Cacna1h mutant and application thereof

Abstract

The invention belongs to the technical field of biology, and particularly relates to a Cacna1h mutant and application thereof. The invention discloses a Cacna1h protein mutant for the first time, and compared with a wild type Cacna1h protein, the Cacna1h protein mutant has the following mutations: p.S1436P; the mutant is related to the airway stenosis and can be used as a diagnosis and treatment target of the airway stenosis, diagnosis, monitoring, curative effect evaluation or prognosis evaluation can be performed on the airway stenosis by detecting the mutant, and the effect of preventing and treating the airway stenosis can be achieved by reversing the mutant into a wild type; the mutant can be used for constructing an airway stenosis animal model, compared with gene large fragment deletion in a traditional method, the mutant is more in line with a human gene mutation mode, and the obtained animal model is more in line with an animal disease model of human diseases.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a Cacna1h mutant and an application thereof. Background Art

[0002] The trachea starts from the Adam's apple and extends to the bronchi in the lungs. It is the only passage for mammals in the interior, including humans, to exchange breath. The human trachea is composed of cartilage, smooth muscle, connective tissue, and epithelium. It is about 13 cm long and 2 cm in diameter. It passes 30 to 120 liters of gas per minute, playing a role in purifying, moistening, and warming the inhaled air. Tracheal-related diseases include airway stenosis and airway collapse, which are one of the main factors threatening human health. At present, there are few animal models of airway stenosis. The establishment of a new animal model of airway stenosis is of great significance for clarifying the pathogenesis of airway stenosis and drug development.

[0003] Mice are currently a good model for studying mammalian airway stenosis: mice are closely related to humans, and the structure and morphology of their trachea are very similar to those of humans; techniques such as gene knockout and chemical mutagenesis can quickly and effectively establish a series of animal models of airway diseases (including airway stenosis). At present, people use gene knockout to establish animal models of airway stenosis, including Cacna1h gene knockout airway stenosis animal models, but they do not conform to the gene mutation mode of humans. In humans, gene point mutations mainly lead to abnormal gene function. Therefore, it is necessary to find the Cacna1h mutant or mutation site that causes airway stenosis. Summary of the invention

[0004] The first aspect of the present invention aims to provide a Cacna1h protein mutant.

[0005] The second aspect of the present invention aims to provide a Cacna1h gene mutant.

[0006] The third aspect of the present invention aims to provide an expression cassette, vector or cell comprising the Cacna1h gene mutant of the second aspect of the present invention.

[0007] The fourth aspect of the present invention aims to provide a reagent for detecting the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention for use in preparing a product for diagnosis, monitoring, efficacy evaluation, or prognosis evaluation of airway stenosis.

[0008] The fifth aspect of the present invention aims to provide a product for the diagnosis, monitoring, efficacy evaluation, or prognosis evaluation of airway stenosis.

[0009] The sixth aspect of the present invention aims to provide the use of the Cacna1h protein mutant of the first aspect of the present invention, the Cacna1h gene mutant of the second aspect of the present invention, or the expression cassette, vector or cell of the third aspect of the present invention in constructing an animal model of airway stenosis or preparing a product for constructing an animal model of airway stenosis.

[0010] The seventh aspect of the present invention aims to provide a method for constructing an animal model of airway stenosis.

[0011] The purpose of the eighth aspect of the present invention is to provide an application of the animal model constructed according to the seventh aspect of the present invention.

[0012] The ninth aspect of the present invention aims to provide use of an agent for specifically changing the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention in the preparation of a drug for preventing and / or treating airway stenosis.

[0013] The tenth aspect of the present invention aims to provide a pharmaceutical composition for preventing and / or treating airway stenosis.

[0014] In order to achieve the above object, the technical solution adopted by the present invention is:

[0015] The first aspect of the present invention provides a Cacna1h protein mutant, wherein the mutant has the following mutation compared to the wild-type Cacna1h protein: p.S1436P.

[0016] In some embodiments, the amino acid sequence of the wild-type Cacna1h protein is shown in SEQ ID NO:1.

[0017] The second aspect of the present invention provides a Cacna1h gene mutant, wherein the nucleotide sequence of the mutant is the sequence of a DNA encoding the Cacna1h protein mutant of the first aspect of the present invention.

[0018] In some embodiments, the mutant has the following mutation compared to the wild-type Cacna1h gene: c.T4036C.

[0019] In some embodiments, the nucleotide sequence of the wild-type Cacna1h gene is as shown in SEQ ID NO:2.

[0020] The third aspect of the present invention provides an expression cassette, vector or cell comprising the Cacna1h gene mutant according to the second aspect of the present invention.

[0021] In some embodiments, the vector includes a prokaryotic expression vector and a eukaryotic expression vector.

[0022] In some embodiments, the eukaryotic expression vector includes a yeast expression vector, a mammalian expression vector, an insect expression vector, and the like.

[0023] In some embodiments, the cells do not comprise propagation material.

[0024] In some embodiments, the cell is selected from a prokaryotic cell and a eukaryotic cell.

[0025] In some embodiments, the prokaryotic cells include bacterial cells, Escherichia coli, and Streptomyces.

[0026] In some embodiments, the eukaryotic cells include yeast cells, mammalian cells, insect cells, etc.

[0027] In some embodiments, the mammalian cells include CHO cells, 293 cells, 293T cells, Vero cells, BHK cells, NS0 cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells or hybridoma cells.

[0028] A fourth aspect of the present invention provides use of a reagent for detecting the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention in the preparation of a product for diagnosis, monitoring, efficacy evaluation, or prognosis evaluation of airway stenosis.

[0029] In some embodiments, the reagent for detecting the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention comprises a reagent for quantitatively detecting the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention.

[0030] In some embodiments, the reagent for detecting the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention comprises a reagent for detecting the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention at the gene level or protein level.

[0031] In some embodiments, the reagents include reagents for one or more detection techniques or methods selected from the following groups: immunohistochemistry, Western blotting, Northern blotting, PCR, biochip, nucleic acid sequencing, amino acid sequencing, high performance liquid chromatography, capillary gel electrophoresis, near infrared spectroscopy, mass spectrometry, surface plasmon resonance technology, immuno-PCR technology, biotin-avidin technology.

[0032] In some embodiments, the immunohistochemistry method comprises at least one of enzyme-linked immunosorbent assay, immunofluorescence assay, radioimmunoassay, co-immunoprecipitation, immunochemiluminescence, colloidal gold immunoassay, fluorescent immunochromatography, complement fixation analysis, flow cytometry fluorescence resolution, and single molecule detection technology.

[0033] In some embodiments, the reagent for detecting the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention is selected from:

[0034] An antibody, ligand protein, polypeptide, non-protein compound, or nucleic acid aptamer specific for the Cacna1h protein mutant of the first aspect of the present invention; or

[0035] Probes and primers specific to the Cacna1h gene mutant of the second aspect of the present invention.

[0036] In some embodiments, the antibody comprises at least one of a polyclonal antibody, a monoclonal antibody, a single-chain antibody, a functional antibody fragment, an antibody Fab region, a nanobody, a chimeric antibody, and a multispecific antibody.

[0037] In some embodiments, the product is a reagent, a kit, a test plate, a test paper, a device, a system, or a chip.

[0038] In some embodiments, the product further comprises other reagents for detecting the diagnosis, monitoring, efficacy evaluation, and / or prognosis evaluation of airway stenosis.

[0039] In some embodiments, the product further comprises auxiliary detection reagents for gene expression levels, and the auxiliary detection reagents for gene expression levels include: reaction reagents for visualizing the amplicons corresponding to the primers, RNA extraction reagents, reverse transcription reagents, cDNA amplification reagents, standard substances used to prepare standard curves, and at least one of positive controls.

[0040] In some embodiments, the product further comprises an auxiliary detection reagent for protein expression, and the auxiliary detection reagent for protein expression comprises at least one of a color developer, a blocking solution, an antibody diluent, a washing buffer, a color stop solution, a standard substance used to prepare a standard curve, and a positive control substance.

[0041] In some embodiments, the test sample of the product is selected from at least one of body fluids, tissues, cells, and excrement of the subject to be tested.

[0042] In some embodiments, the body fluid comprises at least one of blood, lymph, pleural effusion, cerebrospinal fluid, joint fluid, ascites, saliva, lymph, and body fluid.

[0043] In some embodiments, the blood comprises at least one of serum, plasma, dried blood spots, and whole blood.

[0044] In some embodiments, the excreta comprises at least one of urine, feces, and tears.

[0045] In some embodiments, the subject to be tested includes animals; further includes mammals, such as humans, cats, cows, sheep, pigs, dogs, chickens, ducks, geese, rabbits, and mice; further includes mice; and further includes mice.

[0046] A fifth aspect of the present invention provides a product for the diagnosis, monitoring, efficacy evaluation, or prognosis evaluation of airway stenosis, comprising: an antibody, ligand protein, polypeptide, non-protein compound, or nucleic acid aptamer specific to the Cacna1h protein mutant of the first aspect of the present invention; or

[0047] A probe or primer specific to the Cacna1h gene mutant of the second aspect of the present invention.

[0048] In some embodiments, the antibody comprises at least one of a polyclonal antibody, a monoclonal antibody, a single-chain antibody, a functional antibody fragment, an antibody Fab region, a nanobody, a chimeric antibody, and a multispecific antibody.

[0049] In some embodiments, the product is a reagent, a kit, a test plate, a test paper, a device, a system, or a chip.

[0050] In some embodiments, the product further comprises other reagents for detecting the diagnosis, monitoring, efficacy evaluation, and / or prognosis evaluation of airway stenosis.

[0051] In some embodiments, the product further comprises auxiliary detection reagents for gene expression levels, and the auxiliary detection reagents for gene expression levels include: reaction reagents for visualizing the amplicons corresponding to the primers, RNA extraction reagents, reverse transcription reagents, cDNA amplification reagents, standard substances used to prepare standard curves, and at least one of positive controls.

[0052] In some embodiments, the product further comprises an auxiliary detection reagent for protein expression, and the auxiliary detection reagent for protein expression comprises at least one of a color developer, a blocking solution, an antibody diluent, a washing buffer, a color stop solution, a standard substance used to prepare a standard curve, and a positive control substance.

[0053] In some embodiments, the test sample of the product is selected from at least one of body fluids, tissues, cells, and excrement of the subject to be tested.

[0054] In some embodiments, the body fluid comprises at least one of blood, lymph, pleural effusion, cerebrospinal fluid, joint fluid, ascites, saliva, lymph, and body fluid.

[0055] In some embodiments, the blood comprises at least one of serum, plasma, dried blood spots, and whole blood.

[0056] In some embodiments, the excreta comprises at least one of urine, feces, and tears.

[0057] In some embodiments, the subject to be tested includes animals; further includes mammals, such as humans, cats, cows, sheep, pigs, dogs, chickens, ducks, geese, rabbits, and mice; further includes mice; and further includes mice.

[0058] The sixth aspect of the present invention provides use of the Cacna1h protein mutant of the first aspect of the present invention, the Cacna1h gene mutant of the second aspect of the present invention, or the expression cassette, vector or cell of the third aspect of the present invention in constructing an animal model of airway stenosis or preparing a product for constructing an animal model of airway stenosis.

[0059] In some embodiments, the animal is a non-human mammal.

[0060] In some embodiments, the non-human mammal is a cat, a cow, a sheep, a pig, a dog, a chicken, a duck, a goose, a rabbit, or a mouse; further a mouse; and still further a mouse.

[0061] The seventh aspect of the present invention provides a method for constructing an airway stenosis animal model, wherein the animal carries the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention.

[0062] In some embodiments, the animal carries a homozygous mutation.

[0063] In some embodiments, the animal is a non-human mammal.

[0064] In some embodiments, the non-human mammal is a cat, a cow, a sheep, a pig, a dog, a chicken, a duck, a goose, a rabbit, or a mouse; further a mouse; and still further a mouse.

[0065] The eighth aspect of the present invention provides the use of the animal model constructed according to the seventh aspect of the present invention in any one of a1) to a2):

[0066] a1) Screening or developing drugs;

[0067] a2) Preparation of products for screening or development of drugs;

[0068] The medicament is used for preventing and / or treating airway stenosis.

[0069] The ninth aspect of the present invention provides use of an agent for specifically altering the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention in the preparation of a medicament for preventing and / or treating airway stenosis; the specific alteration is restoring the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention to the wild type.

[0070] In some embodiments, the reagent is a reagent based on at least one of the gene editing methods selected from single-base gene editing, zinc finger nuclease, transcription activator-like effector nuclease, CRISPR / Cas9, CRISPR / Cas9 combined with iPSC and AAV vector technology.

[0071] The tenth aspect of the present invention provides a pharmaceutical composition for preventing and / or treating airway stenosis, comprising: an agent for specifically changing the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention; the specific change is to restore the Cacna1h protein mutant of the first aspect of the present invention or the C acna1h gene mutant of the second aspect of the present invention to the wild type.

[0072] In some embodiments, the reagent is a reagent based on at least one of the gene editing methods selected from single-base gene editing, zinc finger nuclease, transcription activator-like effector nuclease, CRISPR / Cas9, CRISPR / Cas9 combined with iPSC and AAV vector technology.

[0073] In some embodiments, the pharmaceutical composition further comprises: a pharmaceutically acceptable carrier.

[0074] In some embodiments, the pharmaceutical composition further comprises: other active ingredients for preventing and / or treating airway stenosis.

[0075] The beneficial effects of the present invention are:

[0076] The present invention discloses for the first time a Cacna1h protein mutant, which has the following mutation compared with the wild-type Cacna1h protein: p.S1436P; the mutant is associated with airway stenosis and can be used as a target for the diagnosis and treatment of airway stenosis. By detecting the mutant, airway stenosis can be diagnosed, monitored, evaluated for efficacy, or evaluated for prognosis, and the effect of preventing and treating airway stenosis can be achieved by reversing the mutant to the wild type; and the mutant can be used to construct an airway stenosis animal model, which is more in line with the human gene mutation mode compared with the large gene fragment deletion in the traditional method (such as the deletion of introns and exons, although it can also lead to gene inactivation and establish a corresponding animal model, but this does not conform to the gene mutation mode in the human body, and may bring about some side effects that may be caused by the large fragment deletion, such as the deletion of some intron regions may cause changes in the expression of genes regulated by them and thus lead to unpredictable gene expression disorder results), and the obtained animal model is more in line with the animal disease model of human diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0077] Figure 1 The results showed that Cacna1h gene missense mutant mice (Cacna1h T4306C / T4306C ) showed obvious airway stenosis: a shows newborn wild-type mice and newborn mutant mice (Cacna1h T4306C / T4306C a shows the trachea of ​​newborn wild-type mice and newborn mutant mice (Cacna1h T4306C / T4306C a shows the Alcian blue staining of the trachea of ​​newborn wild-type mice and newborn mutant mice (Cacna1h T4306C / T4306C ) of complete tracheal rings; d shows the quantitative statistical results of newborn wild-type mice and newborn mutant mice (Cacna1h T4306C / T4306C ) of frozen sections of trachea (scale bar: 200 μm); e shows the trachea of ​​newborn wild-type mice and newborn mutant mice (Cacna1h T4306C / T4306C ) ; f shows the quantitative statistical results of tracheal width in newborn wild-type mice and newborn mutant mice (Cacna1h T4306C / T4306C ) of the tracheal lumen relative area; g shows the whole exon confirmation of the Cacna1h gene point mutation in the newly born airway stenosis mice (Cacna1h T4306C / T4306C ); h shows the confirmation of Cacna1h gene point mutation in newborn airway stenosis mice by first-generation sequencing (Cacna1h T4306C / T4306C ); i shows newborn wild-type mice and newborn Cacna1h gene knockout mice (Cacna1h - / -a shows Alcian blue staining of the trachea of ​​newborn wild-type mice and newborn Cacna1h double heterozygous mice (Cacna1h - / T4306C ) (Scale bar: 1000 μm); c, e, and f are based on 5 wild-type animals and 5-6 mutant animals, and the experiment and statistics were repeated 3 times.

[0078] Figure 2 The results showed that Cacna1h gene missense mutant mice (Cacna1h T4306C / T4306C ) showed obvious reduction in airway smooth muscle area and contractile dysfunction: a shows newborn wild-type mice and newborn mutant mice (Cacna1h T4306C / T4306C a shows the results of αSMA staining, a marker for tracheal smooth muscle, in wild-type mice and mutant mice (Cacna1h T4306C / T4306C ) is a graph of tracheal contraction force detection; b is based on 4 wild-type animals and 4 mutant animals, and the experiment and statistics were repeated 3 times.

[0079] Figure 3 It shows that the expression of Cacna1h protein in the airway tissue of clinical patients with airway stenosis is downregulated: wherein, a shows bronchoscopic airway images of healthy people and clinical patients with airway stenosis; b shows HE staining images of airway tissue of healthy people and clinical patients with airway stenosis (scale: 500μm); c shows Cacna1h antibody staining and cell nucleus DAPI staining images of airway tissue of healthy people and clinical patients with airway stenosis (scale: 50μm); d shows the quantitative analysis results of fluorescence intensity of Cacna1h antibody staining of airway tissue of healthy people and clinical patients with airway stenosis; e shows Cacna1h antibody immunohistochemical staining images of airway tissue of healthy people and clinical patients with airway stenosis (scale: 100μm); d is based on 5 healthy people and 6 clinical patients with airway stenosis, and the experiment and statistics were repeated 3 times. DETAILED DESCRIPTION

[0080] The present invention is further described in detail below through specific examples.

[0081] It should be understood that these embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0082] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer. The materials and reagents used in the examples are commercially available unless otherwise specified. The manufacturers of the reagents used are indicated, and similar products from other manufacturers are substitutes.

[0083]

[0084] cccaggccacgggccaccagactctgagtctgtgcacagtatctaccatgctgactgccacgtggaggggccacaggaaagagcccgtgtg

[0085] gcgcacaccatagccactgctgccagcctcaagctggcctcaggcttgggcaccatgaactaccccaccatcctaccttcaggagcagtcaa

[0086] cagcaaaggcagtaccagctcgcgacccaaggggcttcggagtgctggcaccccaggggccacagcacacagccctctgagcctgggga

[0087] gccccagcccctatgagaagatccagcacgtggttggagaacaaggactaggccgagcctctagtcacctgtcaggcctgagtgtgccttgc

[0088] cccctgcccagcccccaggctggcacactgacctgtgagctgaagagctgcccatattgtgccagcgccctggaggaccccgagtttgagtt

[0089] cagtggctcagagagtggggactcggatgcccatggagtctatgagtttacacaggacgtacggcatggggattgccgagatcctgtgcagc

[0090] agccccatgaagggggcacgccgggccatggcaacgaacggtggcggccaccactgcggacagcctcacagccaggagggttaggccg

[0091] cctctgggcttcctttagtagcaagctgcgtcgcattgtagacagcaagtacttcaaccgaggcatcatggcagccatcctcgtcaatactctga

[0092] gcatgggtgttgagtatcatgagcagcctgatgagctgactaacgcgctggagataagcaacatcgtgttcaccagcatgtttgccttggagat

[0093] gctactgaagttgctggcctgtggcccgctgggctacattcggaacccctacaacatctttgatggcattgttgtcatcataagcgtctgggagat

[0094] tgtggggcaggcagatggtggcctgtcagtgctccgtacgttccggctgctgcgggtgctgaagctggtgcgcttcctgccagccctgcggc

[0095] ggcagctggtggtgctcatgaggaccatggacaatgtggccaccttctgcatgctgctaatgctcttcatcttcatcttcagcatcctgggcatgc

[0096] acctgtttggctgtaagttcagcctgaagacagactctggagacaccgtccctgacaggaagaacttcgactctctactgtgggccatcgtcact

[0097] gtgtttcagatcttgacacaggaagactggaatgtggttctttacaacggcatggcttccacctcgtcctgggctgccctttactttgtggccctcat

[0098] gacctttgggaactatgtgctcttcaacctgctggtagccatcctggtggaaggcttccaggcagagggtgatgccaccagatctgacaccgat

[0099] gaggataagacatctacccacctagaggaagatttcgataagctcagagacgttcaagccacagagatgaagatgtactcactggctgtgacc

[0100] cctaatgggcacctagagggccgaggcagtctgccgccgcctctcatcacgcacacagcggctacgcctatgcctacccccaagagctccc

[0101] ctcatctggacatggcccacactcttttggactcacggcgcagcagcagtggctctgtggacccccaactcggggaccagaagtctctggcta

[0102] gcctgcgcagctccccttgtgccccatggggccccaacagtgcaggaagcagccggcgctccagctggaacagcctgggccgcgcaccc

[0103] agcctcaaacgccgcagccagtgtggggagcgcgagtccctgctctctggtgaggggaagggcagcacggatgatgaggccgaggacag

[0104] cagaccaaactcagggacccacccaggagcttcacccgggccccgggccacacccctgcggcgggctgagtcgttgggccaccgcagca

[0105] caatggacctgtgccccccacggcctgccaccctcctgcccaccaagttccgtgactgcaacgggcagatggtggccctgcccagcgagttc

[0106] ttcctgcgcatcgacagccacaaggaggacgcagcagagtttgatgatgacatagaagatagctgctgcttccgcctgcacaaagtgctgga

[0107] gccctatgcaccccagtggtgcagcagccgggagtcctgggccctgtatctcttcccgccgcagaacaggctacgcgtctcctgccagaaag

[0108] tcatcgcacacaagatgtttgaccacgtggtccttgtcttcatcttcctcaactgtatcaccattgccctggagaggccagacatcgatccgggca

[0109] gcactgaacgggcctttctcagcgtctccaactacatcttcacagccatcttcgtggtggagatgatggtgaaggtggtagccctggggctgct

[0110] gtggggtgagcatgcctacctgcagagcagctggaatgtgctggacgggctgcttgtcctggtgtccctggttgacatcattgtggccgtggcc

[0111] tctgccggtggtgccaagatcctaggcgtcctgcgcgtgctgcgcctgctgcggaccctgaggcctctgagggtcatcagccgagctccagg

[0112] cctcaagctggtcgtggagactctgatatcatcgctcaggcccatcgggaacatcgtcctcatctgctgcgccttcttcattatctttggcatcctc

[0113] ggggtgcagcttttcaagggcaaattctactactgcgagggtacagataccaggaatatcaccaccaaggccgagtgccatgccgcccacta

[0114] ccgctgggtgaggcgcaaatacaactttgacaacctgggtcaggcgctgatgtctctgttcgtgctgtcatccaaggatggctgggtaaacatc

[0115] atgtacgacgggctggacgccgtgggcatcgaccagcagcctgtgcagaaccacaacccctggatgctgctctacttcatctccttcctgctca

[0116]

[0117] The antibodies involved in the embodiments of the present invention and their sources and dilution multiples are as follows: αSMA-Cy3 antibody (1:1000, Sigma-Aldrich, C6198), CACNA1H antibody (1:400, Alomone Labs, ACC-025).

[0118] Example 1 Screening and identification of Cacna1h gene point mutation, i.e. missense mutation, mice (Cacna1h) using N-ethyl-N-nitrosourea chemical mutagenesis and whole exon sequencing T4306C / T4306C )

[0119] Eight-week-old C57BL / 6J wild male mice (purchased from Charles River) were selected and injected intraperitoneally with 100 mg / kg of N-ethyl-N-nitrosourea three times a week to induce mouse sperm gene mutation, which can be stably inherited to offspring. After 10 weeks of recovery, the mice after injection were mated with C57BL / 6J wild female mice to produce G1 generation mice. The G1 generation male mice produced were mated with C57BL / 6J wild female mice to generate G2 generation female mice. G2 generation female mice were mated with their G1 parents to produce G3 generation mice. The trachea of ​​G3 generation mice was dissected, and the trachea of ​​mice was detected by Alcain blue staining and hematoxylin-eosin staining (H&E) to determine whether airway stenosis occurred.

[0120] The specific steps of Alcian blue staining are as follows: the dissected trachea are fixed in 95% ethanol for 12 hours, then stained overnight with 0.03% Alcian blue dissolved in 80% ethanol and 20% acetic acid, and the trachea is washed in 2% KOH to remove background staining.

[0121] The specific steps of hematoxylin-eosin staining (H&E) are as follows: the frozen sections are stained in hematoxylin solution for 10 minutes, washed three times with deionized water for 5 minutes each time, differentiated with 1% hydrochloric acid ethanol, and washed three times with deionized water for 5 minutes each time. The sections are stained in eosin stain for 3 minutes, and then the sections are dehydrated in a gradient of 25%, 50%, 75%, 95% and anhydrous ethanol. The dehydrated tissue sample sections are soaked in xylene three times and finally sealed with neutral gum.

[0122] For mice with airway stenosis, tissue DNA was extracted for whole exome sequencing and Sanger sequencing to identify mutation sites and mutated genes.

[0123] The specific steps of whole exome sequencing analysis are as follows: Agilent SureSelect Mouse All Exonkit V1 was used to capture wild-type and mutant mouse exons and sequenced using Illumina HiSeq 2000. The sequence reads were aligned with the C57BL / 6J mouse genome (mm10) and analyzed using CLCBio Genomic Workbench and GATK software to find the mutation sites of the genes in the mutants.

[0124] Newborn (day 0 after birth) mutant mice (Cacna1h T4306C / T4306C ) and the bright field images of the trachea of ​​newborn wild-type mice Figure 1 Shown in middle a: Newborn mutant mice (Cacna1h T4306C / T4306C ) mice had significant tracheal stenosis; newborn mutant mice (Cacna1h T4306C / T4306C The results of Alcian blue staining of the trachea of ​​newborn wild-type mice are shown in the figure Figure 1 Compared with newborn wild-type mice, newborn mutant mice (Cacna1h T4306C / T4306C ) trachea showed more cartilage fractures, that is, newborn mutant mice (Cacna1h T4306C / T4306C ) were significantly smaller than those of newborn wild-type mice ( Figure 1 Newborn mutant mice (Cacna1h T4306C / T4306C The results of hematoxylin-eosin (H&E) staining of frozen sections of trachea of ​​) and newborn wild-type mice are shown in the figure. Figure 1 Compared with wild-type mice, newborn mutant mice (Cacna1h T4306C / T4306C ) trachea was significantly reduced, among which, newborn mutant mice (Cacna1h T4306C / T4306C ) Both the tracheal width and the relative area of ​​the tracheal lumen were significantly reduced ( Figure 1 e and f), where the tracheal width was measured as follows: the separated whole trachea was photographed in bright field using a Zeiss stereoscope (Z eiss AXIOZoom.V16), with the front end of the trachea at the top and the back end at the bottom. The tracheal width was measured using the software Image J (https: / / imagej.net / ), that is, the width of the outer lumen of the tracheal projection in the photographed image; the tracheal lumen area was measured as follows: the tracheal sections were stained with HE and photographed in bright field using a microscope (Leica DM6 B upright microscope). The tracheal lumen area was measured using the software Image J (https: / / imagej.net / ), that is, the area of ​​the inner lumen of the tracheal projection in the photographed image. Whole exome sequencing and first-generation sequencing confirmed the presence of Cacna1h gene point mutations (missense mutations, Cacna1h T4306C / T4306C , Figure 1 h, g; Cacna1h + / T4306C No airway stenosis was observed). The sequencing results showed that only this point mutation existed in the coding region and non-coding region of the gene. It can be seen that the homozygous Cacna1h gene point mutation (missense mutation, Cacna1h T4306C / T4306C ) can strongly inhibit the formation of trachea in newborn mice, leading to airway stenosis and tracheal cartilage rupture. T4306C / T4306C ) are mice with airway stenosis.

[0125] At the same time, the existing Cacna1h gene knockout mice (Cacna1h - / - ) (JAX, Strain #: 013770) were mated and the newborn Cacna1h gene knockout mice (Cacna1h - / - ) trachea was stained with Alcian blue (Alca in blue), and the results were as follows Figure 1 Figure i shows: Newborn Cacna1h gene whole body knockout mice (Cacna1h - / - ) also showed airway stenosis and tracheal cartilage rupture. A genetic complementation experiment was further conducted, using the Cacna1h point mutation heterozygous female mice induced above (Cacna1h + / T4306C , no airway stenosis) and Cacna1h gene knockout heterozygous male mice (Cacna1h + / - , no airway stenosis, Cacna1h gene knockout mice (Cacna1h - / - The newborn Cacna1h double heterozygous mice (Cacna1h) were produced by mating female C57BL / 6J wild-type mice (JAX, Strain#:013770) with C57BL / 6J wild-type male mice. - / T4306C ), in newborn Cacna1h double heterozygous mice (Cacna1h - / T4306C ) trachea was stained with Alcain blue. The results were as follows Figure 1 Figure j shows: Cacna1h double heterozygous mice (Cacna1h - / T4306C , the first day after birth) showed significant tracheal stenosis and tracheal cartilage fragmentation. This genetic complementation experiment finally confirmed that the Cacna1h point mutation (Cacna1h T4306C / T4306C ) leads to inactivation of the Cacna1h gene and airway narrowing.

[0126] α-SMA is a marker protein of smooth muscle cells. T4306C / T4306C) and whole-mount tracheas of newborn wild-type mice were immunostained as follows: tracheas were fixed in 4% paraformaldehyde overnight at 4°C, whole-mount tracheas were incubated in permeabilization solution (5% FBS / PBS / 0.5% Triton X-100 / 3% BSA) at 4°C for 12 hours, incubated in primary antibody at 4°C overnight, washed, incubated in secondary antibody at 4°C overnight, washed, and then mounted for imaging. Figure 2 Shown in middle a: Newborn mutant mice (Cacna1h T4306C / T4306C )The area of ​​tracheal smooth muscle was significantly reduced.

[0127] To examine the effects of the Cacna1h gene point mutation on tracheal physiology, the mutant mice (Cacna1h T4306C / T4306C ) and wild-type mice. The specific steps of acetylcholine-induced tracheal contraction are as follows: the isolated trachea is made into 2 mm thick tracheal rings and kept in Krebs solution (119 mM NaCl, 4.7 mM KCl, 2.5 mM CaCl2, 1.17 mM MgSO4, 20 mM NaHCO3, 1.18 mM KH2PO4, 0.027 mM EDTA, 11 mM glucose). The tracheal rings are mounted on a linear electromyography system (610-M, Danish Myo T echnology), and a resting tension of 2 mN is applied to each tracheal ring. Tracheal contraction is induced by adding acetylcholine, and the contractile force of the trachea is recorded at the same time. The results are shown in Figure 2 Middle b shows: mutant mice (Cacna1h T4306C / T4306C )'s tracheal contractility was significantly reduced.

[0128] Example 2.

[0129] The function of Cacna1h is evolutionarily conserved. Fiberoptic bronchoscopy was used to detect clinical patients with tracheostenosis and healthy controls (patients were from Guangzhou Women and Children's Medical Center, ethical approval number (120A01)). The results are as follows Figure 3 Shown in a: The airway lumen of a clinical patient with airway stenosis is significantly narrowed.

[0130] The airways of clinical patients with airway stenosis and healthy subjects were stained with hematoxylin-eosin (H&E) (see Example 1 for the method). The results are as follows: Figure 3 Shown in middle b: The airway lumen of a clinical patient with airway stenosis is significantly narrowed.

[0131] The airways of clinical patients with airway stenosis and healthy subjects were stained with Cacna1h antibody and cell nucleus DAPI. Figure 3 As shown in c and d, the expression of Cacna1h protein in the airway of clinical patients with airway stenosis was significantly decreased.

[0132] The airways of clinical patients with airway stenosis and healthy subjects were immunohistochemically stained with Cacna1h antibody (see Example 1 for the method). The results are as follows Figure 3 As shown in middle e: The expression of Cacna1h protein in the airway of clinical patients with airway stenosis is significantly decreased.

[0133] The technical solution of the present invention is not limited to the above-mentioned specific embodiments. All technical variations made according to the technical solution of the present invention fall within the protection scope of the present invention.

Claims

1. A Cacna1h protein mutant, wherein the mutant has the following mutation compared to the wild-type Cacna1h protein: p.S1436P.

2. A Cacna1h gene mutant, wherein the nucleotide sequence of the mutant is the sequence of the DNA encoding the Cacna1h protein mutant according to claim 1.

3. The Cacna1h gene mutant according to claim 2, characterized in that: Compared with the wild-type Cacna1h gene, the mutant has the following mutations: c.T4036C; Preferably, the nucleotide sequence of the wild-type Cacna1h gene is as shown in SEQ ID NO:

2.

4. An expression cassette, vector or cell comprising the Cacna1h gene mutant according to any one of claims 2 to 3; Preferably, the vector includes a prokaryotic expression vector and a eukaryotic expression vector; Preferably, the cells do not comprise propagation material.

5. Use of a reagent for detecting the Cacna1h protein mutant according to claim 1 or the Cacna1h gene mutant according to any one of claims 2 to 3 in the preparation of a product for diagnosis, monitoring, efficacy evaluation, or prognosis evaluation of airway stenosis.

6. The use according to claim 5, characterized in that: The reagent for detecting the Cacna1h protein mutant of claim 1 or the Cacna1h gene mutant of any one of claims 2-3 comprises a reagent for detecting the Cacna1h protein mutant of claim 1 or the Cacna1h gene mutant of any one of claims 2-3 at the gene level or protein level; Preferably, the reagents include reagents for one or more detection techniques or methods selected from the group consisting of immunohistochemistry, Western blotting, Northern blotting, PCR, biochip, nucleic acid sequencing, amino acid sequencing, high performance liquid chromatography, capillary gel electrophoresis, near infrared spectroscopy, mass spectrometry, surface plasmon resonance, immuno-PCR, biotin-avidin technology; Preferably, the immunohistochemistry method comprises at least one of enzyme-linked immunosorbent assay, immunofluorescence assay, radioimmunoassay, immunocoprecipitation, immunochemiluminescence, colloidal gold immunoassay, fluorescent immunochromatography, complement fixation analysis, flow cytometry fluorescence resolution, and single molecule detection technology; Preferably, the reagent for detecting the Cacna1h protein mutant according to claim 1 or the Cacna1h gene mutant according to any one of claims 2-3 is selected from: An antibody, ligand protein, polypeptide, non-protein compound, or nucleic acid aptamer specific for the Cacna1h protein mutant of claim 1; or A probe or primer specific to the Cacna1h gene mutant according to any one of claims 2 to 3; Preferably, the antibody comprises at least one of a polyclonal antibody, a monoclonal antibody, a single-chain antibody, a functional antibody fragment, an antibody Fab region, a nanobody, a chimeric antibody, and a multispecific antibody; Preferably, the product is a reagent, a test kit, a test plate, a test paper, a device, a system, or a chip; Preferably, the product further comprises detecting other reagents for diagnosis, monitoring, efficacy evaluation, and / or prognostic evaluation of airway stenosis; Preferably, the product further comprises a gene expression auxiliary detection reagent, wherein the gene expression auxiliary detection reagent comprises: a reaction reagent for visualizing the amplicon corresponding to the primer, an RNA extraction reagent, a reverse transcription reagent, a cDNA amplification reagent, a standard substance for preparing a standard curve, and at least one of a positive control substance; Preferably, the product further comprises an auxiliary detection reagent for protein expression, wherein the auxiliary detection reagent for protein expression comprises at least one of a color developer, a blocking solution, an antibody diluent, a washing buffer, a color stop solution, a standard substance for preparing a standard curve, and a positive control substance; Preferably, the test sample of the product is selected from at least one of body fluids, tissues, cells and excrement of the subject to be tested.

7. A method for constructing an animal model of airway stenosis, wherein the animal carries the Cacna1h protein mutant of claim 1 or the Cacna1h gene mutant of any one of claims 2-3; Preferably, the animal is a non-human mammal; Preferably, the non-human mammal is a cat, a cow, a sheep, a pig, a dog, a chicken, a duck, a goose, a rabbit, or a mouse; further a mouse; and further a mouse.

8. Any application of b1) to b3): b1) Use of the Cacna1h protein mutant according to claim 1, the Cacna1h gene mutant according to any one of claims 2 to 3, or the expression cassette, vector or cell according to claim 4 in constructing an animal model of airway stenosis or preparing a product for constructing an animal model of airway stenosis; b2) Use of the animal model constructed by the method of claim 7 in any one of a1) to a2): a1) Screening or developing drugs; a2) Preparation of products for screening or development of drugs; The drug is used to prevent and / or treat airway stenosis; b3) Use of an agent for specifically changing the Cacna1h protein mutant described in claim 1 or the Cacna1h gene mutant described in any one of claims 2-3 in the preparation of a drug for preventing and / or treating airway stenosis; the specific change is to restore the Cacna1h protein mutant described in claim 1 or the Cacna1h gene mutant described in any one of claims 2-3 to the wild type.

9. The use according to claim 8, characterized in that: The animal in b1) is a non-human mammal; Preferably, the non-human mammal is a cat, a cow, a sheep, a pig, a dog, a chicken, a duck, a goose, a rabbit, or a mouse; further a mouse; Preferably, the reagent described in b3) is a reagent based on at least one of the gene editing methods selected from single-base gene editing, zinc finger nuclease, transcription activator-like effector nuclease, CRISPR / Cas9, CRISPR / Cas9 combined with iPSC and AAV vector technology.

10. Any one of products c1)-c2): c1) A product for diagnosis, monitoring, efficacy evaluation, or prognosis evaluation of airway stenosis, comprising: an antibody, ligand protein, polypeptide, non-protein compound, or nucleic acid aptamer specific to the Cacna1h protein mutant of claim 1; or A probe or primer specific to the Cacna1h gene mutant according to any one of claims 2 to 3; c2) A product for preventing and / or treating airway stenosis, comprising: an agent for specifically changing the Cacna1h protein mutant according to claim 1, or the Cacna1h gene mutant according to any one of claims 2-3; the specific change is to restore the Cacna1h protein mutant according to claim 1, or the Cacna1h gene mutant according to any one of claims 2-3 to the wild type; the product is a pharmaceutical composition; Preferably, the antibody in c1) comprises at least one of a polyclonal antibody, a monoclonal antibody, a single-chain antibody, a functional antibody fragment, an antibody Fab region, a nanobody, a chimeric antibody, and a multispecific antibody; Preferably, the product in c1) is a reagent, a test kit, a test plate, a test paper, a device, a system, or a chip; Preferably, the product described in c1) further comprises other reagents for the diagnosis, monitoring, efficacy evaluation, and / or prognosis evaluation of airway stenosis; Preferably, the product in c1) further comprises a gene expression auxiliary detection reagent, wherein the gene expression auxiliary detection reagent comprises: At least one of a reaction reagent for visualizing the amplicon corresponding to the primer, an RNA extraction reagent, a reverse transcription reagent, a cDNA amplification reagent, a standard substance for preparing a standard curve, and a positive control substance; Preferably, the product in c1) further comprises an auxiliary detection reagent for protein expression, wherein the auxiliary detection reagent for protein expression comprises at least one of a color developer, a blocking solution, an antibody diluent, a washing buffer, a color stop solution, a standard substance for preparing a standard curve, and a positive control substance; Preferably, the test sample of the product in c1) is selected from at least one of body fluids, tissues, cells, and excrement of the subject to be tested; Preferably, the reagent in c2) is a reagent based on at least one of the gene editing methods selected from single-base gene editing, zinc finger nuclease, transcription activator-like effector nuclease, CRISPR / Cas9, CRISPR / Cas9 combined with iPSC and AAV vector technology; Preferably, the pharmaceutical composition described in c2) further comprises: a pharmaceutically acceptable carrier; Preferably, the pharmaceutical composition described in c2) further comprises: other active ingredients for preventing and / or treating airway stenosis.

Images