilled water and equilibrated with buffer 1 (25 mM Tris, 200 mM NaCl, pH 8.0). The sample was loaded, and the column was rinsed with a washing buffer containing 20 mM imidazole (20 mM imidazole, 25 mM Tris, 200 mM NaCl, pH 8.0) to remove the impurity proteins, and the target protein was eluted with a solution containing 250 mM imidazole (250 mM imidazole, 25 mM Tris, 200 mM NaCl, pH 8.0). The column material was washed with a solution containing 1 M imidazole, then washed with distilled water, and finally filled with 20% ethanol.

[0049] The protein solution purified by the Ni affinity column was desalted by a desalting column to remove the high-concentration imidazole, and the purified recombinant conopeptide-1, conopeptide-2, conopeptide-3, and conopeptide-4 were obtained. After SDS-PAGE electrophoresis detection, there were fewer impurity proteins and the protein purity was high.

[0050] Example 4: Stability Test

[0051] The stability test was carried out on the recombinant conotoxin obtained in Example 3. The conotoxin-1 liquid was configured into a 1 mg / ml solution with endotoxin-free 1×PBS, filtered through a 0.22 μm filter membrane and then aliquoted into sterile centrifuge tubes, and placed at 45 °C and 25 °C respectively. Samples were taken on the 1st day, 3rd day, and 7th day for SDS-PAGE detection. The results are as Figure 2 shown. The degradation rates of conotoxin-1, conotoxin-2, and conotoxin-3 placed at 25 °C and 45 °C were within 20%, and there was no obvious degradation. Conotoxin-1 had the highest stability, and the stabilities of conotoxin-1, conotoxin-2, and conotoxin-3 were all significantly higher than that of conotoxin-4 without a linker at the front end. The results showed that adding a linker at the front end could significantly improve the stability of conotoxin, and conotoxin-4 was not used in the subsequent wrinkle removal effect test.

[0052] Example 5: Test on the wrinkle removal effect of recombinant conotoxin

[0053] The recombinant conotoxin-1, conotoxin-2, and conotoxin-3 obtained in Example 3 were used for the test. The concentration of the conotoxin-1 liquid was 50 ppm, and placebo (pure water) was used as the blank control. The sample was evenly coated on the test area, and no other cosmetics were used during the test. The immediate wrinkle removal effect of the sample was evaluated 15 minutes later. The results are as Figure 3 shown. After using recombinant conotoxin-1, the wrinkle depth of the subjects decreased significantly. It showed that recombinant conotoxin-1, conotoxin-2, and conotoxin-3 all had an immediate and significant wrinkle removal effect, and the effect of recombinant conotoxin-1 was more obvious than that of conotoxin-2 and conotoxin-3.

Claims

1. A Pro.ALP conopeptide for immediate anti-wrinkle and anti-line treatment, characterized in that: Its amino acid sequence is shown in any one of SEQ ID No. 1-3.

2. The gene encoding the Pro.ALP conopeptide according to claim 1.

3. The coding gene according to claim 2, characterized in that Its base sequence is shown in any one of SEQ ID No.5-7.

4. An expression vector expressing the Pro.ALP conopeptide according to claim 1.

5. The expression vector according to claim 4, characterized in that The vector is pET32a or pET30a.

6. An expression host bacterium, which is obtained by transforming the expression vector according to claim 4 or 5 into a host bacterium.

7. The expression host bacteria according to claim 6, characterized in that The host bacteria is Escherichia coli.

8. A method for biosynthesis of Pro.ALP conopeptide, characterized in that: The steps include: (1) constructing the expression vector according to claim 4 or 5, and transforming it into a host bacterium; (2) Cultivate the expression host bacteria and induce protein expression; (3) Purifying the expression product to obtain the Pro.ALP conopeptide described in claim 1.

9. The biosynthesis method according to claim 8, characterized in that In step (3), the protein is purified using a Ni affinity chromatography column.

10. Use of the Pro.ALP conopeptide according to claim 1 in the preparation of anti-wrinkle products.

Images