Endophytic fungus rhizopus microsporus var. Microsporus var. Microsporus and application thereof

Abstract

The invention discloses an endophytic fungus rhizopus microsporus var. Microsporus and application thereof, and belongs to the technical field of microorganisms. The endophytic fungus rhizopus microsporus var.chinensis GZ1F2 is obtained through isolated culture and is preserved in the Guangdong Microbial Culture Collection Center, the preservation address is the 5th floor of the building 59, No. 100 Courtyard, Xianlie Middle Road, Guangzhou, the preservation number is GDMCC No.65361, and the preservation time is October 28, 2024. The invention further discloses a preparation method of the endophytic fungus rhizopus microsporus var.chinensis GZ1F2, and the endophytic fungus rhizopus microsporus var.chinensis GZ1F2 has the advantages that the endophytic fungus rhizopus microsporus var.chinensis GZ1F2 can be used for preparing the endophytic fungus; the endophytic fungus rhizopus microsporus bloom variant GZ1F2 is separated from healthy tobacco leaves, has a remarkable inhibition effect on pathogenic bacteria of various diseases such as tobacco black shank, tobacco brown spot, tobacco target leaf spot and tobacco bacterial wilt, can effectively prevent and treat tobacco bacterial wilt, and has a better application prospect in prevention and treatment of tobacco diseases.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to an endophytic fungus microsporum var. Background Art

[0002] Tobacco is an important economic crop in my country. The incidence of tobacco bacterial wilt and tobacco black shank caused by Ralstonia solanacearum has increased year by year, causing huge losses to tobacco production. Tobacco bacterial wilt is mainly controlled by chemical pesticides, but long-term use of pesticides can easily cause pathogens to develop resistance and cause environmental pollution. Biological control has attracted people's attention due to its advantages of economy, environmental protection, good safety and sustainability. At present, the exploration of beneficial microbial resources has become an urgent problem to be solved in the biological control of tobacco bacterial wilt.

[0003] Endophytic fungi refer to a type of fungi that colonize the internal tissues of plants during all or part of their life cycle without directly causing any obvious negative impact on the host plant. They have the functions of promoting plant growth, inducing plant systemic resistance, and promoting the accumulation of plant secondary metabolites. They have been widely used in research on agriculture and medicinal plants.

[0004] Therefore, it is necessary to screen and develop new plant endophytic fungi for the prevention and treatment of tobacco wilt disease in order to reduce the use of pesticides and promote the sustainable development of the tobacco industry. Summary of the invention

[0005] The object of the present invention is to provide an endophytic fungus Rhizopus microsporus var. hua and its application. The endophytic fungus Rhizopus microsporus var. hua provided by the present invention has a significant inhibitory effect on the pathogens of various tobacco diseases such as tobacco black shank disease, tobacco brown spot disease, tobacco target spot disease and tobacco bacterial wilt, and can effectively prevent and treat tobacco bacterial wilt. Therefore, it has a good application prospect in the prevention and treatment of tobacco diseases.

[0006] In a first aspect, the present invention provides an endophytic fungus Rhizopus microsporus var. chinensis GZ1F2. The deposit number of the endophytic fungus Rhizopus microsporus var. chinensis GZ1F2 is GDMCC No.65361.

[0007] The strain was isolated from healthy tobacco leaves from Kaiyang County, Guiyang City, Guizhou Province. After culturing on PDA medium at 28°C for 5 days, the colony covered the entire plate, the hyphae were grayish white, cotton-like, and the colony texture was loose, surrounded by radially arranged fluffy white hyphae, and the back of the medium did not change color (no pigment was produced). Using a breathable band, the strain will produce a large number of spores, the ascospores are spherical or elliptical, and there are sporangia at the top of the sporangium stalk, which are black and contain many black ascospores.

[0008] The ITS sequence of the strain GZ1F2 was compared in the NCBI (https: / / www.ncbi.nlm.nih.gov / ) database, and the results showed that it had 100% similarity with Rhizopus microsporus var.chinensis strain CBS 394.34. Combining the morphological characteristics and ITS sequence determination, the strain GZ1F2 was named the endophytic fungus Rhizopus microsporus var.chinensis var. GZ1F2.

[0009] In a second aspect, the present invention provides an endophytic fungus Rhizopus microsporus var. chinensis fermentation broth, which is obtained by inoculating the above-mentioned endophytic fungus Rhizopus microsporus var. chinensis GZ1F2 into a culture medium for culturing.

[0010] In some embodiments, the culture medium includes the following components: 100-300 g of potato, for example, 100 g, 150 g, 200 g, 250 g, 300 g or other values ​​within this range; 10-30 g of glucose, for example, 10 g, 15 g, 20 g, 25 g, 30 g or other values ​​within this range; 800-1200 mL of distilled water, for example, 800 mL, 900 mL, 1000 mL, 1100 mL, 1200 mL or other values ​​within this range.

[0011] In some preferred embodiments, the culture medium includes the following components: 200 g potato, 20 g glucose, and 1000 mL distilled water.

[0012] It is to be understood that the culture medium can be sterilized by conventional sterilization methods in the art.

[0013] In a third aspect, the present invention provides a spore suspension of an endophytic fungus Rhizopus microsporus var. hua, wherein the content of spores in the spore suspension of an endophytic fungus Rhizopus microsporus var. hua is 1×10 6 -2×10 6 / mL, for example, 1×10 6 / mL, 1.2×10 6 / mL, 1.4×10 6 / mL, 1.6×10 6 / mL, 1.8×10 6 / mL, 2×10 6 Pieces / mL or other values ​​within this range.

[0014] In a fourth aspect, the present invention provides a biological bacterial agent, comprising the above-mentioned endophytic fungus Rhizopus microsporus var. hua GZ1F2 or any of the above-mentioned endophytic fungus Rhizopus microsporus var. hua fermentation liquid or the above-mentioned endophytic fungus Rhizopus microsporus var. hua spore suspension.

[0015] It is understandable that the biological agent may also include commonly used additives such as excipients, and the biological agent may be a solid preparation, a semi-solid preparation, a liquid preparation, etc. according to actual use needs.

[0016] In a fifth aspect, the present invention provides the use of the above-mentioned endophytic fungus Rhizopus microsporus var. Hua GZ1F2, any of the above-mentioned endophytic fungus Rhizopus microsporus var. Hua fermentation broth, the above-mentioned endophytic fungus Rhizopus microsporus var. Hua spore suspension or the above-mentioned biological bacterial agent in the prevention and control of tobacco diseases.

[0017] In some embodiments, tobacco diseases include at least one of tobacco bacterial wilt caused by Ralstonia solanacearum, tobacco black shank caused by Phytophthora parasitica var. nicotianae, tobacco brown spot caused by Alternaria alternata, and tobacco target spot caused by Rhizoctonia solani.

[0018] In some embodiments, the tobacco disease is tobacco bacterial wilt caused by Ralstonia solanacearum.

[0019] In some embodiments, tobacco disease control specifically includes: applying endophytic fungus Rhizopus microsporus var. hua GZ1F2, endophytic fungus Rhizopus microsporus var. hua fermentation liquid, endophytic fungus Rhizopus microsporus var. hua spore suspension or biological bacterial agent to the roots of tobacco.

[0020] In some embodiments, the tobacco comprises cloud smoke 87.

[0021] The beneficial effect of the present invention is that, different from the prior art, the present invention separates the endophytic fungus Rhizopus microsporus var.chinensis GZ1F2 from healthy tobacco leaves, and the endophytic fungus Rhizopus microsporus var.chinensis GZ1F2 has a significant inhibitory effect on the pathogens of various tobacco diseases such as tobacco black shank disease, tobacco brown spot disease, tobacco target spot disease and tobacco bacterial wilt, and can effectively prevent and control tobacco bacterial wilt. Therefore, the present invention has a good application prospect in the prevention and control of tobacco diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1: is a colony morphology diagram of the strain GZ1F2 isolated in Example 1 of the present invention, wherein A is a front colony morphology diagram, and B is a back colony morphology diagram;

[0023] Figure 2 The spore morphology of strain GZ1F2 isolated in Example 1 of the present invention, wherein A is a spore morphology at 40 μm, and B is a sporangium at 100 μm;

[0024] Figure 3 This is a graph showing the control effect of strain GZ1F2 on tobacco bacterial wilt in Example 3 of the present invention, wherein A is a graph showing the tobacco morphology in the control group, and B is a graph showing the tobacco morphology in the treatment group.

[0025] Biological Deposit

[0026] The strain provided by the present invention is deposited in the Guangdong Provincial Microbiological Culture Collection Center (GDMCC), the storage address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, the storage number is: GDMCC No.65361, the storage time is: October 28, 2024, and the classification name is: Rhizopus microsporus var.chinensis GZ1F2. DETAILED DESCRIPTION

[0027] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] The experimental methods without specific conditions in the examples are usually carried out according to conventional experimental methods in the field of molecular biology, including but not limited to the experimental methods described in Molecular Cloning: A Laboratory Manual by MR Green, Molecular Biology by Robert F. Weaver, etc., or according to the experimental methods recommended by the kit and instrument manufacturers. The reagents and biological materials used in the examples can be obtained from commercial channels unless otherwise specified.

[0029] In the present invention, the tobacco variety is Yunyan 87, which is provided by Guizhou Tobacco Science Research Institute; the tobacco bacterial wilt pathogen Ralstonia solanacearum, the tobacco black shank pathogen Phytophthora parasitica var. nicotianae, the tobacco brown spot pathogen Alternaria alternata, and the tobacco target spot pathogen Rhizoctonia solani are separated and preserved by Guizhou Tobacco Science Research Institute.

[0030] The culture medium formula used in the present invention is as follows:

[0031] Potato dextrose agar (PDA) liquid culture medium: 200 g potato, 20 g glucose, distilled water to 1000 mL.

[0032] The potato dextrose agar (PDA) solid medium was prepared by adding 15 g of agar to the above-mentioned potato dextrose agar (PDA) liquid medium.

[0033] Nutrient agar (NA) liquid medium: peptone 10g, beef extract powder 3g, sodium chloride 5g, distilled water to 1000mL.

[0034] Nutrient agar (NA) solid medium was prepared by adding 15 g of agar to the above-mentioned nutrient agar (NA) liquid medium.

[0035] Example 1 Isolation, purification and identification of strain GZ1F2

[0036] 1.1 Isolation and purification of strain GZ1F2

[0037] Healthy tobacco leaves (sampled in Kaiyang County, Guiyang City, Guizhou Province) were repeatedly rinsed under running tap water to remove surface soil and appendages, then soaked in 75% alcohol for 30s and 1% sodium hypochlorite for 5min for surface disinfection, rinsed with sterile water 3 times, and the samples were cut into small segments of about 0.5cm in length with sterilized scissors, and placed on potato dextrose agar (PDA) medium plates for culture, with 5-6 tissue blocks placed on each plate, 3 plates for each sample, and inverted cultured in a 28°C incubator. The fungal hyphae growing on the edge of the tissue block were picked out in time, transferred to a new PDA medium for culture and purification, and the obtained strain was preserved and named strain GZ1F2.

[0038] 1.2 Identification of strain GZ1F2

[0039] The strain GZ1F2 isolated in 1.1 was inoculated on PDA medium and cultured at 28°C for 5 days. The morphology of its colonies, spores and spore-producing structures were observed. The results were as follows: Figure 1 and 2 shown.

[0040] from Figure 1 It can be seen that after culturing on PDA medium at 28°C for 5 days, the colonies covered the entire plate, the mycelium was grayish white, cotton-like, and the colony texture was loose, with radially arranged fluffy white mycelium around it, and the back of the culture medium did not change color (no pigment was produced).

[0041] from Figure 2 It can be seen that when using breathable bandages, the strain will produce a large number of spores. The ascospores are spherical or elliptical. There are sporangia at the top of the sporangium stalk, which are black and contain many black ascospores.

[0042] Furthermore, strain GZ1F2 was inoculated on a PDA plate and cultured at 28°C for 7 days. Mycelium was scraped and ground into fine powder in a sterile mortar with liquid nitrogen, and its genomic DNA was extracted by CTAB method. The ITS sequence of strain GZ1F2 was amplified by PCR using the extracted genomic DNA of strain GZ1F2 as a template and primers ITS1F and ITS 4R. The reaction system is shown in Table 1.

[0043] Table 1 Reaction system

[0044] Components volume Upstream primer 2μL Downstream primer 2μL 2×Es Taq MasterMix(Dye)CWBIO 25μL <![CDATA[ddH2O]]> 19μL DNA template 2μL

[0045] The reaction procedure was as follows: pre-denaturation at 94°C for 4 min, denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, for a total of 30 cycles, and finally extension at 72°C for 10 min.

[0046] Among them, the nucleotide sequences of ITS1F and ITS4R are as follows:

[0047] ITS1F: 5'-CTTGGTCATTTAGAGGAAGTAA-3' (SEQ ID NO: 2);

[0048] ITS 4R: 5'-TCCTCCGCTTATTGATATGC-3' (SEQ ID NO: 3).

[0049] The PCR amplification product was recovered by gel using TIANGEN Universal DNA Purification Recovery Kit (DP214) and sent to Shanghai Bioengineering Co., Ltd. for sequencing. After sequencing analysis, the ITS sequence of strain GZ1F2 was 590 bp (SEQ ID NO: 1), and the sequencing results were blasted in the NCBI database. The results showed that the ITS sequence of strain GZ1F2 was 100% similar to that of Rhizopus microsporus var. chinensis strain CBS 394.34.

[0050] Combined with the morphological characteristics and molecular biological results of strain GZ1F2, strain GZ1F2 was identified as Rhizopus microsporus var. hua and named as endophytic fungus Rhizopus microsporus var. hua GZ1F2.

[0051] Example 2 Inhibition of the main tobacco disease pathogens by strain GZ1F2

[0052] In this example, the plate confrontation method was used to determine the inhibitory effect of strain GZ1F2 on tobacco black shank pathogen, tobacco brown spot pathogen and tobacco target spot pathogen.

[0053] Specifically, strain GZ1F2 and the above pathogens were activated on PDA medium for 5 days, and a 5 mm diameter bacterial cake was punched out with a hole puncher and inoculated on the left and right sides of the PDA plate, respectively. The two bacterial cakes were about 5 cm apart and about 2 cm away from the edge of the culture dish. The line connecting the centers of the bacterial cakes passed through the center of the plate. The inoculated PDA plate was inverted in a constant temperature incubator at 28°C for 5 days, and the growth radius of the pathogen colony pointing to the antagonistic bacteria was measured (measured from the center of the bacterial cake circle), and the inhibition rate was calculated. The blank culture medium was used as the control and repeated 3 times.

[0054] Inhibition rate (%) = (control colony diameter - treated colony diameter) / (control colony diameter - 0.5) × 100.

[0055] The results of the inhibitory effect of strain GZ1F2 on tobacco black shank pathogen, tobacco brown spot pathogen and tobacco target spot pathogen are shown in Table 2 below.

[0056] Table 2 The results of the inhibitory effect of strain GZ1F2 on tobacco disease pathogens

[0057]

[0058] As can be seen from Table 2, strain GZ1F2 has different degrees of inhibitory effect on tobacco black shank pathogen, tobacco brown spot pathogen and tobacco target spot pathogen; among them, strain GZ1F2 has the highest inhibition rate against tobacco target spot pathogen, which is 77.89%, followed by tobacco brown spot pathogen and tobacco black shank pathogen, with inhibition rates of 56.66% and 44.44% respectively.

[0059] Furthermore, the inhibitory effect of strain GZ1F2 on tobacco bacterial wilt (Ralstonia solanacearum) was determined by the filter paper method. Specifically, strain GZ1F2 was first activated on a PDA plate, and a bacterial block with a diameter of 5 mm was taken and inoculated in a triangular flask containing 100 mL of PDA liquid culture medium. It was shaken and cultured at 28°C and 100 rpm for 5 days, and then filtered with 8 layers of gauze to remove bacteria and obtain the fermentation filtrate of strain GZ1F2. 10 μL of fermentation filtrate was added to a circular sterile filter paper, and after drying it slightly, the filter paper was attached to a plate coated with tobacco bacterial wilt pathogens, cultured at 28°C for 24 hours, and the antibacterial effect was observed and the diameter of the inhibition zone was measured. Repeat 3 times.

[0060] The results showed that the diameter of the inhibition zone of the fermentation liquid of strain GZ1F2 against tobacco bacterial wilt pathogen was 1.5 cm.

[0061] The above results show that strain GZ1F2 has a significant inhibitory effect on tobacco black shank pathogen, tobacco brown spot pathogen, tobacco target spot pathogen and tobacco bacterial wilt pathogen.

[0062] Example 3 Potted experiment of strain GZ1F2 on tobacco bacterial wilt

[0063] 3.1 Preparation of tobacco bacterial wilt pathogen suspension

[0064] The tobacco bacterial wilt pathogen was streaked on NA medium and cultured at 30°C for 2 days. A single colony was picked and inoculated into 5 mL of NA liquid medium. The culture was shaken at 30°C and 180 rpm overnight. The bacterial liquid was expanded 100 times in fresh NA liquid medium. The tobacco bacterial wilt pathogen was then divided into 50 mL sterile centrifuge tubes and centrifuged at 8000 rpm for 15 min. The supernatant was removed and the concentration of the bacterial suspension was adjusted to 10 with sterile water. 8 cfu / mL.

[0065] 3.2 Preparation of spore suspension of strain GZ1F2

[0066] The strain GZ1F2 was activated on a PDA plate and cultured at 28°C for 5 days. After the strain produced spores under a microscope, sterile water was added, the spores were scraped off and filtered, and diluted to a spore concentration of 1.0×10 6 Pieces / mL.

[0067] 3.3 Potted plant experiment

[0068] Conventional seedling raising methods were used. When tobacco seeds germinated and grew two cotyledons, they were transplanted into flower pots (field soil and substrate were mixed in a ratio of 1:1 and sterilized), placed in a 26°C greenhouse with alternating light during the day and night, and used when they grew to 6-8 true leaves. Select tobacco seedlings with consistent growth and inoculate 6 mL of 1×106 / mL of strain GZ1F2 spore suspension, and inoculate 15mL of tobacco bacterial wilt suspension after 5 days. Use a blade to dig an incision in the soil 1cm on both sides of the base of the tobacco stem, and pour the tobacco bacterial wilt suspension in the incision for root irrigation. Use sterile water as the control, and treat 30 tobacco seedlings in each treatment. Repeat 3 times. Cultivate in a greenhouse, with 12 hours of light per day, 28℃, and 85% humidity. Observe every 24 hours, record the occurrence of tobacco bacterial wilt, and calculate the disease index and prevention effect. The classification method of tobacco bacterial wilt disease refers to the tobacco disease classification and investigation method issued by the General Administration of Quality Supervision, Inspection and Quarantine of the People's Republic of China. The specific classification is shown in Table 3 below.

[0069] Table 3 Disease classification of tobacco bacterial wilt

[0070]

[0071] Among them, the calculation formula for disease index and prevention and control effect is:

[0072] Disease index = [∑ (number of diseased plants or leaves at each level × value of the disease level) / (total number of plants or leaves surveyed × highest level value)] × 100;

[0073] Prevention and control effect (%) = (control disease index - treatment disease index) / control disease index × 100.

[0074] The results of strain GZ1F2 on tobacco bacterial wilt were as follows: Figure 3 And as shown in Table 4.

[0075] Table 4 Control results of strain GZ1F2 on tobacco bacterial wilt

[0076] deal with Incidence (%) Disease index Relative efficacy (%) Comparison 44.44 51.85 Strain GZ1F2 22.22 12.35 76.19

[0077] As can be seen from Table 4, compared with the control, the tobacco seedlings inoculated with strain GZ1F2 showed better resistance to tobacco bacterial wilt. Observation at 14 days after inoculation with tobacco bacterial wilt pathogens found that the tobacco in the treatment group showed only slight wilting symptoms ( Figure 3 ), the bacterial wilt index was 12.35, while the tobacco wilt phenomenon in the control group was more serious ( Figure 3 ), the bacterial wilt disease index was 51.85, which was significantly higher than that of the tobacco in the treatment group. According to calculations, the control effect of strain GZ1F2 on tobacco bacterial wilt was 76.19%, which has good application potential.

[0078] In summary, the endophytic fungus Rhizopus microsporus var. chinensis GZ1F2 isolated by the present invention has a significant inhibitory effect on the pathogens of various tobacco diseases such as tobacco black shank disease, tobacco brown spot disease, tobacco target spot disease and tobacco bacterial wilt, and can effectively prevent and control tobacco bacterial wilt. Therefore, it has a good application prospect in the prevention and control of tobacco diseases.

[0079] It should be noted that the above embodiments all belong to the same inventive concept, and the description of each embodiment has its own focus. For matters that are not described in detail in some embodiments, reference may be made to the description in other embodiments.

[0080] The above-mentioned embodiments only express the implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

[0081] ITS sequence of strain GZ1F2 (SEQ ID NO: 1)

[0082] ATTTACTTCTCAGTATTGTTTGCTTCTATACTGTGAACCTCTGGCGATGAAGGTCGTAAC

[0083] TGACCTTCGGGAGAGACTCAGGACATATAGGCTATAATGGGTAGGCCTGTTCTGGGGTT

[0084] TGATCGATGCCAATCAGGATTACCTTTCTTCCTTTGGGAAGGAAGGCGCCTGGTACCCT

[0085] TTACCATATACCATGAATTCAGAATTGAAAGTATAATAATAATAACAACTTTTAACAATGGA

[0086] TCTCTTGGTTCTCGCATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGC

[0087] ATATTCGTGAATCATCGAGTCTTTGAACGCAGCTTGCACTCTATGGATCTTCTATAGAGT

[0088] ACGCTTGCTTCAGTATCATAACCAACCCACACATAAAATTTATTTTATGTGGTGATGGAC

[0089] AAATTCGGTTAGATTTAATTATTATACCGATTGTCTAAAATACAGCCTCTTTGTAATTTTCA

[0090] TTAAATTACGAACTACCTAGCCATCGTGCTTTTTTGGTCCAACCAAAAAACATTTAATCT

[0091] AGGGGTTCTGCCAGCCAGCAGATATTTTAATGCTCTTTAACTATGATCTG。

Claims

1. An endophytic fungus Rhizopus microsporus var. hua GZ1F2, characterized in that: The deposit number of the endophytic fungus Rhizopus microsporus var. hua GZ1F2 is GDMCC No.65361.

2. A fermentation broth of an endophytic fungus Rhizopus microsporus var. The endophytic fungus Rhizopus microsporus var. hua fermentation broth is obtained by inoculating the endophytic fungus Rhizopus microsporus var. hua GZ1F2 described in claim 1 into a culture medium for culturing.

3. The endophytic fungus Rhizopus microsporus var. hua fermentation broth according to claim 2, characterized in that: The culture medium comprises the following components: 100-300 g of potato, 10-30 g of glucose, and 800-1200 mL of distilled water.

4. A spore suspension of endophytic fungus Rhizopus microsporus var. hua, characterized in that: The content of spores in the endophytic fungus microsporum var. hua spore suspension is 1×10 6 -2×10 6 Pieces / mL.

5. A biological bacterial agent, characterized in that: The method comprises the endophytic fungus Rhizopus microsporus var. Hua GZ1F2 described in claim 1 or the endophytic fungus Rhizopus microsporus var. Hua fermentation liquid described in any one of claims 2 to 3 or the endophytic fungus Rhizopus microsporus var. Hua spore suspension described in claim 4.

6. Use of the endophytic fungus Rhizopus microsporus var. Hua GZ1F2 according to claim 1, the endophytic fungus Rhizopus microsporus var. Hua fermentation liquid according to any one of claims 2 to 3, the endophytic fungus Rhizopus microsporus var. Hua spore suspension according to claim 4, or the biological agent according to claim 5 in tobacco disease control.

7. The use according to claim 6, characterized in that: The tobacco diseases include at least one of tobacco bacterial wilt caused by Ralstonia solanacearum, tobacco black shank disease caused by Phytophthora parasiticus pathogenic strains of tobacco, tobacco brown spot disease caused by Alternaria alternata, and tobacco target spot disease caused by Rhizoctonia solani.

8. The use according to claim 7, characterized in that: The tobacco disease is tobacco bacterial wilt caused by Ralstonia solanacearum.

9. The use according to claim 6, characterized in that: The tobacco disease prevention and control specifically includes: applying the endophytic fungus Rhizopus microsporus var. Hua GZ1F2, the endophytic fungus Rhizopus microsporus var. Hua fermentation liquid, the endophytic fungus Rhizopus microsporus var. Hua spore suspension or the biological bacterial agent to the roots of the tobacco.

10. The use according to any one of claims 6 to 9, characterized in that: The tobacco includes cloud tobacco 87.

Images