High-affinity pseudo-antibody targeting type 2 diabetes related protein FABP4 as well as preparation method and application of high-affinity pseudo-antibody

Abstract

The invention discloses a high-affinity pseudo-antibody targeting type 2 diabetes related protein FABP4 as well as a preparation method and application of the high-affinity pseudo-antibody. The method comprises the following steps: constructing a pseudo-antibody skeleton CBody on the basis of a bacillus licheniformis cellulase Ig-like structural domain, then establishing a pseudo-antibody library on the basis of the pseudo-antibody skeleton CBody, and screening a pseudo-antibody 6F6 atCBody targeting type 2 diabetes associated protein FABP4 from the pseudo-antibody library, the nucleotide sequence of the pseudo-antibody 6F6 atCBody being as shown in SEQ ID No.7, and the amino acid sequence of the pseudo-antibody 6F6 atCBody being as shown in SEQ ID No.8. Compared with a conventional full-length antibody, the quasi-antibody 6F6 atCBody provided by the invention has the advantages that the molecular weight is much smaller, the tissue permeability is better, the ability of combining an epitope with a steric hindrance effect is better, the quasi-antibody 6F6 atCBody can be massively expressed in a prokaryotic expression system, the period is short, and the production cost is low. The 6F6-coated CBody has high affinity for the type 2 diabetes related protein FABP4, has a good application prospect, and can be used for detection, diagnosis or treatment of type 2 diabetes.

Description

Technical Field

[0001] The present invention belongs to the field of biomedical engineering technology, and specifically relates to a high-affinity pseudo-antibody targeting the type 2 diabetes-associated protein FABP4, and a preparation method and application thereof. Background Art

[0002] Antibodies are immunoglobulins (Igs) produced by plasma cells derived from B lymphocytes or memory B cells in response to antigenic stimulation, specifically binding to their corresponding antigens. Antibodies play a broad and important role in both biotechnology and disease diagnosis and treatment, and related research areas have become a hot topic. The advantages of antibodies are primarily reflected in their high specificity, diversity, and targeted specificity. However, as research deepens, their inherent limitations have become apparent: ① Antibodies are large in size, resulting in poor penetration into tissues and solid tumors; ② The small size of the Fv region of the antigen-binding site leads to unstable binding between the light and heavy chains, making recombinant expression difficult and restricting their application; ③ The Fv region is composed of six variable regions from the heavy and light chains, limiting structural diversity when preparing fully synthetic antibody libraries; and ④ Glycosylated antibody drugs must be expressed in eukaryotic cell lines, which is time-consuming and costly.

[0003] Given the shortcomings of antibodies, the search for antibody-like or non-antibody scaffold drugs has become a new focus of basic research and technological innovation. Ideal non-antibody scaffold proteins typically possess a small size, a compact and thermally stable structure, and a variable surface area. Compared to traditional antibody drugs, antibody-like scaffold drugs offer key advantages such as intracellular stability, weak immune effects, oral absorption, and low cost, making them a hot area of ​​drug development.

[0004] Protein mimetics are polypeptides, modified peptides, or other molecules that mimic the biological functions or activities of other proteins and are commonly used in drug design and discovery. Protein mimetics are divided into antibody mimetics (antibody mimics or antibody mimics), peptide mimics, and phospho-mimics. Antibody mimics can specifically bind to antigens but are not related to antibodies in terms of molecular structure. They are usually artificial proteins (peptides) with a molecular weight of 2 to 20 kDa (a full-length antibody is approximately 150 kDa). Nucleic acids and small molecules are sometimes also considered antibody mimics, but they are not artificial antibodies or antibody fragments and their fusion proteins. Mimetic antibodies also possess high affinity and specificity for their targets, making them easy to screen. Compared to traditional antibodies, they offer three key advantages: ① Their smaller protein backbones, enhanced tissue penetration, and lower immunogenicity make them more suitable for finding binding sites difficult for antibodies to reach, offering advantages in treating solid tumors or producing inhaled drugs. ② They are more resistant to thermal and enzymatic degradation, can be expressed or synthesized in large quantities in bacteria and yeast in highly soluble forms, are easily modified, and have relatively low production costs. Mimetic antibodies can, to a certain extent, address the limitations of traditional antibody therapies, and their unique advantages and potential applications are becoming increasingly prominent as their development and application progress.

[0005] The protein scaffolds of mimic antibodies are obtained by screening specific target molecules from a library of genetically engineered scaffold proteins. Recent research has seen significant progress. The Academy of Military Medical Sciences has made exploratory efforts in the research and development of scaffold proteins. Du Jianfang et al. constructed a scaffold peptide library using thioredoxin Trx as a scaffold by inserting random peptide fragments into the protruding loop region. Zhao An et al. displayed a modified insect defensin A on the surface of a bacteriophage. In 2009, the U.S. FDA approved Kalbitor (ecallantide) manufactured by Dyax for the prevention of hereditary angioedema attacks. In May 2017, AstraZeneca launched Boston Pieris Pharmaceuticals' anticalin asthma drug PRS-060 (mimetic antibody) into clinical trials. In March 2019, progress was made in the application of orally available anti-influenza mimetic antibodies in mouse studies. This mimetic antibody targets a conserved epitope on influenza HA (Hemagglutinin, hemagglutinin), possesses antibody functional characteristics in vitro and in vivo, and exhibits high affinity and broad-spectrum binding activity comparable to the influenza neutralizing antibody CR6261.

[0006] Microbial proteins are an important source of mimetic antibody backbones. For example, the backbone of Affibody is derived from the Z domain of Staphylococcus aureus Protein A, and the backbone of Affitin is derived from the Sac7d protein of Sulfolobus acidocaldarius. This demonstrates the importance of microbial protein backbones in the development of mimetic antibody backbones. Bacillus sp. can survive in environments such as high temperatures and saline-alkali environments. Some strains are even isolated directly from extreme environments and are often used as a source for screening enzymes that are tolerant to these conditions.

[0007] Cellulase Cel5B from Bacillus licheniformis ATCC 14580 (PDB ID: 4YZP), like Cel5B from B. halodurans (PDB ID: 4V2X), and CelB from Bacillus sp. BG-CS10 (PDB ID: 5E0C), contains three domains, with an additional Ig-like domain between the catalytic domain and the carbohydrate-binding module CBM46. The Ig-like fold is a ubiquitous fold found not only in antibodies but also in many other proteins. For example, the cadherin domain adopts an Ig-like fold topology. Through structural comparative analysis, we found that the Ig-like domain of three-domain cellulases such as cellulases has structural similarities with antibody fragments (single-domain antibody VH, nanoantibodies CH2 and CH3). Its three loop regions (structurally corresponding to the complementarity determining region (CDR) of antibodies) can be designed and developed into mimetic antibody frameworks, which have the natural advantage of being transformed into the underlying framework of mimetic antibodies.

[0008] Fatty acid binding protein 4 (FABP4), also known as adipocyte fatty acid binding protein (A-FABP) or adipocyte protein 2 (aP2), is expressed in multiple species and is a highly conserved protein that primarily promotes the storage, distribution, transport, breakdown, and metabolism of lipids. FABP4 facilitates the transport and storage of fatty acids within cells, playing a crucial role in energy balance in adipose tissue. It regulates lipid metabolism by assisting in the mobilization of fatty acids, enabling their use as an energy source during fasting or when energy demand is high. It also binds to vitamin A and lauric acids. The FABP4 protein contains a hydrophobic pocket specifically designed to bind long-chain fatty acids. Elevated levels of FABP4 in the body are a contributing factor to metabolic diseases, including cardiovascular, respiratory, and neurological disorders. Increased FABP4 levels may aggravate insulin resistance and glucose intolerance, and have been listed as a common risk factor for type 2 diabetes mellitus (T2DM) and coronary heart disease (CHD).

[0009] Therefore, detecting FABP4 levels can be used to predict and diagnose metabolic diseases (such as type 2 diabetes and coronary heart disease), assess disease risks, and monitor treatment effects, providing a scientific basis for early intervention and treatment process evaluation of related diseases. Summary of the Invention

[0010] The purpose of the present invention is to provide a high-affinity mimetic antibody targeting type 2 diabetes-associated protein FABP4 and its preparation method and application.

[0011] To achieve the above object, the present invention adopts the following technical solutions:

[0012] The present invention first provides a pseudo-antibody framework CBody constructed based on the Ig-like domain of Bacillus licheniformis cellulase, wherein the pseudo-antibody framework CBody is a quadruple mutant of the Ig-like domain protein, and its amino acid sequence is shown in SEQ ID No. 6; the pseudo-antibody framework CBody has three antigen-binding loop regions similar to the functions of antibody complementary determinants: loop 1, loop 2 and loop 3; the amino acid sequence of loop 1 is positions 28-34 of SEQ ID No. 6, the amino acid sequence of loop 2 is positions 52-58 of SEQ ID No. 6, and the amino acid sequence of loop 3 is positions 86-92 of SEQ ID No. 6.

[0013] The method for preparing a pseudo-antibody library based on the pseudo-antibody framework CBody comprises the following steps:

[0014] (1) Using primers to amplify and splice the pseudo-antibody gene fragments with CBody as the backbone, the fragments were connected and inserted into the shuttle vector to form the pseudo-antibody gene library;

[0015] (2) The pseudo-antibody gene library was electroporated into E. coli competent cells, and the helper phage M13KO7 was used to infect the E. coli carrying the pseudo-antibody gene library to obtain the phage surface displayed pseudo-antibody library, and the library capacity of the phage surface displayed pseudo-antibody library was evaluated.

[0016] Based on the CBody mimetic antibody library constructed above, a mimetic antibody 6F6@CBody targeting the type 2 diabetes-related protein FABP4 was screened out, whose nucleotide sequence is shown in SEQ ID No.7 and amino acid sequence is shown in SEQ ID No.8.

[0017] Furthermore, the preparation method of the mimetic antibody 6F6@CBody targeting the type 2 diabetes-related protein FABP4 comprises the following steps:

[0018] (1) Constructing a prokaryotic expression vector containing the gene sequence of the type 2 diabetes-related protein FABP4, expressing the FABP4 protein, and isolating and purifying the obtained protein FABP4;

[0019] (2) Using purified FABP4 protein as the antigen, a phage surface-displayed mimetic antibody library with CBody as the backbone was screened, and a high-affinity, specific binding mimetic antibody clone was obtained through multiple rounds of panning;

[0020] (3) The pseudoantibody clone was expressed and purified to obtain a high-affinity pseudoantibody 6F6@CBody targeting the type 2 diabetes-related protein FABP4. The pseudoantibody 6F6@CBody has three antigen-binding regions, loop1, loop2 and loop3, wherein the amino acid sequence of loop1 is positions 28-35 of SEQ ID No.8, the amino acid sequence of loop2 is positions 53-59 of SEQ ID No.8, and the amino acid sequence of loop3 is positions 87-97 of SEQ ID No.8.

[0021] The present invention also provides an antigen-binding fragment or a mimetic antibody derivative, which is the following A1) or A2):

[0022] A1): an antigen-binding fragment or mimetic antibody derivative with an amino acid sequence as shown in SEQ ID No. 8;

[0023] A2): An antigen-binding fragment or mimetic antibody derivative obtained by linking a protein tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID No. 8.

[0024] The present invention also provides a biomaterial, which is any one of the following:

[0025] B1): a nucleic acid molecule encoding the mimetibody 6F6@CBody according to claim 3 or the antigen-binding fragment according to claim 5;

[0026] B2): an expression cassette containing the nucleic acid molecule described in B1);

[0027] B3): a recombinant vector containing the nucleic acid molecule described in B1);

[0028] B4): a recombinant vector containing the expression cassette described in B2);

[0029] B5): A recombinant microorganism containing the nucleic acid molecule described in B1);

[0030] B6): A recombinant microorganism containing the expression cassette described in B2);

[0031] B7): A recombinant microorganism containing the recombinant vector described in B3);

[0032] B8): A recombinant microorganism containing the recombinant vector described in B4).

[0033] Furthermore, the nucleic acid molecule as described in B1) has three antigen-binding loop regions: loop1, loop2 and loop3, the encoding gene of loop1 is nucleotides 82-105 of SEQ ID No.7; the encoding gene of loop2 is nucleotides 157-177 of SEQ ID No.7; and the encoding gene of loop3 is nucleotides 259-291 of SEQ ID No.7.

[0034] Furthermore, the nucleic acid molecule as described in B1) is any one of the following:

[0035] C1): a DNA molecule with a nucleotide sequence as shown in SEQ ID No. 7;

[0036] C2): A DNA molecule that hybridizes with the DNA molecule defined in C1) under stringent conditions and encodes the mimetibody 6F6@CBody;

[0037] C3): A DNA molecule that has more than 80% homology with the DNA sequence defined in either C1) or C2) and encodes the mimetibody 6F6@CBody.

[0038] The method for preparing the antigen-binding fragment or the mimetic antibody derivative comprises the following steps: introducing a nucleic acid molecule encoding the antigen-binding fragment or the mimetic antibody derivative into a recipient cell to obtain a transgenic cell expressing the antigen-binding fragment or the mimetic antibody derivative, and culturing the transgenic cell to obtain the antigen-binding fragment or the mimetic antibody derivative, wherein the nucleotide sequence of the nucleic acid molecule is as shown in SEQ ID No. 7.

[0039] The present invention also provides an ELISA detection kit targeting the type 2 diabetes-related protein FABP4, wherein the kit comprises the pseudoantibody 6F6@CBody, or the antigen-binding fragment or pseudoantibody derivative, or the biomaterial.

[0040] The present invention also provides any of the following applications:

[0041] D1): Use of the mimetic antibody 6F6@CBody, or the antigen-binding fragment, or the biomaterial, or the kit in the preparation of a product for detecting the type 2 diabetes-associated protein FABP4;

[0042] D2): Use of the mimetic antibody 6F6@CBody, or the antigen-binding fragment, or the biomaterial, or the kit in the preparation of a product that binds to the type 2 diabetes-associated protein FABP4;

[0043] D3): Use of the mimetic antibody 6F6@CBody or the antigen-binding fragment in the preparation of a detection reagent for the type 2 diabetes-associated protein FABP4;

[0044] D4): Use of the mimetic antibody 6F6@CBody or the antigen-binding fragment in the preparation of a diagnostic reagent for type 2 diabetes;

[0045] D5): Use of the mimetic antibody 6F6@CBody or the antigen-binding fragment in the preparation of a drug for preventing and / or treating type 2 diabetes.

[0046] The present invention adopts the above technical solution to construct a pseudo-antibody skeleton based on the Ig-like domain of Bacillus licheniformis cellulase, and then construct a pseudo-antibody library based on the pseudo-antibody skeleton. The pseudo-antibody skeleton construction method provided by the present invention is conducive to mining pseudo-antibody skeletons from microbial proteins, and the high-affinity pseudo-antibody 6F6@CBody targeting the type 2 diabetes-related protein FABP4 screened from the phage surface-displayed pseudo-antibody CBody library can be used for the detection, diagnosis or treatment of type 2 diabetes. The pseudo-antibody 6F6@CBody has a much smaller molecular weight (about 11.5 kDa) than conventional full-length antibodies (molecular weight of about 150 kDa), has better tissue permeability and the ability to bind to antigenic epitopes with steric hindrance effects, can be expressed in large quantities in a prokaryotic expression system, has a short cycle, and has low production costs. The 6F6@CBody screened by the present invention has a high affinity (EC 50 ≈10nM), and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 This is a protein detection diagram of the purified type 2 diabetes-related protein FABP4; (A): SDS-PAGE gel image; (B): Western Blotting image.

[0048] Figure 2 It is the tertiary structure and structural superposition of nanoantibodies and Ig-like domain proteins; (AC): three-dimensional structure of nanoantibody VH, CH2 and CH3; (DF): three-dimensional structure of Ig-like domain proteins of cellulases BlCel5B, BhCel5B and BsCel5B; (GI): structural superposition of the Ig-like domain of cellulase BlCel5B and nanoantibody VH, CH2 and CH3; (J): amino acid sequence alignment of the Ig-like domain of BlCel5B and the VH, CH2 and CH3 domains of the antibody fragment based on protein structure, in which the conserved amino acid residues are marked with red boxes.

[0049] Figure 3Schematic diagram of the mutation site in the Ig-like domain and the expression of wild-type and mutant proteins; (A): Schematic diagram of the structural position of the mutation site in the Ig-like domain; (B): SDS-PAGE detection diagram of the wild-type and mutant proteins after purification.

[0050] Figure 4 The Tm values ​​of wild-type and mutant Ig-like domain proteins were determined using NanoTemper.

[0051] Figure 5 This is an SDS-PAGE detection diagram of the wild-type and mutant Ig-like domain proteins' tolerance to different concentrations of DTT.

[0052] Figure 6 This is a graph showing hemolysis detection of wild-type and mutant Ig-like domain proteins.

[0053] Figure 7 The phage surface display of the pseudo antibody CBody library construction; (A): the pseudo antibody CBody library was diluted 10 8 Colonies on the plate after multiple dilution; (B): CBody library of pseudo-antibodies diluted 10 9 Colonies on the plate after multiple folds; (C): CBody library of pseudo-antibodies diluted 10 10 Colonies on the plate after multiple folds; (D): CBody library of pseudo-antibodies diluted 10 11 After multiples, spread the colonies on the plate.

[0054] Figure 8 This is the SDS-PAGE detection image of the protein after purification of 6F6@CBody mimetic antibody.

[0055] Figure 9 It is an ELISA test to determine the binding of the pseudoantibody 6F6@CBody to the type 2 diabetes-related protein FABP4. DETAILED DESCRIPTION

[0056] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0057] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0058] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0059] SEQ ID No. 1: Nucleotide sequence of type 2 diabetes-associated protein FABP4

[0060] SEQ ID No. 2: Amino acid sequence of type 2 diabetes-associated protein FABP4

[0061] SEQ ID No. 3: Nucleotide sequence of the Ig-like domain of cellulase Cel5B from Bacillus licheniformis ATCC 14580

[0062] SEQ ID No. 4: Amino acid sequence of the Ig-like domain of Bacillus licheniformis ATCC 14580 cellulase Cel5B

[0063] SEQ ID No.5: Nucleotide sequence of the pseudoantibody backbone CBody

[0064] SEQ ID No.6: Amino acid sequence of the pseudoantibody backbone CBody

[0065] SEQ ID No.7: Nucleotide sequence of the mimetic antibody 6F6@CBody targeting type 2 diabetes-associated protein FABP4

[0066] SEQ ID No.8: Amino acid sequence of the mimetic antibody 6F6@CBody targeting type 2 diabetes-associated protein FABP4

[0067] SEQ ID No. 9: Nucleotide sequence of FLAG tag

[0068] SEQ ID No. 10: Amino acid sequence of FLAG tag

[0069] Example 1 Expression and purification of type 2 diabetes-related protein FABP4

[0070] Codon optimization was performed based on the amino acid sequence of the human type 2 diabetes-associated protein FABP4 (GenBank: CAG33184.1). The codon-optimized base sequence is shown in SEQ ID No. 1. The codon-optimized base sequence was inserted between the restriction enzyme sites BamHI and HindIII of the vector pET-28a(+) (Novagen, Catalog No. 69864), and ligated to construct the prokaryotic expression vector pET28a-FABP4.

[0071] The nucleotide sequence (ie, coding sequence) of pET28a-FABP4 is the codon-optimized nucleotide sequence of FABP4 of SEQ ID No. 1 in the sequence listing, and the expressed amino acid sequence is the fusion protein of SEQ ID No. 2 in the sequence listing with a histidine tag at the C-terminus.

[0072] 10 ng of the recombinant vector pET28a-FABP4 was transformed into Escherichia coli BL21 (DE3) competent cells (NEWENGLAND Biolabs, Catalog No.: C2527H). Positive clones were screened with kanamycin hydrochloride and verified by PCR, enzyme digestion, or sequencing. The successfully verified positive clone recombinant strain was named BL21-pET28a-FABP4.

[0073] The recombinant strain BL21-pET28a-FABP4 was inoculated into LB liquid medium (Luria-Bertani broth, containing 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl) containing kanamycin hydrochloride at a final concentration of 50 μg / mL, and the OD 600 When the p-value reaches 0.6-0.8, add IPTG to a final concentration of 0.2 mmol / L and induce at 16°C, 200 rpm for 16-20 hours. Collect the induced cells expressing the protein by centrifugation at 6000 rpm for 20 minutes at 4°C, and resuspend the pellet in PBS buffer. Disrupt the cells by ultrasonication in an ice-water bath, centrifuge at 12000 rpm for 30 minutes at 4°C, collect the supernatant, and after affinity binding with Ni-NTA packing, elute the purified protein through an imidazole gradient and dialyze to remove the imidazole.

[0074] The purity of the purified protein was verified by SDS-PAGE. Figure 1 It can be seen that the protein obtained by purification and elution of the supernatant after the recombinant strain BL21-pET28a-FABP4 bacterial liquid was broken had a clear target protein size band, and the purified protein was verified by Western Blotting to be the type 2 diabetes-related protein FABP4 containing a His tag at the C-terminus.

[0075] Example 2 Design and construction of a mimetic antibody skeleton based on the underlying protein of the Bacillus licheniformis cellulase Ig-like domain

[0076] The Ig-like domain of Bacillus licheniformis ATCC 14580 cellulase Cel5B was selected as the bottom protein ( Figure 2), its amino acid sequence is SEQ ID No.4, and its coding gene sequence is SEQ ID No.3; it corresponds to the loop sequence of the three CDR regions of the single-domain antibody VH or nanobody CH2 / CH3: the gene sequence encoding loop1 is from positions 82 to 102 of SEQ ID No.3, and the amino acid sequence is from positions 28 to 34 of SEQ ID No.4; the gene sequence encoding loop2 is from positions 154 to 174 of SEQ ID No.3, and the amino acid sequence is from positions 52 to 58 of SEQ ID No.4; the gene sequence encoding loop3 is from positions 256 to 276 of SEQ ID No.3, and the amino acid sequence is from positions 86 to 92 of SEQ ID No.4.

[0077] Based on the resolved protein structure (PDB ID: 4YZP), the structural characteristics of the non-loop region of the Ig-like domain (i.e., the Framework region, abbreviated as FR) were analyzed, and the stability of the underlying protein of the pseudo-antibody was further improved by constructing intramolecular disulfide bonds. The 27th isoleucine, the 37th isoleucine, the 50th tyrosine, the 59th valine, and the 84th phenylalanine of SEQ ID No. 4 were mutated to cysteine, so that I37C and Y50C, F84C and I27C or V59C can form intramolecular disulfide bonds ( Figure 3 A) The expression plasmid of the mutant was obtained by designing site-directed mutagenesis primers and rolling circle PCR.

[0078] (1) Construction of expression plasmids for the wild-type and mutant Ig-like domains of Bacillus licheniformis cellulase. The primers for constructing the mutants and wild-type are as follows:

[0079] I27C_F:5'-GATCAGACGTGGACTGTCAGCTGAACGGCAATGTG-3'

[0080] I27C_R: 5'-GCCGTTCAGCTGACAGTCCACCGTCTGATCGCTGATG-3'

[0081] I37C_F:5'-AAGTGTGCTGACTGGCTGTTATCAGAAATCTGAACC-3'

[0082] I37C_R:5'-GATTTCTGATAACAGCCAGTCAGCACATTGCCG-3'

[0083] Y50C_F:5'-AAGGAAGGCAGTGATTGTACAGTTGACAATGCC-3'

[0084] Y50C_R:5'-TTGTCAACTGTACAATCACTGCCTTCCTTTAATGG-3'

[0085] V59C_F:5'-GCCGGAAAAACGTGCTCTATTAAGGCATCCTGC-3'

[0086] V59C_R:5'-TGCCTTAATAGAGCACGTTTTTCCGGCATTGTC-3'

[0087] F84C_F:5'-GCGCAGCTCACTTGTACGTTTCATAAAGGAGCC-3'

[0088] F84C_R: 5'-TTTATGAAACGTACAAGTGAGCTGCGCTTTTACCC-3'

[0089] Ig-like_F:5'-ATAGGCCCAGGCGGCCGGCGTTCCCAATGCGATCATC-3'

[0090] Ig-like_R:5'-GCCGGCCGGCCTGGCCATCATAAAGAATGATATCC-3'

[0091] The steps for constructing wild-type and mutant expression plasmids of the Ig-like domain of Bacillus licheniformis ATCC 14580 cellulase Cel5B are as follows:

[0092] The Ig-like domain gene fragment was amplified using the nucleotide sequence of B. licheniformis ATCC 14580 cellulase Cel5B (GenBank: AAU23417.1) as a template using a primer pair (Ig-like_F and Ig-like_R). After digestion with SfiI restriction endonuclease (New England Biolabs, Catalog No. R0123L), the fragment was ligated into the phagemid vector pComb3XSS (Addgene, Catalog No. 63890) also digested with SfiI to construct the wild-type expression plasmid pComb3XSS-Ig-like for the Ig-like domain.

[0093] The mutant expression plasmids pComb3XSS-Ig-like-I27C, pComb3XSS-Ig-like-I37C, pComb3XSS-Ig-like-Y50C, pComb3XSS-Ig-like-V59C, and pComb3XSS-Ig-like-F84C were amplified using primer pairs (I27C_F and I27C_R), (I37C_F and I37C_R), (Y50C_F and Y50C_R), (V59C_F and V59C_R), and (F84C_F and F84C_R) with the wild-type expression plasmid pComb3XSS-Ig-like as template. The templates were digested with DpnI enzyme (New England Biolabs, cat. no. R0176S) and then transformed into Escherichia coli DH5α (New England Biolabs, cat. no. R0176S). Biolabs, catalog number: C2987H) competent cells, screened positive clones and sequenced for identification. Then, the single mutant recombinant plasmid pComb3XSS-Ig-like-I37C was used as a template and Y50C_F and Y50C_R were used as primers to amplify the double mutant recombinant plasmid pComb3XSS-Ig-like-I37C-Y50C; the single mutant recombinant plasmid pComb3XSS-Ig-like-F84C was used as a template and I27C_F and I27C_R, V59C_F and V59C_R were used as primers to amplify the double mutant recombinant plasmids pComb3XSS-Ig-like-I27C-F84C and pComb3XSS-Ig-like-V59 C-F84C; then, the double mutant recombinant plasmid pComb3XSS-Ig-like-I27C-F84C was used as a template and I37C_F and I37C_R were used as primers to amplify the triple mutant recombinant plasmid pComb3XSS-Ig-like-I27C-I37C-F84C; finally, the triple mutant recombinant plasmid pComb3XSS-Ig-like-I27C-I37C-F84C was used as a template and Y50C_F and Y50C_R were used as primers to amplify the quadruple mutant recombinant plasmid pComb3XSS-Ig-like-I27C-I37C-Y50C-F84C. All mutant recombinant plasmids were digested with DpnI enzyme (New England Biolabs, Catalog No.: R0176S) before being transformed into Escherichia coli DH5α (New England Biolabs, Catalog No.: C2987H) competent cells, and positive clones were screened and sequenced for identification.

[0094] (2) Protein expression and purification of wild-type and mutant Ig-like domains

[0095] 20 ng of sequencing-verified wild-type or mutant recombinant plasmid was transformed into competent E. coli HB2151 (Agilent Life Sciences, Cat. No. 930684). Positive clones verified by PCR and 2% agarose gel electrophoresis or enzyme digestion were used for protein expression. The specific steps are as follows:

[0096] The recombinant strain was inoculated into SB liquid medium (SuperBroth, containing 32 g / L tryptone, 20 g / L yeast extract, 5 g / L NaCl) containing ampicillin at a final concentration of 100 μg / mL, and the OD 600 When the p-value reaches 0.6-0.8, add IPTG with a final concentration of 0.1mmol / L and induce at 16℃, 200rpm for 16-20 hours. Centrifuge at 4℃, 6000rpm for 10min to collect the induced bacteria and resuspend the bacterial pellet in PBS buffer. Ultrasonicate the bacteria in an ice water bath, collect the supernatant by centrifugation, pass it through Ni-NTA filler, and obtain the purified protein by imidazole gradient elution. The imidazole is removed by dialysis. The purity is verified by SDS-PAGE ( Figure 3 B) After the recombinant strain induced expression, the supernatant was purified and eluted, and a clear target protein band was found in the protein. The protein expression level of the mutant was generally higher than that of the wild type.

[0097] (3) Stability determination of wild-type and mutant Ig-like domain proteins

[0098] The protein was diluted to 0.1 mg / mL using the NanoTemper (NanoTemper Technologies, model: Prometheus NT.48) instrument. The temperature range was set to 25-95°C with a temperature increase of 1°C / min. The thermal stability and unfolding temperature (Tm value) of the expressed and purified Ig-like domain wild-type recombinant protein, mutant recombinant proteins Ig-like-I37C-Y50C, Ig-like-I27C-F84C, Ig-like-V59C-F84C, and Ig-like-I27C-I37C-Y50C-F84C were measured, and the corresponding Tm values ​​were measured. The results were 51.9℃, 57.5℃, 52.5℃, 45.6℃ and 59.0℃ respectively, indicating that the double mutation of I37C and Y50C is very beneficial to protein stability, which is 5.6℃ higher than that of the wild type; the double mutation of I27C and F84C slightly improves protein stability, while the double mutation of V59C and F84C is not conducive to protein stability; the recombinant protein of the quadruple mutant Ig-like-I27C-I37C-Y50C-F84C, which is I27C, I37C, Y50C and F84C, has the strongest stability, which is 7.1℃ higher than that of the wild type ( Figure 4 ).

[0099] (4) Evaluation of the ability of wild-type and mutant Ig-like domain proteins to resist reducing environments

[0100] Since cysteine ​​was artificially introduced into the mutant of the underlying protein of the Ig-like domain in order to form a disulfide bond to increase the stability of the protein, it is necessary to evaluate the ability of the disulfide bond to resist the reducing environment. According to the method of the literature (Kun Qu, et al. PLOS Pathogens, 2022, 18 (7): e1010583), the wild-type and mutant proteins of the Ig-like domain were mixed and incubated in PBS at room temperature with final concentrations of 0, 2.5, 5, 10 and 20 mM dithiothreitol (DTT) for 60 minutes, and then 55 mM iodoacetamide was added in the dark for 10 minutes to alkylate the free cysteine ​​residues. The reaction mixture was mixed with 4× non-reducing loading buffer and analyzed by SDS-PAGE ( Figure 5 The results showed that the wild type Ig-like domain protein and its mutants Ig-like-I27C-F84C and Ig-like-I27C-I37C-Y50C-F84C had strong tolerance to reducing environment.

[0101] (5) Analysis of hemolytic ability of wild-type and mutant Ig-like domain proteins

[0102] In order to evaluate whether the mimetic antibody has the potential toxicity of causing red blood cell rupture (hemolysis), rabbit red blood cells were used to measure the hemolytic ability of the mimetic antibody at different concentrations, Triton X-100 was used as the positive control, and PBS was used as the negative control. The Ig-like domain wild type and mutant proteins with an initial concentration of 10 μM were diluted in a 2-fold concentration gradient and mixed with an equal volume of 6% rabbit red blood cells. The positive control Triton X-100 had an initial concentration of 1% (v / v) and was diluted in a 2-fold concentration gradient and mixed with an equal volume of 6% rabbit red blood cells. The negative control PBS was mixed with an equal volume of 6% rabbit red blood cells and then incubated at 37°C for 1 hour. After the incubation, centrifuge at 1,000×g for 3 minutes and observe hemolysis with the naked eye. If the solution is clear red, there are no cells remaining at the bottom or a small amount of red blood cells remaining, it indicates that hemolysis has occurred; if all the red blood cells sink and the supernatant is colorless and clear, it indicates that no hemolysis has occurred. The results show that ( Figure 6 ), neither the wild-type nor the mutant Ig-like domain proteins showed hemolysis.

[0103] After comprehensive analysis of the properties of the wild type and modified mutants, the quadruple mutant Ig-like-I27C-I37C-Y50C-F84C with significantly improved stability was selected as the mimetic antibody framework and named CBody. Example 3 Construction and selection of mimetic antibody library based on mimetic antibody framework CBody

[0104] The pseudo-antibody framework CBody ( Figure 3 ) Construct a pseudoantibody library, the amino acid sequence of the pseudoantibody CBody is SEQ ID No. 6, and the encoding gene sequence is SEQ ID No. 5. CBody corresponds to the three loop region sequences of the CDR region of the single-domain antibody VH: the gene sequence encoding loop 1 is from positions 82 to 102 of SEQ ID No. 5, and the amino acid sequence is from positions 28 to 34 of SEQ ID No. 6; the gene sequence encoding loop 2 is from positions 154 to 174 of SEQ ID No. 5, and the amino acid sequence is from positions 52 to 58 of SEQ ID No. 6; the gene sequence encoding loop 3 is from positions 256 to 276 of SEQ ID No. 5, and the amino acid sequence is from positions 86 to 92 of SEQ ID No. 6.

[0105] Referring to the literature (Caucheteur D, et al., Methods Mol Biol. 2018, 1827: 93-108; Bobkov V, et al., Methods Mol Biol, 2018, 1827: 129-144; Kuroda D, et al., Methods Mol Biol, 2018, 1827: 15-34; Moreno E, et al., BMC Res Notes, 2022, 15(1): 124.), primers were designed for the loop region and a phage surface display library was constructed ( Figure 7 AD) and was applied to the screening of pseudo-antibodies against the type 2 diabetes-related protein FABP4.

[0106] The primers for constructing the phage surface display pseudo-antibody library are as follows:

[0107] FR1_F: 5'-GAGGCGGGGCCCAGGCGGCCGGCGTTCCCAATGCGATC-3';

[0108] FR1_R: 5'-ACAGTCCACCGTCTGATCG-3';

[0109] loop1_F:5'-CGATCAGACGGTGGACTGT NNNACTGGCTGTTATCAGAA ATCTG-3' (series length primer, where N is any base of A, T, C, or G, and the number of N is an integer multiple of 3, and the multiple is an integer between 5 and 8);

[0110] loop1_R: 5'-TTTCTGATAACAGCCAGT NNN ACAGTCCACCGTCTGATC-3' (series length primer, where N is any base of A, T, C, or G, and the number of N is an integer multiple of 3, and the multiple is an integer between 5 and 8);

[0111] FR2_F: 5'-ACTGGCTGTTATCAGAAATC-3';

[0112] FR2_R: 5'-TGTACAATCACTGCCTTCC-3';

[0113] loop2_F: 5'-GAAGGCAGTGATTGTACA NNN GTCTCTATTAAGGCATCC-3' (series length primer, where N is any base of A, T, C, or G, and the number of N is an integer multiple of 3, and the multiple is an integer between 6 and 10);

[0114] loop2_R: 5'-GGATGCCTTAATAGAGAC NNN TGTACAATCACTGCCTTC-3' (series length primer, where N is any base of A, T, C, or G, and the number of N is an integer multiple of 3, and the multiple is an integer between 6 and 10);

[0115] FR3_F: 5'-GTCTCTATTAAGGCATCCTG-3';

[0116] FR3_R: 5'-CGTACAAGTGAGCTGCGC-3';

[0117] loop3_F: 5'-GCGCAGCTCACTTGTACG NNN GTTATGGATATCATTC-3' (series length primer, where N is any base of A, T, C, or G, and the number of N is an integer multiple of 3, and the multiple is an integer between 7 and 15);

[0118] loop3_R: 5'-GTGGCCGGCCTGGCCATCATAAAGAATGATATCCATAAC NNNCGTACAAGTGAGCTGCGC-3' (series length primer, wherein N is any base of A, T, C, or G, and the number of N is an integer multiple of 3, and the multiple is an integer between 7 and 15);

[0119] The steps for constructing the pseudo-antibody CBody library are as follows:

[0120] 1) Using primer pairs (FR1_F and FR1_R), (FR2_F and FR2_R), (FR3_F and FR3_R) and CBody nucleotide (SEQ ID No. 3) as templates, PCR amplified the FR1, FR2, and FR3 gene fragments, respectively; using primer pairs (loop1_F and loop1_R), (loop2_F and loop2_R), (loop3_F and loop3_R) and CBody nucleotide (SEQ ID No. 3) as templates, PCR amplified the loop1, loop2, and loop3-FR4 gene mutation fragments, respectively, using GeneMorph II-Random Mutagenesis Kits (Aglient, Catalog No.: 200550) (refer to the kit instructions for the operating steps). The PCR amplification products were recovered using a PCR product kit (QIAGEN, Catalog No.: 28006). The FR1-loop1 gene fragment was amplified using FR1 and loop1 as templates and FR1_F and loop1_R as primers; the FR2-loop2 gene fragment was amplified using FR2 and loop2 as templates and FR2_F and loop2_R as primers; the FR3-loop3-FR4 gene fragment was amplified using FR3 and loop3-FR4 as templates and FR3_F and loop3_R as primers. The products obtained by PCR amplification were recovered using a PCR product kit (QIAGEN, product number: 28006).

[0121] 2) The FR1-loop1-FR2-loop2 gene fragment was amplified using FR1-loop1 and FR2-loop2 as templates and FR1_F and loop2_R as primers; the FR3-loop3-FR4 gene fragment was amplified using FR3-loop3-FR4 as a template and FR3_F and loop3_R as primers. The PCR products were recovered using a PCR product kit (QIAGEN, Cat. No. 28006).

[0122] 3) Using FR1-loop1-FR2-loop2 and FR3-loop3-FR4 as templates and FR1_F and loop3_R as primers, the full-length mutant fragment of the pseudo-antibody CBody gene was amplified. After digestion with SfiI restriction endonuclease (New England Biolabs, Catalog No.: R0123L), the fragment was ligated into the phagemid vector pComb3XSS (Addgene, Catalog No.: 63890) that had also been digested with SfiI to construct the pComb3XSS-CBody pseudo-antibody library recombinant vector. The vector was then electroporated into Escherichia coli TG1 competent cells (Agilent, Catalog No.: 200123) and infected with helper phage M13KO7 (New England Biolabs, Catalog No.: N0315S) to obtain a phage surface-displayed pseudo-antibody library with a storage capacity of up to 4×10 11 pfu / mL( Figure 7 ).

[0123] The purified type 2 diabetes-associated protein FABP4 was coated as an antigen in 96-well plates and incubated overnight at 4°C. The CBody mimetic antibody library displayed on the phage surface was used for panning to obtain phage mimetic antibody candidate clones that specifically bound to the antigen. After six rounds of screening, one mimetic antibody clone was enriched and named mimetic antibody 6F6@CBody.

[0124] After sequencing, the amino acid sequence of the pseudoantibody 6F6@CBody was obtained as SEQ ID No.8, and its encoding gene sequence was SEQ ID No.7. The loop sequences corresponding to the single-domain antibody VH complementary determining clusters CDR1, CDR2 and CDR3 were numbered according to the amino acid sequence; among them, the nucleotide sequence of loop1 was SEQ ID No.7, positions 82-105: GGCTTCAGCCTGAGCACCTACTAC; the amino acid sequence was SEQ ID No.8, positions 28-35: GFSLSTYY; the nucleotide sequence of loop2 was SEQ ID No.7, positions 157-177: ATCTACCCTTCTGGTTCTACG; the amino acid sequence was SEQ ID No.8, positions 53-59: IYPSGST; the nucleotide sequence of loop3 was SEQ ID No.7, positions 259-291: GACAACGACGGCACTAGCGGTTACCTGTCCGGT; the amino acid sequence was SEQ ID No.8, positions 87-97: DNDGTSGYLSG.

[0125] Example 4 Expression and purification of mimetic antibody 6F6@CBody

[0126] The pseudo-antibody 6F6@CBody gene targeting the type 2 diabetes-related protein FABP4 was fused with the FLAG tag gene (Merck) and inserted between the multiple cloning sites NcoI and XhoI of the vector pET-28a(+) (Novagen, catalog number: 69864), and the expression vector pET28a-6F6@CBody-FLAG was constructed.

[0127] The structure of the expression vector pET28a-6F6@CBody-FLAG is described as follows: A small fragment between the NcoI and XhoI restriction endonuclease sites in pET-28a(+) is replaced with a DNA molecule containing a 6F6@CBody nucleotide fragment (nucleotide sequence: SEQ ID No. 7 and SEQ ID No. 9 connected) carrying a FLAG tag, while the other nucleotides in pET-28a(+) remain unchanged. This results in a recombinant expression vector carrying a FLAG tag. The expression vector pET28a-6F6@CBody-FLAG contains a nucleotide sequence (i.e., coding sequence) for the recombinant 6F6@CBody-FLAG protein gene, formed by connecting the 6F6@CBody gene (SEQ ID No. 7) and the FLAG tag gene (SEQ ID No. 9). It expresses a fusion protein with the amino acid sequence of SEQ ID No. 8 and SEQ ID No. 10.

[0128] Transform 10 ng of the expression vector pET28a-6F6@CBody-FLAG into competent E. coli BL21(DE3) cells. Screen for positive clones and verify them by PCR, 2% agarose gel electrophoresis, enzyme digestion, or sequencing. Successful recombinant strains are designated as recombinant strains BL21-pET28a-6F6@CBody-FLAG.

[0129] The recombinant strain BL21-pET28a-6F6@CBody-FLAG was inoculated into LB medium containing kanamycin hydrochloride at a final concentration of 50 μg / mL, and the OD 600 When the p-value reaches 0.6-0.8, add IPTG to a final concentration of 0.1 mmol / L and induce at 16°C, 180 rpm for 16-20 hours. Collect the induced cells expressing the protein by centrifugation at 6000 rpm for 15 minutes at 4°C, and resuspend the pellet in PBS buffer. Disrupt the cells by ultrasonication in an ice-water bath, collect the supernatant by centrifugation, and apply affinity binding to Ni-NTA packing. Purify the mimic antibody protein by imidazole gradient elution, and dialyze to remove the imidazole. Verify the purity of the target protein by SDS-PAGE.

[0130] Depend on Figure 8It can be seen that after the recombinant strain BL21-pET28a-6F6@CBody-FLAG was broken, the supernatant purified and eluted proteins contained a clear target protein size band, and the protein purity was very high; the molecular weight was about 12kDa, which was consistent with the theoretical molecular weight, that is, the 6F6@CBody mimic antibody fusion protein containing a FLAG tag at the C-terminus was expressed and purified.

[0131] Example 5 ELISA determination of the binding ability of the mimetic antibody 6F6@CBody to the type 2 diabetes-related protein FABP4

[0132] FABP4 (10 μg / mL), a His-tagged type 2 diabetes-associated protein obtained in Example 1, was coated onto a 96-well plate and incubated overnight at 4°C. The plate was then blocked with 1% (w / v) BSA at 37°C for 1 hour. A serial dilution of 6F6@CBody, a FLAG-tagged mimetic protein obtained in Example 4, was added (0, 50, 100, 150, and 200 nM). The plate was incubated at 37°C for 2 hours and then washed four times with PBS + 0.05% (v / v) Tween 20. Horseradish peroxidase (HRP)-conjugated anti-FLAG tag mouse monoclonal antibody (Sigma, Cat. No. A8592) was then added and incubated at 37°C for 1 hour. The plate was then washed four times with PBS + 0.05% (v / v) Tween 20. The mimetic antibody backbone, CBody, served as a negative control. The mimetic antibody backbone CBody is a protein with the amino acid sequence of SEQ ID No. 6, i.e., the bottom protein Ig-like quadruple mutant (I27C / I37C / Y50C / F84C) in Example 2, obtained by prokaryotic expression and purification. The mimetic antibody backbone CBody was prepared according to the following steps:

[0133] The nucleotide sequence of the mimetic antibody backbone CBody (SEQ ID No. 5) was concatenated with the FLAG tag gene (Merck, SEQ ID No. 9) and synthesized by Beijing Qingke Biotechnology Co., Ltd. The nucleotide sequence was ligated to the multiple cloning sites NcoI and XhoI of the pET-22b(+) vector (Novagen, Catalog No. 69744) to construct the expression vector pET22b-CBody-FLAG.

[0134] The structure of the pET22b-CBody-FLAG vector is described as follows: a DNA molecule containing a CBody nucleotide fragment (nucleotide sequence of SEQ ID No. 5 and SEQ ID No. 9 connected) carrying a FLAG tag replaces the small fragment between the NcoI and XhoI restriction endonuclease sites in pET22b(+), while keeping the other nucleotides in pET-22b(+) unchanged. The resulting recombinant vector expressing the FLAG tag is described as follows. The recombinant vector pET22b-CBody-FLAG contains a nucleotide sequence (i.e., coding sequence) that is a recombinant CBody-FLAG protein gene formed by connecting the CBody gene (SEQ ID No. 5) and the FLAG tag gene (SEQ ID No. 9) in the sequence listing. The expressed amino acid sequence is the fusion protein CBody-FLAG of SEQ ID No. 6 and SEQ ID No. 10 in the sequence listing.

[0135] Transform 10 ng of the plasmid (pET22b-CBody-FLAG) into competent E. coli BL21(DE3) cells. Screen for positive clones and verify by PCR, 2% agarose gel electrophoresis, enzyme digestion, or sequencing. Successfully validated recombinant strains are designated as recombinant strains BL21-pET22b-CBody-FLAG.

[0136] The recombinant strain BL21-pET22b-CBody-FLAG was inoculated into LB liquid medium containing ampicillin at a final concentration of 100 μg / mL, and the OD 600 When the p-value reaches 0.6-0.8, add IPTG to a final concentration of 0.1 mmol / L and induce at 16°C, 180 rpm for 16-20 hours. Collect the induced cells by centrifugation at 6000 rpm for 15 minutes at 4°C, and resuspend the pellet in PBS buffer. Disrupt the cells by ultrasonication in an ice-water bath, collect the supernatant by centrifugation, and purify over Ni-NTA media and dialyze to remove imidazole.

[0137] ELISA results Figure 9 As shown, the EC of the mimetic antibody 6F6@CBody(■) binding to the type 2 diabetes-related protein FABP4 50 The concentration of the negative control mimetic antibody CBody (▼) was about 10 nM, while the negative control mimetic antibody skeleton CBody (▼) could not interact with the FABP4 protein, indicating that the interaction between the mimetic antibody 6F6@CBody and the FABP4 protein was specific binding.

[0138] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. A pseudo-antibody framework CBody constructed based on the Ig-like domain of Bacillus licheniformis cellulase, characterized in that: The pseudo-antibody skeleton CBody is a quadruple mutant of the Ig-like domain protein, and its amino acid sequence is shown in SEQ ID No.

6.

2. A method for preparing a mimetic antibody library based on the mimetic antibody framework CBody according to claim 1, characterized in that: The steps include: (1) Using primers to amplify and splice the pseudo-antibody gene fragments with CBody as the backbone, and then connect and insert them into the shuttle vector to form a pseudo-antibody gene library; (2) The pseudo-antibody gene library was electroporated into competent E. coli cells, and the helper phage M13KO7 was used to infect the E. coli carrying the pseudo-antibody gene library to obtain the phage surface displayed pseudo-antibody library, and the library capacity of the phage surface displayed pseudo-antibody library was evaluated.

3. A pseudo-antibody 6F6@CBody targeting type 2 diabetes-related protein FABP4, characterized in that: The nucleotide sequence is shown in SEQ ID No.7, and the amino acid sequence is shown in SEQ ID No.

8.

4. The method for preparing a mimetic antibody 6F6@CBody targeting a type 2 diabetes-related protein FABP4 according to claim 3, characterized in that: The steps include: (1) constructing a prokaryotic expression vector containing the gene sequence of type 2 diabetes-related protein FABP4, expressing FABP4 protein, and isolating and purifying the FABP4 protein; (2) Using purified FABP4 protein as an antigen, a phage surface-displayed pseudo-antibody library with CBody as a backbone was used for screening, and a high-affinity specific binding pseudo-antibody clone was obtained through multiple rounds of panning; (3) Expressing and purifying the pseudoantibody clone, a high-affinity pseudoantibody 6F6@CBody targeting the type 2 diabetes-related protein FABP4 was obtained. The pseudoantibody 6F6@CBody has three antigen-binding regions, loop1, loop2 and loop3, wherein the amino acid sequence of loop1 is positions 28-35 of SEQ ID No.8, the amino acid sequence of loop2 is positions 53-59 of SEQ ID No.8, and the amino acid sequence of loop3 is positions 87-97 of SEQ ID No.

8.

5. An antigen-binding fragment or a mimetic antibody derivative, characterized in that: It is the following A1) or A2): A1): an antigen-binding fragment or a mimetic antibody derivative with an amino acid sequence as shown in SEQ ID No. 8; A2): An antigen-binding fragment or a pseudo-antibody derivative obtained by connecting a protein tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID No.

8.

6. A biomaterial, characterized in that It is any of the following: B1): a nucleic acid molecule encoding the mimetibody 6F6@CBody according to claim 3 or the antigen-binding fragment according to claim 5; B2): an expression cassette containing the nucleic acid molecule described in B1); B3): a recombinant vector containing the nucleic acid molecule described in B1); B4): a recombinant vector containing the expression cassette described in B2); B5): A recombinant microorganism containing the nucleic acid molecule described in B1); B6): A recombinant microorganism containing the expression cassette described in B2); B7): a recombinant microorganism containing the recombinant vector described in B3); B8): A recombinant microorganism containing the recombinant vector described in B4).

7. The biomaterial according to claim 6, characterized in that: The nucleic acid molecule as described in B1) has three antigen-binding loop regions: loop1, loop2 and loop3, the coding gene of loop1 is nucleotides 82-105 of SEQ ID No.7; the coding gene of loop2 is nucleotides 157-177 of SEQ ID No.7; the coding gene of loop3 is nucleotides 259-291 of SEQ ID No.

7.

8. The biomaterial according to claim 6 or 7, characterized in that: The nucleic acid molecule as described in B1) is any one of the following: C1): a DNA molecule with a nucleotide sequence as shown in SEQ ID No.7; C2): A DNA molecule that hybridizes with the DNA molecule defined in C1) under stringent conditions and encodes the mimetic antibody 6F6@CBody; C3): A DNA molecule that has more than 80% homology with any of the DNA sequences defined in C1) or C2) and encodes the mimetic antibody 6F6@CBody.

9. An ELISA detection kit targeting type 2 diabetes-related protein FABP4, characterized in that: The kit comprises the mimetic antibody 6F6@CBody as described in claim 3, or comprises the antigen-binding fragment or mimetic antibody derivative as described in claim 5, or comprises the biomaterial as described in claim 6.

10. Any of the following applications: D1): Use of the mimetic antibody 6F6@CBody as claimed in claim 3, or the antigen-binding fragment as claimed in claim 5, or the biomaterial as claimed in claim 6, or the kit as claimed in claim 9 in the preparation of a product for detecting type 2 diabetes-related protein FABP4; D2): Use of the mimetic antibody 6F6@CBody as claimed in claim 3, or the antigen-binding fragment as claimed in claim 5, or the biomaterial as claimed in claim 6, or the kit as claimed in claim 9 in the preparation of a product that binds to the type 2 diabetes-associated protein FABP4; D3): Use of the mimetic antibody 6F6@CBody as claimed in claim 3 or the antigen-binding fragment as claimed in claim 5 in the preparation of a detection reagent for the type 2 diabetes-related protein FABP4; D4): Use of the mimetic antibody 6F6@CBody as claimed in claim 3 or the antigen-binding fragment as claimed in claim 5 in the preparation of a diagnostic reagent for type 2 diabetes; D5): Use of the pseudoantibody 6F6@CBody as described in claim 3 or the antigen-binding fragment as described in claim 5 in the preparation of a drug for preventing and / or treating type 2 diabetes.

Images