Phytobacterium plantarum DACN128 for inhibiting malassezia and application of phytobacterium plantarum DACN128

Abstract

The invention discloses lactobacillus plantarum DACN128 which is preserved in the China Center for Type Culture Collection, the preservation number of the lactobacillus plantarum DACN128 is CCTCC NO: M20241337, and the lactobacillus plantarum DACN128 has a remarkable effect of inhibiting pathogenic malassezia, can be applied to prevention and treatment of skin diseases caused by excessive propagation of malassezia such as seborrheic dermatitis, characteristic dermatitis and psoriasis, and has a good application prospect. The application range of the plant lactobacillus DACN128 is expanded, the utilization value of the plant lactobacillus DACN128 is improved, and a new thought is brought to preparation of related daily washing products for removing dandruff and treating fungal infectious dermatitis.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a strain of Lactobacillus plantarum DACN128 capable of inhibiting Malassezia and application thereof. Background Art

[0002] At present, the incidence of fungal infectious diseases is high and the types of antifungal drugs are limited. There is a trend of drug resistance, so it is of great value to find new antifungal drugs. Malassezia is a lipophilic conditional pathogen that often parasitizes the parts of the human body rich in sebaceous glands. Under the action of certain susceptibility factors, the massive proliferation of Malassezia can cause skin diseases such as tinea versicolor, Malassezia folliculitis, seborrheic dermatitis, atopic dermatitis, acne vulgaris, and psoriasis. Studies have found that Malassezia secretes lipase and phospholipase, which hydrolyze triglycerides in human sebum to produce saturated fatty acids, maintain the reproduction of Malassezia, and release unsaturated fatty acids such as oleic acid and arachidonic acid. When these unsaturated fatty acids penetrate into the stratum corneum in large quantities, they will cause abnormal differentiation of keratinocytes, and at the same time, they can induce keratinocytes to produce pro-inflammatory factors such as IL-1β, IL-6, and IL-8, causing damage to the epidermal barrier and producing dandruff. In severe cases, they can also cause various types of skin inflammation. The Malassezia species most involved in studies on skin diseases caused by Malassezia include Malassezia furfur, Malassezia globosa, and Malassezia restricta.

[0003] The most commonly used antimicrobial agents in clinical treatment and daily chemical products are ketoconazole and zinc pyrithione. However, both drugs currently have problems such as unpredictable clinical efficacy, drug resistance and side effects. Zinc pyrithione has also been proven to be carcinogenic and teratogenic, and has potential hazards to the environment and animals, and has been banned from use in cosmetics by the European Union. Currently, the use of plant extracts for antibacterial purposes is more studied, but there are also disadvantages such as volatility and irritation to the skin. Therefore, it has become an urgent need to find safer and more reliable natural drugs to replace or partially replace antifungal chemical drugs.

[0004] Lactic acid bacteria (LAB) are bacteria that use carbohydrates to produce lactic acid as the main fermentation product. They exist in the intestines of vertebrates and various fermentation products. Lactobacillus and Bifidobacterium are the representatives. They have the functions of maintaining the stability of intestinal flora and improving gastrointestinal digestion in the body. They can also promote the absorption of calcium, magnesium and vitamins. Most lactic acid bacteria, such as Lactobacillus plantarum, Lactobacillus rhamnosus and Lactobacillus mucosa fermentation, have been proven to have health benefits and are used as probiotics in the food and nutrition industry. Lactic acid bacteria can produce a variety of antimicrobial compounds, such as bacteriocins, hydrogen peroxide and small molecular acids. Bacteriocins are ribosomally synthesized antimicrobial peptides that can inhibit or kill bacterial strains that are closely related or unrelated to the produced bacteriocins without causing any harm to the bacteria themselves due to the presence of self-defense proteins. In recent years, experimental studies have shown that topical or oral probiotics, such as Lactobacillus, can improve skin health by inhibiting the colonization of skin pathogens such as Malassezia furfur, Staphylococcus aureus and Propionibacterium acnes on the skin surface. It provides a new idea for developing innovative probiotic strains to replace antibacterial agents and preventing and treating various skin diseases. Therefore, screening lactic acid bacteria strains that can effectively inhibit Malassezia furfur has important practical significance for developing functional health products and medicines for preventing and treating fungal infectious diseases, enriching the types of fermented products and establishing a lactic acid bacteria strain resource library. Summary of the invention

[0005] The purpose of the present invention is to solve the above problems and provide a strain of Lactobacillus plantarum DACN128 for inhibiting Malassezia and its application.

[0006] In order to achieve its purpose, the present invention adopts the following technical solution:

[0007] The first aspect of the present invention provides a strain of Lactobacillus plantarum DACN128, which is deposited in China Center for Type Culture Collection with a deposit number of CCTCCNO: M20241337.

[0008] The second aspect of the present invention provides a bacterial agent, the active ingredient of which comprises the above-mentioned Lactobacillus plantarum DACN128 or its fermentation liquid or its cell-free fermentation supernatant.

[0009] Preferably, the bacterial agent is a freeze-dried powder.

[0010] The third aspect of the present invention provides a method for preparing the above-mentioned bacterial agent, which is obtained by inoculating the above-mentioned Lactobacillus plantarum DACN128 into a culture medium for cultivation.

[0011] The preparation method of the fermentation liquid is as follows: after activating the Lactobacillus plantarum DACN128 strain, the strain is cultured in a liquid culture medium at 37° C. for 12 to 48 hours to obtain the fermentation liquid of Lactobacillus plantarum DACN128; preferably, the liquid culture medium is an MRS liquid culture medium;

[0012] The preparation method of the cell-free fermentation supernatant comprises the following steps: filtering the prepared Lactobacillus plantarum DACN128 fermentation liquid through a filter membrane to obtain the cell-free fermentation supernatant, and performing rotary evaporation and freeze-drying on the cell-free fermentation supernatant to prepare a freeze-dried powder.

[0013] The fourth aspect of the present invention provides the use of the above-mentioned Lactobacillus plantarum DACN128 or bacterial agent in any of the following:

[0014] (1) Inhibit the growth of pathogenic Malassezia;

[0015] (2) Use in the preparation of drugs for preventing and / or alleviating and / or treating diseases related to pathogenic Malassezia infection.

[0016] In the above-mentioned application technology scheme, the pathogenic Malassezia includes Malassezia furfur, Malassezia globosa, and Malassezia restricta.

[0017] The related diseases are selected from at least one of tinea versicolor, Malassezia folliculitis, seborrheic dermatitis, atopic dermatitis, acne vulgaris, and psoriasis.

[0018] The fifth aspect of the present invention provides a product, comprising the above-mentioned Lactobacillus plantarum DACN128 or the above-mentioned bacterial agent.

[0019] Preferably, the product is selected from daily chemical products or medicines.

[0020] The beneficial effects of the present invention are:

[0021] The present invention studies the effect of plant lactobacillus DACN128 on inhibiting Malassezia furfur. The results of the study found that the plant lactobacillus DACN128 strain and its cell-free fermentation supernatant both have the ability to preferably inhibit Malassezia furfur ATCC14521. The plant lactobacillus DACN128 antibacterial ability is detected by double-layer plate method, and its antibacterial diameter can reach 20.32 ± 0.52 mm, and the antibacterial effect is greater than other lactic acid bacteria strains reported at present. The cell-free fermentation supernatant of plant lactobacillus DACN128 cultured in MRS culture medium for 24 h also has a good antibacterial effect, and the cell-free fermentation supernatant of plant lactobacillus DACN128 added with 100 μL in 8 mm agar wells is utilized, and the antibacterial diameter can reach 14.06 ± 0.49 mm. The invention also evaluates the safety of plant lactobacillus DACN128 at the same time, confirming that DACN128 is a safe and reliable plant lactobacillus.

[0022] The Lactobacillus plantarum DACN128 screened by the present invention that can inhibit Malassezia expands the application of lactic acid bacteria strains in the development of efficient and safe anti-dandruff products, and at the same time has important practical significance for enriching the types of fermented products and establishing a lactic acid bacteria strain resource library. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The colony morphology (A) and Gram staining results (B) of Lactobacillus plantarum DACN128.

[0024] Figure 2 Phylogenetic tree of Lactobacillus plantarum DACN128 (A).

[0025] Figure 3 The hemolytic test results of Lactobacillus plantarum DACN128 (A) and Staphylococcus aureus ATCC25923 (B).

[0026] Figure 4 This is the growth curve and pH value change of Lactobacillus plantarum DACN128.

[0027] Figure 5 The inhibition zone of Lactobacillus plantarum DACN128 strain (A) and its cell-free fermentation supernatant (B) against Malassezia furfur.

[0028] Figure 6 The differences in antibacterial activity between Lactobacillus plantarum DACN128 and other lactic acid bacteria were compared by double-layer plate method (A) and agar well diffusion method (B).

[0029] Figure 7Effects of different fermentation times (A), different concentrations (B), different temperature treatments (C) and different pH values ​​(D) on the antibacterial activity of the supernatant of cell-free fermentation of Lactobacillus plantarum DACN128.

[0030] Above Figure 6 to Figure 7 Different letters indicate significant differences, P < 0.05. DETAILED DESCRIPTION

[0031] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0032] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0033] Example 1

[0034] 1 Experimental Materials

[0035] The strains used in the experiment were from the strain resource bank of Suo Huayi Laboratory of Southwest University.

[0036] 2 Experimental methods

[0037] 2.1 Morphological observation of strains

[0038] The plant lactobacillus DACN128 preserved in the strain resource bank was cultured in MRS liquid medium at 37℃ for 24h to activate the strain. The bacterial liquid after two generations of activation was picked up with an inoculation loop and streaked on an MRS solid medium plate for separation. The colonies were observed after culturing at 37℃ for 48h. 1mL of bacterial liquid was centrifuged at 8000×g for 10min, the supernatant was discarded, a small amount of sterile physiological saline was added and mixed to make a bacterial turbid liquid, and the bacterial turbid liquid was evenly applied on a glass slide with an inoculation loop. After Gram staining, the strain cell morphology was observed under a microscope and photographed to record.

[0039] 2.2 PCR amplification of 16S rDNA sequences

[0040] The DNA of the purified strain was extracted using a bacterial genomic DNA extraction kit. A 25 μL reaction system was used for PCR amplification. Two synthetic universal primers (16s 27F: GAGAGTTTGATCCTGGCTCAG, SEQ ID NO.1; 16s 1492R: CGGCTACCTTGTTACGACTT, SEQ ID NO.2) were used for PCR amplification. The 25 μL system of 16S rDNA PCR was composed as follows: the volume of the upstream primer 27F was 1.25 uL, the volume of the downstream primer was 1.25 uL, the volume of the Taq enzyme Mix was 12.5 uL, the bacterial liquid template was 1 uL, and the double distilled water was 9 uL. The conditions of 16S rDNA PCR were as follows: the first step: 94°C, 5 min; the second step: 94°C, 30 s; the third step: 55°C, 30 s; the fourth step: 72°C, 2 min; the fifth step: 72°C, 10 min. The second to fourth steps were repeated for 30 cycles. The strain was then sent to Sangon Biotech for sequencing, and the sequencing results were compared with BLAST at the National Center for Biotechnology Information to determine the species of the strain.

[0041] Construction of phylogenetic tree: The sequences of 9 bacterial strains were retrieved from Gene Bank as reference sequences. The neighbor-joining method in MEGA5.0 software was used to construct a 16S rDNA phylogenetic tree for the screened lactic acid bacteria. The bootstrap method was used to perform a confidence test with a bootstrap data set of 1000.

[0042] 2.3 Safety evaluation of strains

[0043] 2.3.1 Evaluation of hemolytic activity of Lactobacillus plantarum DACN128

[0044] Lactobacillus plantarum DACN128 was activated in MRS medium at 37°C for 24h, and Staphylococcus aureus (ATCC25923) was activated in LB medium at 37°C for 24h as a positive control for hemolysis. The culture solution of the strain was streaked on a Columbia blood agar medium plate containing 5% sterile defibrinated sheep blood using a sterile inoculation loop, and cultured at 37°C for 48h, and the hemolysis zone was observed and photographed for record.

[0045] 2.3.2 Evaluation of antibiotic susceptibility of Lactobacillus plantarum DACN128

[0046] The concentration of activated Lactobacillus plantarum DACN128 was adjusted to 1×10 7CFU / mL, take 100μL in a 5mL sterile centrifuge tube, add 4mL MRS agar semi-solid medium (containing 0.75% agar) and mix well, and quickly pour it on the MRS agar solid plate. After solidification, use sterile tweezers to pick up 20 different drug-sensitive paper discs (Bickman Biology) and place them on the plate, with three drug-sensitive paper discs (triangular) on each plate. In order to minimize the error, the measuring instrument uses a vernier caliper, with the center of the inhibition zone as the center of the circle, and measures the distance between two points on the circumference of the circle passing through the center of the inhibition zone, which is used as the diameter of the inhibition zone, and the diameter of the inhibition zone is used to represent the size of the inhibition zone.

[0047] 2.4 Growth curve and pH change trend of Lactobacillus plantarum DACN128

[0048] Lactobacillus plantarum DACN128 was cultured in MRS liquid medium at 37°C for 24 h to activate the strain and adjust the viable count to 1×10 9 CFU / mL, the bacterial suspension of the screened strain was inoculated into 200 mL of MRS broth at a 2% inoculum, and cultured at 37°C for 24 h. Samples were taken every 2 h to measure the absorbance of the fermentation broth at a wavelength of 600 nm (OD 600nm value) and pH value, and draw the growth curve and pH change curve.

[0049] 2.5 Statistical analysis

[0050] Each experiment was performed three times in parallel. The experimental data were expressed as "mean ± standard deviation" and variance analysis was performed using SPSS20. P < 0.05 indicated statistical significance.

[0051] 3 Experimental results and analysis

[0052] 3.1 Identification of strains

[0053] After the 16SrDNA PCR amplification of strain DACN128 was successful, sequencing was completed by Bioengineering (Shanghai) Co., Ltd. The sequence of the 16SrDNA gene amplification product of DACN128 was compared by BLAST, and it was found that the similarity with the 16SrDNA sequence (SEQ ID NO.3) of Lactobacillus plantarum gp38 in the database was 100%, and the strain DACN128 was identified as Lactobacillus plantarum DACN128. Figure 1 The colony morphology of Lactobacillus plantarum DACN128 grown on MRS solid plates and observed under a microscope after Gram staining, the phylogenetic tree of the strain is as follows Figure 2 shown.

[0054] 3.2 Evaluation of hemolytic activity of Lactobacillus plantarum DACN128

[0055] Columbia blood agar containing 5% sterile defibrillated sheep blood was used to test whether Lactobacillus plantarum DACN128 was hemolytic. Figure 3 It can be observed that Lactobacillus plantarum DACN128 ( Figure 3 A) No transparent hemolytic ring was produced on the blood plate, indicating that the strain was non-hemolytic. In contrast, the positive control hemolytic Staphylococcus aureus ATCC 25923 ( Figure 3 B) An obvious transparent hemolytic ring appeared. It can be judged that Lactobacillus plantarum DACN128 does not have hemolytic ability and is a safe strain.

[0056] 3.3 Antibiotic sensitivity test of Lactobacillus plantarum DACN128

[0057] This experiment uses the drug sensitivity paper method to detect the sensitivity of Lactobacillus plantarum DACN128 to 10 antibiotics, which is the most widely used drug sensitivity test method in clinical practice. The drug sensitivity of probiotic strains to multiple antibiotics is judged with reference to the latest NCCLS standards provided by WHO. If a probiotic is sensitive to a certain antibiotic, it is represented by S; if it is resistant, it is represented by R; if it is intermediate, it is represented by I. By comparing the average value of the inhibition zone diameter produced by the resistance of Lactobacillus plantarum DACN128 to these 10 antibiotics measured in the experiment with the NCCLS drug sensitivity test standard, the drug sensitivity results of Lactobacillus plantarum DACN128 to these 10 antibiotics are shown in Table 1:

[0058] Table 1 Resistance results of Lactobacillus plantarum DACN128 to 10 antibiotics

[0059]

[0060]

[0061] * Note: In Table 1, S indicates sensitive, R indicates resistant, and I indicates moderately sensitive.

[0062] Whether a strain has drug resistance is an important criterion for evaluating whether it can be safely used in food. Lactobacillus plantarum DACN128 is sensitive to the seven most commonly used antibiotics in clinical practice, including piperacillin, ampicillin, erythromycin, etc., and there is no risk of transmitting resistance genes of commonly used clinical antibiotics to skin and intestinal microorganisms.

[0063] 3.4 Growth curve and pH change trend of Lactobacillus plantarum DACN128

[0064] Observe the growth trend and acid production of Lactobacillus plantarum DACN128 strain in MRS broth medium within 24 hours. Figure 4 As shown in the figure, the growth curve of Lactobacillus plantarum DACN128 is "S" shaped, 0-2h is the growth lag phase, the bacterial concentration increases slowly; 4-14h is the logarithmic growth phase, especially 4-10h growth is fast, at this time the cell metabolism is very active; after 16h the growth tends to be stable, OD 600nm The value was stable at about 1.6. As the culture time increased, the pH of the fermentation liquid gradually decreased. After 14 hours of culture, the pH of the strain tended to be about 4.0, indicating that Lactobacillus plantarum TK37 had the ability to produce acid after fermentation.

[0065] The deposit information of Lactobacillus plantarum DACN128 is as follows:

[0066] The strain DACN128 was sent to the China Center for Type Culture Collection (CCTCC) for preservation in June 2024. The address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The preservation date is June 21, 2024; the preservation number is CCTCC NO: M20241337; the classification name is: Lactobacillus plantarum DACN128 Lactiplantibacillus plantarum DACN128.

[0067] Example 2 Study on the in vitro antibacterial activity of Lactobacillus plantarum DACN128

[0068] 1 Experimental strains

[0069] The experimental strain is Lactobacillus plantarum DACN128 (Lactiplantibacillus plantarum DACN128), and the deposit number is CCTCC NO: M20241337.

[0070] Malassezia furfur ATCC14521: commercially available product.

[0071] 2 Experimental methods

[0072] 2.1 Activation of Malassezia furfur

[0073] Modified Dixon medium (MD): Weigh 66 g of modified Dixon medium, take 10 mL of Tween 40, add 1000 mL of pure water, and sterilize at 121°C for 30 minutes (add 1.5% agar to the solid culture medium).

[0074] For the first activation of Malassezia furfur ATCC14521 freeze-dried powder, disinfect the tip with alcohol and knock open the storage tube. Take 0.2-0.3mL of the solution and add it to the culture tube. Gently flick the powder to mix it evenly. Use a sterile pipette to precipitate the solution and inoculate it on the modified MD solid medium. Culture it at 30℃ for 2-3 days. Pick a single colony and inoculate it in 50mL of modified MD liquid medium at 30℃ and 180rpm for activation.

[0075] 2.2 Preparation of freeze-dried powder of lactic acid bacteria fermentation broth

[0076] A single colony of Lactobacillus plantarum DACN128 was picked from the plate and inoculated into 10 mL of MRS broth. After culturing at 37 °C for 24 h, 5 mL of the culture solution was centrifuged at 4000 r / min for 10 min in a 15 mL centrifuge tube. 5 mL of sterile saline was added to prepare a bacterial suspension. The number of viable bacteria in the bacterial suspension was adjusted to 1 × 10 with sterile saline. 9 CFU / mL, then diluted ten times with sterile physiological saline and inoculated into 200mL MRS liquid culture medium at an inoculum size of 2% (v / v), cultured at 37°C for 24h, centrifuged at 8000×g for 10min at 4°C, discarded the bacteria, and filtered the supernatant with a 0.22μm filter membrane to obtain a cell-free fermentation supernatant (CFS). Use a rotary evaporator at 60°C, 80rpm to evaporate the solution to about 30mL, and place it in a -80°C ultra-low temperature refrigerator for 24h. Then place it in a vacuum freeze dryer and dry it for 48h to obtain a lactic acid bacteria fermentation lyophilized powder. When used, the supernatant lyophilized powder is dissolved and diluted to 500mg / mL with sterile water, and sterilized by filtering with a 0.22μm filter membrane.

[0077] 2.3 Double-layer plate method to detect the antibacterial effect of strains in vitro

[0078] The antibacterial ability of the strain was tested by double-layer plate culture method. The lower culture medium was MRS solid culture medium (1.5% agar). 10 μL of lactic acid bacteria suspension, blank MRS, and 1 mg / mL ketoconazole were inoculated on the MRS solid culture medium and cultured at 37°C for 24 hours. Prepare mDixon culture medium, sterilize at 121°C for 15 minutes, and add Malassezia furfur ATCC 14521 suspension when the temperature cools to about 40°C. The final concentration of Malassezia furfur was adjusted to 10 7 CFU / mL, 7-10mL / dish, after solidification, place under aerobic growth conditions at 30℃ and culture for 48h, observe and record whether there is an inhibition zone around the single colony and the size of the inhibition zone to determine whether it has the activity to inhibit the indicator bacteria. Use a vernier caliper to record the diameter of the inhibition zone (repeat 3 times, measure the diameter of the inhibition zone by the cross method, and calculate the average value x±s of the 3 measurements).

[0079] 2.4 Agar plate diffusion method to detect the in vitro antibacterial effect of cell-free supernatant of strains

[0080] Use sterile saline to dilute the Malassezia furfur solution to make 1×10 7 CFU / mL of bacterial suspension, take 100μL of various bacterial suspensions on the culture plate and spread evenly. Use a sterile hole puncher with a diameter of 8mm to evenly punch 4 holes on the culture medium plate. Pipette 100μL CFS (the supernatant lyophilized powder is dissolved in sterile water and diluted to 500mg / mL) and add it to the above holes, seal the culture dish, culture at 30℃ for 48h, and measure the size of the inhibition zone (repeat 3 times, determine the diameter of the inhibition zone by the cross method, and calculate the average value x±s of the 3 measurements). Negative control: 100μL MRS culture medium (the culture medium lyophilized powder is dissolved in sterile water and diluted to 500mg / mL). Positive control: 1mg / mL ketoconazole (dissolved in ultrapure water).

[0081] 2.5 Effects of different conditions on the antibacterial activity of Lactobacillus plantarum DACN128 CFS

[0082] 2.5.1 Effects of different fermentation times on the antibacterial activity of Lactobacillus plantarum DACN128 CFS

[0083] Plant lactobacillus DACN128 is activated by 2% (v / v) inoculum size and inoculated in 200mL MRS liquid medium. After culturing 12, 24, 48, 72h respectively at 37 ℃, at 4 ℃, 8000 × g is centrifuged for 10min, and the thalline is discarded. The supernatant is filtered with a 0.22 μm membrane to obtain a cell-free fermentation supernatant (CFS). With a rotary evaporator at 60 ℃, 80rpm / min is revolved to about 30mL of solution, and then placed in -80 ℃ of ultra-low temperature refrigerators for freezing for 24h. Then, vacuum freeze dryer is placed for 48h to obtain the lactobacillus fermentation liquid freeze-dried powder. During use, the supernatant freeze-dried powder is dissolved and diluted to 500mg / mL with sterilized water, and sterilized with a 0.22 μm membrane filtration.

[0084] 2.5.2 Effects of different concentrations of Lactobacillus plantarum DACN128 CFS on antibacterial activity

[0085] Use sterile saline to dilute the Malassezia furfur solution to make 1×10 7CFU / mL of bacterial suspension, take 100μL of various bacterial suspensions on the culture plate and spread evenly. Use a sterile hole puncher with a diameter of 8mm to evenly punch 4 holes on the culture medium plate. Pipette 100μL of different concentrations of Lactobacillus plantarum DACN128 cell-free fermentation supernatant (1000mg / mL, 800mg / mL, 600mg / mL, 400mg / mL) and add it to the above holes, seal the culture dish, culture at 30℃ for 48h, and measure the size of the inhibition zone (repeat 3 times, determine the diameter of the inhibition zone by the cross method, and calculate the average value x±s of the 3 measurements). Negative control: 100μL of different concentrations of MRS culture medium. Positive control: 1, 0.8, 0.6, 0.4mg / mL ketoconazole (dissolved in ultrapure water).

[0086] 2.5.3 Effects of different temperature treatments on CFS of Lactobacillus plantarum DACN128

[0087] In order to study the thermal stability of CFS, the cell-free fermentation supernatant of Lactobacillus plantarum DACN128 was heated at 25, 40, 60, 80, 100, and 121°C for 30 min, three in each group, cooled to room temperature, and sterilized by filtration with a 0.22 μm water filter membrane. The activity of each group of CFS in inhibiting Malassezia furfur was determined by agar diffusion method. The fermentation broth that had not been heat-treated was used as a control to determine the effect of heat-treated CFS on the antibacterial effect. The experiment was paralleled three times.

[0088] 2.5.4 Effect of different pH values ​​on the antibacterial activity of Lactobacillus plantarum DACN128 CFS

[0089] In order to evaluate the effect of pH on the antibacterial activity of CFS, the pH value of CFS was adjusted to 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0 and 9.0 with 5 mol / L NaOH or 5 mol / L HCl, and filtered with a 0.22 μm filter membrane for sterilization. The antibacterial activity of CFS at different pH was determined by agar pore diffusion method, and the fermentation broth without pH adjustment was used as a control to determine the effect of pH treatment on the antibacterial effect of CFS. The experiment was repeated three times.

[0090] 2.6 Minimum inhibitory concentration

[0091] The minimum inhibitory concentration (MIC) of CFS was determined by the two-fold dilution method to explore the inhibitory effect of its cell-free supernatant (CFS) on MFS. First, CFS was diluted twice with sterile water, and the concentrations after dilution were 1000, 500, 250, 125, 62.5, 31.25, 15.625, 7.183, and 3.906 mg / mL. 100 μL of fermentation broth of each concentration and an equal volume of Malassezia furfur suspension (final concentration of 1×10 7CFU / mL). At the same time, set up a positive control (indicator bacteria liquid + blank MRS) and a blank control (mD liquid culture + MRS liquid culture). Place the 96-well culture plate at 30℃ for aerobic culture for 48h and observe the growth in time. Take the positive control as the standard for good growth, observe the growth in each well with the naked eye and a magnifying glass, and the well with clear liquid and no colony growth is indicated by "+", and the well with colony growth is indicated by "-". The lowest drug concentration well with no visible colony growth is taken as the MIC of the experiment.

[0092] 2.7 Statistical analysis

[0093] Each experiment was performed three times in parallel. The experimental data were expressed as "mean ± standard deviation" and variance analysis was performed using SPSS20. P < 0.05 indicated statistical significance.

[0094] 3 Experimental results and analysis

[0095] 3.1 Screening of strains with inhibitory activity against Malassezia furfur

[0096] A total of 100 strains stored in the laboratory strain resource library were screened, and 8 lactic acid bacteria with the ability to inhibit Malassezia furfur ATCC 14521 were preliminarily selected. The inhibitory activities of the 8 lactic acid bacteria were compared, among which Lactobacillus plantarum DACN128 showed the strongest inhibitory activity against Malassezia furfur ( Figure 6 ). The double-layer plate method was used for detection. After 24 hours of culture, the diameter of the inhibition zone of Lactobacillus plantarum DACN128 was 20.32±0.52mm( Figure 5 A). The cell-free supernatant of Lactobacillus plantarum DACN128 fermented for 24 h was lyophilized and then adjusted to a concentration of 500 mg / mL. 100 μl CFS was added to the modified MD agar wells. Figure 5 As shown in B, no inhibition zone appeared in the blank MRS, but an obvious inhibition zone appeared around the agar wells with the addition of Lactobacillus plantarum DACN128CFS, and the inhibition diameter reached 14.06±0.49 mm, showing a strong antibacterial ability.

[0097] 3.2 Effects of different conditions on the antibacterial activity of CFS

[0098] 3.2.1 Effects of different fermentation times on the antibacterial activity of Lactobacillus plantarum DACN128 CFS

[0099] After activation, Lactobacillus plantarum DACN128 was inoculated in 200 mL of MRS liquid culture medium at a 2% (v / v) inoculation rate and cultured at 37°C for 12, 24, 48, and 72 h. CFS at different fermentation times were taken to determine the antibacterial activity. Figure 7A shows that the antibacterial activity of CFS cultured for 12 h was significantly lower than that of the culture fluid after 24 h of culture. There was no significant difference in the antibacterial activity of CFS after 24 h, 48 h and 72 h (P>0.05). Subsequent studies used the cell-free fermentation supernatant at 24 h of fermentation.

[0100] 3.2.2 Effect of different concentrations of Lactobacillus plantarum DACN128 CFS on antibacterial activity

[0101] like Figure 7 As shown in Figure B, with the continuous increase of the concentration of Lactobacillus plantarum DACN128 CFS, the activity of CFS in inhibiting Malassezia furfur became higher, and there were significant differences in the antibacterial activities of different concentrations (P < 0.05). When the CFS concentration was 800 mg / mL, the diameter of the inhibition zone was 11.93 ± 0.48 mm, and when the concentration was increased to 1000 mg / mL, the inhibition zone could reach 16.38 ± 0.43 mm.

[0102] 3.2.3 Effects of different temperature treatments on the antibacterial activity of Lactobacillus plantarum DACN128 CFS

[0103] After the Lactobacillus plantarum DACN128 CFS was heated at 40, 60, 80, 100, and 121°C, the antibacterial activity of the CFS was detected using the unheated CFS as a control. Figure 7 It can be seen that with the increase of treatment temperature, there was no significant difference in the antibacterial activity of CFS compared with the control group (P>0.05). The results showed that CFS has certain high temperature resistance and strong thermal stability.

[0104] 3.2.4 Effect of different pH values ​​on the antibacterial activity of Lactobacillus plantarum DACN128 CFS

[0105] The cell-free fermentation supernatant of Lactobacillus plantarum DACN128 was close to 4.0 before adjustment. After adjusting the pH value of CFS to 2.0, 3.0, and 4.0, there was no significant difference in the antibacterial activity of CFS ( Figure 7 D), after adjusting the pH to 5, the antibacterial activity of CFS decreased significantly (P < 0.05), and there was no inhibition zone of CFS after adjusting the pH to 6-9. The antibacterial activity of CFS is affected by the pH value and the antibacterial activity is weakened or even disappears under alkaline conditions.

[0106] 3.3 Minimum inhibitory concentration analysis

[0107] As shown in Table 2, the concentration of Lactobacillus plantarum DACN128 CFS was adjusted by the two-fold dilution method. After co-culture with Malassezia furfur for 48 hours, no colonies were generated in the wells to which the unfermented supernatant of MRS was added and the wells to which the concentration was adjusted to 125 mg / mL. Therefore, the minimum inhibitory concentration of Lactobacillus plantarum DACN128 CFS for inhibiting Malassezia furfur was 125 mg / mL.

[0108] Table 2 Antibacterial effects of different concentrations of Lactobacillus plantarum DACN128CFS

[0109]

Claims

1. A strain of Lactobacillus plantarum DACN128, which is deposited in China Center for Type Culture Collection with a deposit number of CCTCC NO: M20241337.

2. A bacterial agent, the active ingredient of which comprises the plant lactobacillus DACN128 or its fermentation liquid or its cell-free fermentation supernatant according to claim 1.

3. The bacterial agent according to claim 2, characterized in that: The bacterial agent is freeze-dried powder.

4. A method for preparing the bacterial agent according to claim 2, characterized in that: The lactobacillus plantarum DACN128 according to claim 1 is inoculated into a culture medium and cultured to obtain the product.

5. The preparation method according to claim 4, characterized in that: The preparation method of the fermentation liquid is as follows: after activating the Lactobacillus plantarum DACN128 strain, the strain is cultured in a liquid culture medium at 37° C. for 12 to 48 hours to obtain the fermentation liquid of Lactobacillus plantarum DACN128; preferably, the liquid culture medium is an MRS liquid culture medium; The preparation method of the cell-free fermentation supernatant comprises the following steps: filtering the prepared Lactobacillus plantarum DACN128 fermentation liquid through a filter membrane to obtain the cell-free fermentation supernatant, and performing rotary evaporation and freeze-drying on the cell-free fermentation supernatant to prepare a freeze-dried powder.

6. Use of the plant lactobacillus DACN128 according to claim 1 or the bacterial agent according to claim 2 in any of the following: (1) Inhibit the growth of pathogenic Malassezia; (2) Use in the preparation of drugs for preventing and / or alleviating and / or treating diseases related to pathogenic Malassezia infection.

7. The use according to claim 6, characterized in that: The pathogenic Malassezia includes Malassezia furfur, Malassezia globosa, and Malassezia restricta; The related diseases are selected from at least one of tinea versicolor, Malassezia folliculitis, seborrheic dermatitis, atopic dermatitis, acne vulgaris, and psoriasis.

8. A product, characterized in that: It includes the plant lactobacillus DACN128 described in claim 1 or the bacterial agent described in claim 2.

9. The product according to claim 8, characterized in that: The product is selected from daily chemical products or medicines.

Images