Bacillus subtilis YB-15 and application thereof

Abstract

The invention discloses a bacillus subtilis YB-15 strain and an application of the bacillus subtilis YB-15 strain. The preservation number of the bacillus subtilis YB-15 strain is GDMCC No: 65208, and the bacillus subtilis YB-15 strain is a bacillus subtilis YB-15 strain. The YB-15 and the sterile fermentation liquor of the YB-15 show good inhibition effects on Cophinforma tumefaciens, Rhizoctonia solani and Diaporthe ueckeri, and field tests prove that the YB-15 and the sterile fermentation liquor of the YB-15 have remarkable prevention and treatment effects on the litsea cubeba shoot blight and have good development value and application potential in prevention and treatment of various plant diseases such as the litsea cubeba shoot blight, okra sotto-down disease and cassava leaf spot disease, and the YB-15 and the sterile fermentation liquor of the YB-15 can be widely applied to prevention and treatment of various plant diseases such as the litsea cubeba shoot blight and the okra sotto-down disease and the cassava leaf spot disease. And a new biocontrol strain resource is provided for biological control of pathogenic bacteria of litsea cubeba and other important forest trees.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology control of plant diseases, and specifically relates to a strain of Bacillus subtilis YB-15 and its application in controlling plant diseases caused by plant pathogens (including litsea cubeba blight pathogens and various plant pathogens). Background Art

[0002] Litsea cubeba, belonging to the genus Litsea cubeba, also known as mountain pepper, mountain pepper, etc., is widely distributed in eastern Asia, Oceania and the Pacific Islands, and is widely distributed in the low mountain and hilly areas south of the Yangtze River in my country. Its roots, stems, leaves and fruits can be used as medicine, with the effects of dispelling wind and cold, reducing swelling and relieving pain, warming the stomach and strengthening the stomach; Litsea cubeba oil has the effects of antibacterial, insect repellent, food preservation and antioxidant, and is widely used in medicine, cosmetics, food, spices, flavors, etc., and has important development and utilization value, so it is widely planted in Hunan, Zhejiang, Sichuan, Guangxi and other regions in my country.

[0003] Dieback is one of the most common tree diseases of Litsea cubeba. The occurrence of dieback is closely related to the climate and environment of the forest, and its pathogen is mainly spread through air currents in the forest. The disease can occur throughout the growth period of Litsea cubeba plants. After the pathogenic fungi infect the plants, the infected parts turn brown, and then with further infection by the pathogens, the top of the plants gradually die, branches and trunks crack, necrosis and other symptoms are gradually caused. Years of damage cause the crown to be bald, and even the whole plant to die, causing serious damage to Litsea cubeba forests.

[0004] In the process of forest pest control, scientific analysis of the causes of pests and diseases, understanding the characteristics and forms of pests and diseases, will help to better adopt effective prevention and control technologies and methods to solve the problem of pests and diseases. Pest control should be based on prevention. Once pests and diseases occur, they will bring immeasurable losses to the forestry economy. Traditional pest control technology is mainly chemical control, which will kill other organisms at the same time, destroy the ecosystem, and is not conducive to the healthy development of the forestry economy. Therefore, it is necessary to actively adopt biological control technology to reduce the impact of pest control on the ecological environment. As a cutting-edge forest pest control technology, biological control technology constitutes an important part of the comprehensive management strategy and shows great development potential. This technology uses microorganisms isolated from soil and plant tissues to prevent and control forest pests and diseases. This control method not only does not pollute the environment, but also effectively reduces the risk of pathogens developing drug resistance. More importantly, it does not threaten the stability of the forest ecosystem. Therefore, biological control technology has significant advantages and plays an important role in the prevention and control of various plant diseases.

[0005] However, there are few reports on the antagonism of Litsea cubeba dieback pathogen. In order to better prevent the outbreak of Litsea cubeba dieback and promote the green and healthy development of the Litsea cubeba industry, it is urgent to study the pathogenic mechanism of Litsea cubeba dieback disease, identify the target pathogens, and screen out antagonistic bacteria. Summary of the invention

[0006] Based on this, the object of the present invention is to provide Bacillus subtilis YB-15 and its application. Bacillus subtilis YB-15 and its fermentation liquid can inhibit a variety of plant pathogens such as Cophinforma tumefaciens, Rhizoctonia solani, Diaporthe ueckeri, etc., and can be used to effectively prevent and control plant diseases such as litsea cubeba dieback, okra blight and cassava leaf spot.

[0007] The specific technical solutions for achieving the above-mentioned invention objectives include the following.

[0008] The first aspect of the present invention provides Bacillus subtilis YB-15, whose deposit number is GDMCC No:65208.

[0009] The second aspect of the present invention provides the use of the above-mentioned Bacillus subtilis YB-15, its bacterial suspension, and / or its fermentation liquid in preventing and controlling plant diseases caused by pathogenic bacteria.

[0010] The third aspect of the present invention provides a bacterial agent or biological agent comprising the above-mentioned Bacillus subtilis YB-15.

[0011] The fourth aspect of the present invention provides a method for preventing and controlling litsea cubeba dieback disease, comprising the following steps: spraying the above-mentioned bacterial agent or biological agent on litsea cubeba seedlings or plants.

[0012] The fifth aspect of the present invention provides a method for preventing and controlling okra wilting disease, comprising the following steps: spraying the above-mentioned bacterial agent or biological agent on okra leaves or fruits.

[0013] The sixth aspect of the present invention provides a method for preventing and controlling cassava leaf spot disease, comprising the following steps: spraying the above-mentioned bacterial agent or biological agent on cassava leaves.

[0014] The Bacillus subtilis YB-15 described in the present invention is classified and named Bacillus subtilis, and was deposited in the Guangdong Provincial Microbiological Culture Collection Center on September 26, 2024. The storage address is Building 59, No. 100 Xianlie Middle Road, Guangzhou, and the storage number is GDMCC No: 65208.

[0015] The present invention separates and identifies a strain of Bacillus subtilis YB-15 which has a good antagonistic effect on Cophinforma tumefaciens, and also exhibits a good inhibitory effect on multiple pathogens such as Rhizoctonia solani and Diaporthe ueckeri. Field test results show that the strain has a significant control effect on litsea cubeba dieback. Therefore, Bacillus subtilis YB-15 provides a new biocontrol strain resource for biological control of pathogens of litsea cubeba and other important forest trees, and has good development value and application potential in the control of multiple plant diseases such as litsea cubeba dieback, okra wilting disease, cassava leaf spot disease, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is a plate confrontation experiment diagram of strain YB-15 in Example 1 of the present invention and Cophinformatumefaciens, the pathogen of litsea cubeba blight.

[0017] Figure 2 This is a graph showing the inhibitory effect of the fermentation liquid of strain YB-15 in Example 1 of the present invention on the mycelial growth of Cophinformatumefaciens, the pathogen of litsea cubeba dieback disease; wherein A is the control group and B is the test group.

[0018] Figure 3 This is a phylogenetic tree diagram of strain YB-15 in Example 1 of the present invention based on combined 16S rRNA sequence and gyrA gene sequence analysis.

[0019] Figure 4 This is a diagram of the morphological changes in the mycelium of Cophinformatumefaciens, the pathogen of litsea cubeba dieback disease, observed under a microscope in Example 2 of the present invention; wherein A is the control group and B is the test group.

[0020] Figure 5 This is a diagram showing the disease development of adult Litsea cubeba plants 3 months after field spraying of the fermentation liquid of strain YB-15 in Example 3 of the present invention; wherein A is sprayed with water, and B is sprayed with the fermentation liquid of strain YB-15.

[0021] Figure 6 The figures are the plate confrontation experiment effect diagrams of strain YB-15 and Rhizoctonia solani and Diaporthe ueckeri in Example 4 of the present invention, wherein A is the confrontation effect diagram of strain YB-15 and Rhizoctonia solani, and B is the confrontation effect diagram of strain YB-15 and Diaporthe ueckeri.

[0022] Figure 7 The graphs show the inhibitory effect of the fermentation broth of strain YB-15 on the mycelial growth of Rhizoctonia solani and Diaporthe ueckeri in Example 4 of the present invention, A and B show the inhibitory effect of the fermentation broth of strain YB-15 on Rhizoctonia solani, wherein A is the control group and B is the test group; C and D show the inhibitory effect of the fermentation broth of strain YB-15 on Diaporthe ueckeri, wherein C is the control group and D is the test group. DETAILED DESCRIPTION

[0023] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0024] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0025] Unless otherwise specified, the examples are based on conventional experimental conditions, such as Sambrook et al. Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2013), or the conditions recommended by the manufacturer's instructions.

[0026] The inventors of the present applicant have previously isolated and identified the pathogens of litsea cubeba dieback disease, and determined that the pathogen causing litsea cubeba dieback disease is Cophinforma tumefaciens, which mainly infects the branches and trunks of litsea cubeba. After infection, the cortex of the diseased parts turns brown, the branches and trunks crack, and the branches and trunks of litsea cubeba plants dry up and die. The pathogen Cophinforma tumefaciens (formerly known as Cophinforma atrovirens) is also a pathogenic fungus of many plants such as citrus, eucalyptus urophylla, mulberry, trifoliate orange, crape myrtle, and mango (Zhao et al. (2021)), and the pathogen has been listed as one of the quarantine fungi in China.

[0027] The present invention adopts the dilution coating plate method and the plate confrontation method to screen a strain YB-15 with good inhibitory effect on the pathogenic bacteria Cophinforma tumefaciens of litsea cubeba blight from the soil. Based on the colony characteristics of the strain YB-15 and the combined 16S rRNA sequence and gyrA gene sequence comparison analysis and phylogeny analysis, it is identified as Bacillus subtilis. The performance test of Bacillus subtilis YB-15 was carried out, and the following results were obtained: 1. The plate experiment results show that Bacillus subtilis YB-15 has a good inhibitory effect on Cophinforma tumefaciens, with an inhibition rate of 63.09%, and the inhibition rate of its sterile fermentation liquid on Cophinforma tumefaciens is 75.67%. 2. In the field, the fermentation liquid of strain YB-15 was sprayed on the seedlings of Litsea cubeba, and the development of Litsea cubeba dieback disease was statistically investigated one month after the spraying. The results showed that the number of lesions in the control group sprayed with water increased by 60%, while the number of lesions in the spraying of strain YB-15 fermentation liquid increased by 5.88%; the fermentation liquid of strain YB-15 was sprayed on the adult Litsea cubeba plants. Compared with the control group sprayed with water, the infected parts of the plants did not further crack after spraying the fermentation liquid of strain YB-15, and the cracked parts healed, while the infected parts of the control group did not heal. 3. Microscopic observation results showed that strain YB-15 inhibited the growth of the pathogen of Litsea cubeba dieback disease by curling the mycelium morphology of the pathogen Cophinforma tumefaciens. 4. Bacillus subtilis YB-15 also showed good inhibitory effects on plant pathogens Rhizoctonia solani and Diaportheueckeri, with an inhibition rate of 65.33% on Rhizoctonia solani and 78.41% on Diaporthe ueckeri. The inhibition rates of its sterile fermentation liquid on Rhizoctonia solani and Diaporthe ueckeri were 71.45% and 78.01%, respectively. Therefore, Bacillus subtilis YB-15, bacterial suspension or fermentation liquid can be prepared into biological preparations, providing new biological control strain resources for biological control of pathogens of Litsea cubeba and other important forest trees, and having good development value and application potential in the prevention and control of various plant diseases such as Litsea cubeba dieback, okra blight caused by Rhizoctonia solani and cassava leaf spot caused by Diaportheueckeri.

[0028] In some embodiments of the present invention, a strain of Bacillus subtilis YB-15 is disclosed, and its deposit number is GDMCC No:65208.

[0029] In other embodiments of the present invention, the use of the above-mentioned Bacillus subtilis YB-15, bacterial suspension or fermentation liquid in preventing and controlling plant diseases caused by pathogenic bacteria is disclosed.

[0030] In some embodiments, the pathogen is Cophinforma tumefaciens, Rhizoctoniasolani or Diaporthe ueckeri.

[0031] In some embodiments, the plant disease is litsea cubeba dieback caused by Cophinforma tumefaciens, okra blight caused by Rhizoctonia solani, or cassava leaf spot caused by Diaporthe ueckeri.

[0032] In other embodiments of the present invention, a bacterial agent comprising the above-mentioned Bacillus subtilis YB-15 is disclosed.

[0033] In other embodiments of the present invention, a biological preparation comprising the above-mentioned Bacillus subtilis YB-15 is disclosed.

[0034] In other embodiments of the present invention, a method for preventing and controlling litsea cubeba dieback disease is disclosed, comprising the following steps: spraying the above-mentioned bacterial agent or biological agent on litsea cubeba seedlings or plants.

[0035] In some embodiments, the concentration of Bacillus subtilis YB-15 in the bacterial agent or biological agent is 0.8×10 7 cfu~1.2×10 7 cfu.

[0036] In other embodiments of the present invention, a method for preventing and controlling okra wilt disease is disclosed, comprising the following steps: spraying the above-mentioned bacterial agent or biological agent on okra leaves or fruits.

[0037] In other embodiments of the present invention, a method for preventing and controlling cassava leaf spot disease is disclosed, comprising the following steps: spraying the above-mentioned bacterial agent or biological agent on cassava leaves.

[0038] In the following examples, the tested litsea cubeba pathogen Cophinforma tumefaciens was isolated from litsea cubeba blight-susceptible plants in a litsea cubeba plantation in Yiyang, Hunan; the plant pathogens Rhizoctonia solani and Diaportheueckeri were both donated by Professor Yi Runhua of Guangdong Ocean University and stored in the laboratory.

[0039] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0040] Example 1 Isolation, Screening and Identification of Antagonistic Bacteria YB-15 against Litsea cubeba Blight

[0041] In this example, a strain YB-15 antagonistic to litsea cubeba blight was obtained by separation and screening using the dilution coating plate method and the plate confrontation method, and was identified as Bacillus subtilis. The specific steps include:

[0042] 1. Weigh 0.1g of the collected soil and mix it with 0.9ml of sterile water, then dilute it to 10 -4 , 10 -5 , 10 -6 Take 100 μl of each and dilute it to 10 -4 , 10 -5 , 10 -6 The soil solutions were spread on PDA solid culture medium and cultured at 28°C for 2 to 3 days. After single colonies grew on the plates, single clones were picked out for purification and preservation. A total of 60 strains of Bacillus were purified.

[0043] 2. Mark the back of the PDA plate by the cross method, use a sterile punch with a diameter of 6 mm to prepare a cake of Cophinforma tumefaciens, and inoculate the cake in the center of the PDA plate culture medium. Mark 4 points on the cross line 2.5 cm away from the bacterial block, 3 of which are inoculated with soil isolates, and 1 point is not inoculated. Repeat each treatment 3 times. When the control pathogenic fungal colony grows close to the edge of the culture dish, measure the colony size and calculate the inhibition rate according to the formula.

[0044] Inhibition rate (%) = (control group diameter - test group diameter) / control group diameter × 100

[0045] Through the plate confrontation experiment, three strains with good antagonism to Cophinformatumefaciens, the pathogen of litsea cubeba blight, were screened out. The colony diameter of strain YB-15 in the experimental group was 1.34±0.29cm (the colony diameter of the control group was 3.63±0.47cm), and the inhibition rate was 63.09% ( Figure 1 ).

[0046] 3. Pick the single colonies of the above three strains with good antagonism to Cophinforma tumefaciens, the pathogen of litsea cubeba blight, in LB medium, culture at 37°C with shaking for 2 days, take 10 ml of the cultured antagonistic bacteria fermentation liquid, centrifuge at 5000rpm for 10 minutes, take the supernatant, filter with a 0.22μm filter membrane, and obtain the sterile fermentation liquid of the strain, which is stored at 4°C for standby use. Add the sterile fermentation liquid of the strain to the PDA medium to dilute it 50 times, mix it thoroughly and pour it on the plate to obtain the fermentation liquid plate containing the strain. Use a sterile punch with a diameter of 6mm to prepare the litsea cubeba pathogenic bacteria block, and inoculate the bacterial cake in the center of the PDA plate medium. Use the PDA plate with an equal amount of LB culture medium as the control, and repeat each treatment 3 times. When the pathogenic fungal colony in the control group grows close to the edge of the dish, measure the size of the pathogenic fungal colony and calculate the inhibition rate according to the formula.

[0047] Inhibition rate (%) = (control group diameter - test group diameter) / control group diameter × 100

[0048] The results of the plate experiment showed that the fermentation liquid of strain YB-15 also had a good inhibitory effect on the pathogen that causes the blight of Litsea cubeba ( Figure 2 ), the colony diameter of the control group was 5.22cm±0.49cm, the colony diameter of the test group was 1.27cm±0.08cm, and the inhibition rate was 75.67%. The inhibition rate of the fermentation broth of the other two strains on Cophinforma tumefaciens was only about 35%.

[0049] 4. The colonies of strain YB-15 on PDA medium were milky white, dry, wrinkled, and had irregular edges, similar to the colony morphology of Bacillus. The 16S rRNA gene and gyrA gene fragments of YB-15 were amplified by colony PCR using universal primers 16S-27f (SEQ ID NO: 1) / 16S-1492r (SEQ ID NO: 2) and specific primers gyrA-F (SEQ ID NO: 3) / gyrA-R (SEQ ID NO: 4), respectively.

[0050] 16S-27f:AGAGTTTGATCCTGGCTCAG(SEQ ID NO:1)

[0051] 16S-1492r:TACGGCTACCTTGTTACGACTT(SEQ ID NO:2)

[0052] gyrA-F:CAGTCAGGAAATGCGTACGTCCCTT (SEQ ID NO: 3)

[0053] gyrA-R:CAAGGTAATGCTCCAGGCATTGCT(SEQ ID NO:4)

[0054] After positive detection by 1% agarose gel electrophoresis, the strains were recovered and sent to the company for sequencing. The obtained sequences were subjected to Blastn analysis. The 16S rRNA sequence analysis showed that the sequence similarity between strain YB-15 and Bacillus subtilis, Bacillus rugosus, Bacillus stercoris, Bacillus halotolerans, Bacillus mojavensis, etc. in the genus Bacillus was 100%, while the gyrA gene sequence analysis showed that the sequence similarity between strain YB-15 and Bacillus subtilis and Bacillus stercoris exceeded 98%. Strains with higher homology to strain YB-15 in the genus Bacillus were selected for phylogenetic analysis based on the combined 16S rRNA and gyrA gene sequences. The results showed that strain YB-15 and Bacillus subtilis were on the same evolutionary branch, and the bootstrap test was performed, and the bootstrap value was 87% ( Figure 3 Therefore, based on the colony morphology of strain YB-15 and the results of 16S rRNA and gyrA gene sequence analysis, strain YB-15 was preliminarily identified as Bacillus subtilis.

[0055] Example 2 Effect of strain YB-15 on hyphae growth of litsea cubeba blight pathogen

[0056] The pathogen of Litsea cubeba blight was inoculated in the center of the PDA plate, and the antagonistic bacteria YB-15 was inoculated 2.0 mm away from the pathogen. The control group was not inoculated with antagonistic bacteria YB-15. After the size of the pathogen colony stabilized, the mycelium of the pathogen near the edge of the inhibition zone was selected to make a temporary slide for microscopic observation to observe the differences and changes in the mycelium morphology of the pathogen in the control group and the test group.

[0057] Microscopic observation revealed that compared with the control group, under the action of antagonistic bacteria YB-15, the hyphae of Cophinforma tumefaciens, the pathogen of litsea cubeba blight, curled ( Figure 4 ).

[0058] Example 3 Evaluation of the field control effect of strain YB-15

[0059] The fermentation broth of strain YB-15 was diluted with water to a concentration of 1×10 7cfu, and add 2% sucrose for standby use. Six litsea cubeba seedlings were treated as a group, and the diluted YB-15 fermentation liquid was evenly sprayed on the branches and trunks of the diseased litsea cubeba seedlings (the average number of lesions per tree was 16), and the control group (the average number of lesions per tree was 12) was sprayed with an equal amount of clean water. Under natural conditions, the disease was observed, and the spraying was performed once every month. One month after the spraying, the disease development was investigated and statistically analyzed to evaluate the disease prevention and control effect. The statistical results showed that the number of lesions of the diseased litsea cubeba seedlings sprayed with the fermentation liquid of the strain YB-15 was 17 / tree, an increase of 5.88%, while the number of lesions in the control group was 30 / tree, an increase of 60%.

[0060] In addition, when adult litsea cubeba plants were sprayed with fermented liquid of strain YB-15 and clean water, two months later, it was found that the cracked parts of the litsea cubeba plants sprayed with fermented liquid of strain YB-15 healed, while the cracked parts of the plants sprayed with clean water did not heal ( Figure 5 ).

[0061] The results of this example show that Bacillus subtilis YB-15 has a significant control effect on Litsea cubeba dieback disease, and has application potential in the preparation of biological agents for the prevention and control of Litsea cubeba dieback disease.

[0062] Example 4 Inhibition of other pathogens by strain YB-15

[0063] Take the preserved strain YB-15 for streaking and culture at 37℃ for 3 days. Mark the back of the PDA plate by the cross method, use a sterilized punch with a diameter of 6mm to prepare Rhizoctonia solani and Diaportheueckeri cakes, and inoculate the cakes in the center of the PDA plate culture medium. Mark 4 points on the cross line 2.5cm away from the bacterial block, 3 of which are inoculated with strain YB-15, and 1 point is not inoculated. Each treatment is repeated 3 times. When the pathogenic fungal colony in the control group grows close to the edge of the dish, measure the colony size and calculate the inhibition rate according to the formula.

[0064] Pick a single colony of strain YB-15 in LB medium, shake and culture at 37°C for 2 days, take 10ml of the cultured antagonistic bacteria fermentation liquid, centrifuge at 5000rpm for 10min, take the supernatant, filter with a 0.22μm filter membrane, and obtain the sterile fermentation liquid of strain YB-15 (diluted to 1 / 50), which is stored at 4°C for use. Add the fermentation liquid of strain YB-15 to PDA medium to dilute it 50 times, mix it thoroughly and pour it into a plate to obtain a fermentation liquid plate containing strain YB-15. Use a sterile punch with a diameter of 6mm to prepare pathogenic bacteria blocks, and inoculate the bacteria cakes in the center of the PDA plate medium. Use the PDA plate with an equal amount of LB culture medium as the control, repeat each treatment 3 times, and calculate the inhibition rate when the pathogenic fungal colonies in the control group grow close to the edge of the dish.

[0065] Inhibition rate (%) = (control group diameter - test group diameter) / control group diameter × 100

[0066] Table 1 Inhibitory effect of YB-15 and its fermentation liquid on plant pathogens

[0067]

[0068] Both sets of results showed that strain YB-15 had a good inhibitory effect on Rhizoctonia solani and Diaporthe ueckeri ( Figure 6 and Figure 7 ), among which the inhibition rate of strain YB-15 on Rhizoctonia solani was 65.33%, and the inhibition rate of its fermentation broth on Rhizoctonia solani was 71.45%; the inhibition rate of strain YB-15 on Diaporthe ueckeri was 78.41%, and the inhibition rate of its fermentation broth was 78.01%.

[0069] Therefore, Bacillus subtilis YB-15 has a good control effect on Rhizoctonia solani and Diaporthe ueckeri, and can be used to control plant diseases caused by Rhizoctonia solani and Diaporthe ueckeri (such as okra blight and cassava leaf spot, etc.).

[0070] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0071] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A strain of Bacillus subtilis YB-15, whose deposit number is GDMCC No: 65208.

2. Use of the Bacillus subtilis YB-15, its bacterial suspension, and / or its fermentation liquid according to claim 1 in preventing and controlling plant diseases caused by pathogenic bacteria.

3. The use according to claim 2, characterized in that: The pathogenic bacteria are Cophinforma tumefaciens, Rhizoctonia solani or Diaporthe ueckeri.

4. The use according to claim 2, characterized in that: The plant disease is litsea cubeba dieback caused by Cophinformatumefaciens; and / or, the plant disease is okra wilt caused by Rhizoctonia solani; and / or, the plant disease is cassava leaf spot caused by Diaporthe ueckeri.

5. A bacterial agent comprising the Bacillus subtilis YB-15 according to claim 1.

6. A biological preparation comprising the Bacillus subtilis YB-15 according to claim 1.

7. A method for preventing and treating litsea cubeba dieback disease, characterized in that: The following steps are involved: Spray the bacterial agent described in claim 5 or the biological agent described in claim 6 on Litsea cubeba seedlings or plants.

8. The method for preventing and treating litsea cubeba dieback disease according to claim 7, characterized in that: The concentration of Bacillus subtilis YB-15 in the bacterial agent or biological agent is 0.8×10 7 cfu~1.2×10 7 cfu.

9. A method for preventing and treating okra wilt disease, characterized in that: The method comprises the following steps: spraying the bacterial agent according to claim 5 or the biological agent according to claim 6 on okra leaves or fruits.

10. A method for preventing and treating cassava leaf spot disease, characterized in that: The following steps are involved: The cassava leaves are sprayed with the bacterial agent according to claim 5 or the biological agent according to claim 6.

Images