Mutant high-stable catalase and construction method thereof

By optimizing the codons of catalase sequences from thermophilic bacteria and constructing mutant, highly stable catalases, the problem of preparing highly stable catalases in existing technologies has been solved. This approach achieves high expression levels and stability, making it suitable for large-scale preparation and applicable to the food, pulp and paper, clothing bleaching, and medical fields.

CN119464240BActive Publication Date: 2025-11-07ZHEJIANG UNIV OF TECH SHAOXING BIOMEDICAL RES INST CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411132464.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-19
Publication Date
2025-11-07
Estimated Expiration
2044-08-19

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the efficient preparation of highly stable catalases, and they are also difficult to maintain activity under extreme conditions, which limits their application in many fields.

Method used

By codon optimization of the catalase sequence from thermophilic bacteria, a mutant highly stable catalase was constructed. It was then integrated into the pET-28a vector using seamless cloning technology and expressed in Escherichia coli BL21(DE3), achieving high expression and stability.

Benefits of technology

We have developed a catalase with high expression levels, good solubility, and resistance to heat, acids, and alkalis. It is suitable for large-scale preparation, has high relative enzyme activity, and is applicable to multiple fields.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119464240B_ABST
    Figure CN119464240B_ABST
Patent Text Reader

Abstract

The application discloses a mutant high-stability catalase and a construction method thereof, and the construction method comprises the following steps: obtaining a catalase sequence from a thermophilic bacteria source in a NCBI database; synthesizing a mutated amino acid sequence by using a codon optimization; amplifying a target gene and a pET-28a vector by using PCR; cloning the target gene into the pET-28a vector by using seamless cloning; and transforming into BL21 (DE3) for expression, wherein the catalase has the advantages of high prokaryotic expression, direct synthesis, large-scale preparation, simple operation, good solubility, and wide application in food industry, environmental protection industry, papermaking industry, textile industry, industrial enzyme catalysis and the like.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a catalase and a construction method thereof, more particularly to a mutant high-stable catalase and a construction method thereof, and belongs to the technical field of biological genetic engineering. BACKGROUND

[0002] Catalase (CAT) is widely present in human body, animals, plants and microorganisms. For example, most of the bacteria, actinomycetes and other microorganisms in the organelles of plants, the liver of animals and cells contain the enzyme. It is an important antioxidant enzyme, which decomposes hydrogen peroxide (H2O2) in the process of cell metabolism, and converts it into water and oxygen, thereby protecting the cells from oxidative damage. Catalase mainly consists of single subunit or multiple identical or different subunits. It can be mainly divided into catalase containing hydrogen peroxide, manganese-containing catalase, copper-containing catalase, zinc-containing catalase. It can also be divided into tetrameric catalase, which is the most common type, usually consisting of four identical subunits, each subunit containing a heme cofactor as an active center, non-heme catalase: does not contain a heme cofactor, but still has catalytic activity; special catalase: for example, some microorganisms can produce very heat-resistant catalase, or enzymes that can remain active in extreme environments. In the current research, obtaining a large amount of fermentation products by expressing in microorganisms is the trend of biological fermentation. SUMMARY

[0003] The present application aims to provide a mutant high-stable catalase and a construction method thereof, which has the technical characteristics of high prokaryotic expression amount, direct synthesis, suitability for large-scale preparation, simple operation, good solubility, etc.

[0004] In order to achieve the above-mentioned purpose, the present application is realized by the following technical scheme:

[0005] The mutant high-stable catalase of the present application has the protein sequence of:

[0006] MEARKAPRLTTADGRPIGDNQNALTAGPRGPLLIQDVQLLEQIQHFNRERIPERVVHAKGSGAYGTFTVTNDVTRYTKAAFLSEVGKQTEVFVRFSTVAGERGAADAERDVRGFAVKFYTEEGNFDLVGNNTPVFFVRDPYKFQMFIHSQKRHPKTNLRDPDMQWDFWSLCPESLHQVTILFSDRGIPASYRHMNGYGSHTYSMYNDRGELFWVKFHFKTQQGIKCLTDEEAARLIGEDRETHQRDLYEAIERGDYPRWTLYIQVMTPEQAENFRWNPFDLTKVWPHAEFPLIEVGVLELNRNPENYFAEVEQAAFKPSAFVPGIGPSPDKMLQARLMSYADAHRYRLGVNYQQLKVNRPRCPVHHYQRDGFMAQIEGSGHPNYFPNSIPGSPQDDPIYKEPAWHLGEVIVDRYDSRKDHDDYTQAGNLYRLFDEGQKDRLARAIAASLGQARLEVQKRQLGHFYRADVDYGRRVARALGFDPAAAEAELGIDASVAG.

[0007] Preferably, the molecular weight of the mutant high-stability catalase is 57.07 kDa, and the theoretical isoelectric point is 6.584.

[0008] Preferably, the mutant high-stability catalase does not have a signal peptide and a transmembrane domain.

[0009] The application also provides a construction method of the mutant high-stability catalase.

[0010] Step 1) obtaining a catalase sequence from a thermophilic bacterium in the NCBI database;

[0011] Step 2) synthesizing a mutated amino acid sequence by using codon optimization;

[0012] Step 3) amplifying the target gene and the pET-28a vector by PCR;

[0013] Step 4) cloning the target gene into the pET-28a vector by using seamless cloning;

[0014] Step 5) transforming into BL21 (DE3) for expression.

[0015] Preferably, step 1) to step 2) specifically comprises: obtaining the catalase sequence WP_012845258.1 from thermophilic bacteria in the NCBI database, mutating the amino acids, then codon optimizing the sequence with E. coli as the host, synthesizing the sequence on pGEX-4T-1, and taking TOP10 as the host strain to obtain a plasmid containing the optimized target gene.

[0016] Preferably, the plasmid construction: taking the synthesized pGEX-4T-1-CAT plasmid as the template, using primers Cat-f and Cat-r to amplify the target gene CAT by PCR, using X-F and X-R to amplify the linearized vector fragment of pET28a containing the homologous arm, and using 1% agarose gel electrophoresis to electrophorese the products, using ultraviolet to detect the size of the electrophoresis bands of the products, and if the size is consistent, using a gel recovery kit to recover the products.

[0017] Preferably, the Cat-f primer sequence (5'-3')

[0018] GAGATATACCATGGAAGCGCGCAAAGCGCCGCG; Cat-r primer sequence (5'-3') TTCTTAGCCCGCCACGCTCGCATCAATGCCCA; X-F primer sequence (5'-3') GCGTGGCGGGCTAAGAATTCGAGCTCCGTC; X-R primer sequence (5'-3')

[0019] GCGCTTCCATGGTATATCTCCTTCTTAAAGTTAAAC.

[0020] Preferably, the seamless cloning: the target gene CAT obtained by PCR recovery and the linearized vector of pET28a containing the homologous arm are connected by seamless cloning, and the reaction condition is 50°C for 30 min.

[0021] Preferably, step 5) specifically comprises heat shock transformation of DH5α, plasmid extraction, heat shock transformation of BL21(DE3), and strain induction expression; the heat shock transformation of DH5α specifically comprises the following steps:

[0022] 1) Take the DH5α competent cells from the -80°C refrigerator and place them on ice to thaw;

[0023] 2) Add the seamless cloning product to the thawed DH5α competent cells, gently tap the centrifuge tube wall to mix the seamless cloning product and the DH5α competent cells well, place on ice for 30 min, and open the 42°C water bath;

[0024] 3) 42°C water bath heat shock 45s, immediately placed on ice for 3-5 min, add 700uL medium, 37°C, 220 rpm for 60 min;

[0025] 4) 12000 rpm, 4°C, centrifuge for 1 min, discard the supernatant, leave 200uL for resuspension, and spread on the corresponding resistant LB plate, and place at 37°C for 12h;

[0026] 4) Pick and verify: pick colonies from the above LB plate into 5mL LB medium, and incubate at 37°C, 220 rpm for 12h for identification. If the sequence is correct, return the bacteria and plasmid.

[0027] Preferably, plasmid extraction: transfer the returned plasmid, incubate at 37°C, 220 rpm for 12h, then use the plasmid mini extraction kit for plasmid extraction, measure the plasmid concentration by ultraviolet spectrophotometer, and store at -20°C.

[0028] Preferably, the specific steps of heat shock transformation of BL21(DE3) are as follows:

[0029] 1) Take BL21(DE3) competent cells from -80°C refrigerator, and place on ice for thawing;

[0030] 2) Add 10uL of the above plasmid to 100uL of thawed BL21(DE3) competent cells, and gently tap the centrifuge tube wall to mix the plasmid and BL21(DE3) competent cells thoroughly, and place on ice for 30 min;

[0031] 3) Turn on the 42°C water bath, heat shock for 45s in the 42°C water bath, immediately place on ice for 3-5 min, add 700uL medium, and incubate at 37°C, 220 rpm for 60 min;

[0032] 4) 12000 rpm, 4°C, centrifuge for 1 min, discard the supernatant, leave 200uL for resuspension, and spread on the corresponding resistant LB plate, and place at 37°C for 12h.

[0033] Preferably, strain induction expression: 1) pick a single colony into 5mL LB medium, add 5uL of 50mg / mL Kan solution, and incubate at 37°C, 220 rpm until OD600 is 0.6-0.8; 2) add 5uL of 1M IPTG, and incubate at 37°C, 220 rpm for 12h to obtain hydrogen peroxidase protein.

[0034] Beneficial effects: the peptide segment of the mutant catalase of the application is short, the molecular weight is only 57.07 kDa, can be directly synthesized, and is suitable for large-scale preparation; a large amount of protein is obtained by eukaryotic expression, and the relative enzyme activity of the protein is higher than that of the hydrogen peroxide enzyme product on the market; the mutant catalase has the effects of heat resistance and acid and alkali resistance, can maintain stable activity during transportation and preservation, and has high stability; has the technical characteristics of simple operation, good solubility, and is suitable for use in multiple fields. BRIEF DESCRIPTION OF DRAWINGS

[0035] Figure 1 is a gel electrophoresis map of the target gene of the pET-28a vector of the application.

[0036] Figure 2 is a gel electrophoresis map of the target gene of the CAT of the application.

[0037] Figure 3 is a pET28a-CAT plasmid map of the application.

[0038] Figure 4 is a sequence alignment map of the sequencing result of the application.

[0039] Figure 5 is a protein gel map of the CAT protein expressed in BL21 (DE3) of the application.

[0040] Figure 6 is a protein expression map of the standard control and the CAT crude enzyme liquid of the application.

[0041] Figure 7 is a comparison map of the enzyme activity of the standard and the CAT crude enzyme liquid of the application.

[0042] Figure 8 is a CAT acid and alkali environment tolerance test map of the application.

[0043] Figure 9 is a CAT 10 min temperature environment tolerance test map of the application.

[0044] Figure 10 is a CAT enzyme activity change map of the application within 100 min of heating at 50 DEG C.

[0045] Figure 11 is a CAT enzyme activity change map of the application within 100 min of heating at 60 DEG C. DETAILED DESCRIPTION

[0046] The application will be further described below in conjunction with the drawings of the specification, but the application is not limited to the following examples.

[0047] The mutant catalase gene can be constructed into a plasmid for soluble expression, and the expression amount reaches the standard of industrial production.

[0048] As Figures 1-11 shown is a specific embodiment of a mutant high-stability catalase and its construction method, to realize the embodiment of a mutant high-stability catalase and its construction method, the following experiments are adopted.

[0049] I. Materials, instruments and reagents of the experiment

[0050] 1.1 Main materials

[0051] Escherichia coli DH5α species, Escherichia coli BL21(DE3) species, pET-28a(+) plasmid are purchased from Suzhou Jinyuzhi Biotechnology Co., Ltd. Catalase standard (22092200510) is from Shandong Longkete Enzyme Preparation Co., Ltd.

[0052] 1.2 Main instruments

[0053] Table 1 Main instruments

[0054]

[0055]

[0056] 1.3 Main reagents

[0057] Table 2 Main reagents

[0058]

[0059] 1.4 Preparation of main reagents

[0060] IPTG (1M):

[0061] 1) Weigh 2.4g IPTG powder into a 15mL centrifuge tube.

[0062] 2) Add 8mL sterilized water, mix thoroughly to dissolve, then add double distilled water to 10mL.

[0063] 3) Then filter sterilize in a clean bench with a 0.22μm filter membrane.

[0064] 4) Small portions are packed (1mL / portion) and stored at -20℃.

[0065] Sulfate kanamycin solution (Kan, 50mg / mL):

[0066] 1) Weigh 0.5g Kan powder into a 15mL centrifuge tube.

[0067] 2) Add 8mL sterilized water, mix thoroughly to dissolve, then add double distilled water to 10mL.

[0068] 3) Then filter sterilize in a clean bench with 0.22 μm filter.

[0069] 4) After aliquot (1 mL / portion), store at -20℃.

[0070] Coomassie Brilliant Blue R-250 staining solution (1 L):

[0071] 1) Weigh 1 g of Coomassie Brilliant Blue R-250 powder into a 1 L beaker.

[0072] 2) Measure 250 mL of isopropyl alcohol into the beaker and stir to dissolve.

[0073] 3) Add 100 mL of glacial acetic acid, stir to mix, and then add 650 mL of double distilled water, stir to mix.

[0074] 4) After removing particulate matter with filter paper, store at room temperature.

[0075] Coomassie Brilliant Blue destaining solution (1 L):

[0076] 1) Measure the following solutions into a 1 L beaker.

[0077] Ethanol 50 mL Glacial acetic acid 100 mL

[0078] 2) Add double distilled water to make up to 1 L, mix well, and use.

[0079] 10×PBS (1 L):

[0080] 1) Weigh the following reagents into a 1 L beaker.

[0081] Sodium chloride 80.0 g Disodium hydrogen phosphate 35.8 g Potassium dihydrogen phosphate 2.4 g Potassium chloride 2.0 g

[0082] 2) Add about 800 mL of double distilled water to the beaker, stir to dissolve.

[0083] 3) Adjust the pH to 7.2-7.4 by adding concentrated hydrochloric acid dropwise, and then add double distilled water to make up to 1 L.

[0084] 4) After autoclaving at 121℃ for 30 min, store at room temperature, and dilute to 1×PBS when used.

[0085] LB liquid medium (1 L):

[0086] 1) Weigh the following reagents into a 1 L beaker.

[0087] Peptone 10 g Sodium chloride 10 g Yeast extract 5 g

[0088] 2) Add about 800 mL of double distilled water, stir to dissolve.

[0089] 3) Add about 0.2 mL NaOH to adjust pH to 7.0.

[0090] 4) Add double distilled water to make up the volume to 1 L.

[0091] 5) After autoclaving at 121 °C for 20 min, store at 4 °C.

[0092] SDS-PAGE Running Buffer:

[0093] 1) Weigh the following reagents into a 1 L beaker.

[0094]

[0095] 2) Add about 800 mL double distilled water to the beaker and stir to dissolve.

[0096] 3) After adding double distilled water to make up the volume to 1 L, store at room temperature and dilute to 1 x SDS-PAGE Running Buffer when used.

[0097] 5 x SDS-PAGE Loading Buffer:

[0098] 1) Measure the following reagents into a 10 mL plastic centrifuge tube.

[0099] 1 M Tris-HCl (pH 6.8) 1.25 mL

[0100] SDS 0.5 g

[0101] Bromophenol blue (BPB) 25 mg

[0102] Glycerol (glycerin) 2.5 mL

[0103] 2) After dissolving in double distilled water, make up the volume to 5 mL.

[0104] 3) Store at room temperature in small aliquots (500 μl / aliquot).

[0105] 4) Before use, add 25 μl of β-mercaptoethanol to each aliquot, which can then be stored at room temperature for about a month.

[0106] II. Construction of Mutant Catalases with High Stability

[0107] 2.1 CAT gene synthesis

[0108] The sequence of catalase from thermophilic bacteria (WP_012845258.1) was obtained in the NCBI database, the 13th last amino acid I was mutated to A, and then codon optimization was performed using E. coli as the host. The gene synthesis sequence was placed on pGEX-4T-1, and TOP10 was used as the host strain. The gene synthesis obtained a plasmid containing the optimized target gene.

[0109] 2.2 Plasmid construction

[0110] (1) PCR: Using the synthesized pGEX-4T-1-CAT plasmid as the template, the target gene CAT was amplified by PCR using primers Cat-f and Cat-r, and the linearized vector fragment of pET28a containing the homologous arm was amplified by PCR using X-F and X-R. The specific primer sequences are shown in Table 3. The PCR reaction system is shown in Table 4, and the PCR reaction program is shown in Table 5.

[0111] Table 3 Primer sequences

[0112]

[0113] Table 4 PCR system

[0114]

[0115]

[0116] Table 5 PCR reaction program

[0117]

[0118] After PCR, the product was electrophoresed by 1% agarose gel, and the size of the product electrophoresis band was detected by ultraviolet. The expected size was the same, and then a gel recovery kit was used for recovery.

[0119] (2) Seamless cloning: The target gene CAT obtained by PCR recovery and the linearized vector of pET28a containing the homologous arm were connected by seamless cloning with appropriate proportions, and the reaction condition was 50°C for 30 min.

[0120] (3) Heat shock transformation of DH5a: Transform the seamless cloning product into DH5a competent cells. The specific steps are as follows: 1) Take the DH5a competent cells out of the -80°C refrigerator and place them on ice to thaw. 2) Add the seamless cloning product to the thawed DH5a competent cells, and gently tap the centrifuge tube wall to mix the seamless cloning product and the DH5a competent cells well, and place them on ice for 30 min. Turn on the 42°C water bath. 3) Heat shock in the 42°C water bath for 45 s, and immediately place it on ice for 3-5 min after heat shock. Add 700 uL of medium, and culture at 37°C, 220 rpm for 60 min. 4) Centrifuge at 12000 rpm, 4°C for 1 min, and discard the supernatant. Leave 200 uL for resuspension and spread on the corresponding resistant LB plate. Place it in a 37°C incubator for 12 h. 4) Colony picking verification: pick a colony from the above LB plate into 5 mL of LB medium and culture at 37°C, 220 rpm for 12 h. If the identification and sequence are correct, return the bacteria and plasmid.

[0121] 2.3 Plasmid extraction

[0122] Subculture the returned plasmid at 37°C, 220 rpm for 12 h. Then use the plasmid mini extraction kit for plasmid extraction. Measure the plasmid concentration by ultraviolet spectrophotometer, and store it at -20°C.

[0123] 2.4 Heat shock transformation of BL21(DE3)

[0124] (1) Take the BL21(DE3) competent cells out of the -80°C refrigerator and place them on ice to thaw.

[0125] (2) Add the above plasmid 10 uL to the thawed 100 uL BL21(DE3) competent cells, and gently tap the centrifuge tube wall to mix the plasmid and the BL21(DE3) competent cells well, and place them on ice for 30 min. Turn on the 42°C water bath.

[0126] (3) Heat shock in the 42°C water bath for 45 s, and immediately place it on ice for 3-5 min after heat shock. Add 700 uL of medium, and culture at 37°C, 220 rpm for 60 min.

[0127] (4) Centrifuge at 12000 rpm, 4°C for 1 min, and discard the supernatant. Leave 200 uL for resuspension and spread on the corresponding resistant LB plate. Place it in a 37°C incubator for 12 h.

[0128] 2.5 Strain induction expression

[0129] (1) Pick a single colony into 5 mL of LB medium, add 5 uL of 50 mg / mL Kan solution, and culture at 37°C, 220 rpm until the OD600 is 0.6-0.8.

[0130] (2) Add 5uL 1M IPTG 37℃, 220rpm culture 12h.

[0131] III. Test of catalase protein

[0132] 3.1 Ultrasonic disruption

[0133] (1) Collection: Take the bacterial liquid after culture, centrifuge at 12000rpm for 3min at 4℃. Take 500uL 1*PBS to resuspend the bacterial liquid, centrifuge at 12000rpm for 3min at 4℃ and repeat once.

[0134] (2) Disruption: Use ultrasonic disruptor to disrupt the bacterial body on ice, ultrasonic disruption conditions are 3s, pause 5s, 70% power, disruption for 5min.

[0135] (3) Supernatant: After ultrasonic disruption, centrifuge at 12000rpm for 3min at 4℃, take the supernatant.

[0136] (4) Precipitation: The precipitate is resuspended with equal volume of 1*PBS.

[0137] 3.2 SDS-PAGE electrophoresis

[0138] (1) Protein sample preparation: Take 80uL of the sample to be prepared into a 1.5mL centrifuge tube, add 20uL of 5*loading buffer and blow evenly, heat at 100℃ for 10min.

[0139] (2) Protein gel preparation: Prepare 12.5% SDS-PAGE protein gel according to the manufacturer's instructions.

[0140] (3) SDS-PAGE electrophoresis: Centrifuge the heated sample at 12000rpm for 3min, take 10ul and add it to the protein gel channel in turn, the electrophoresis conditions are voltage 150V for 50min.

[0141] (4) Protein gel baking and staining: After electrophoresis, remove the concentrated gel and retain the separation gel, add coomassie brilliant blue (R-250) for staining for 1h. After staining, add decolorizing solution for decolorization until clear bands are observed.

[0142] (5) Photography: Use gel imaging instrument for photography.

[0143] 3.3 CAT crude enzyme liquid and standard enzyme activity detection and gray scale analysis

[0144] (1) Use Image J software to analyze the gray scale of the obtained CAT crude enzyme liquid and standard to obtain the gray scale value.

[0145] (2) Use total CAT detection kit to detect the CAT activity of the CAT crude enzyme liquid and standard.

[0146] (3) Relative enzyme activity = CAT activity / gray value.

[0147] 3.4 Acid and alkaline environment tolerance test of CAT crude enzyme solution and standard

[0148] (1) The strain was induced to express CAT to obtain a crude enzyme solution.

[0149] (2) The total CAT detection kit was used to detect the enzyme activity of the CAT crude enzyme solution and the standard.

[0150] (3) The CAT crude enzyme solution and the standard were diluted 10 times with phosphate buffer of different pH (3-12), incubated at 37°C for 30 min, and then the CAT activity was detected. Each group was repeated three times.

[0151] (4) The enzyme activity was taken as 1 when the CAT enzyme activity was diluted ten times with double distilled water. Thus, the relative enzyme activity of each pH was calculated.

[0152] 3.5 High temperature environment tolerance test of CAT crude enzyme solution and standard

[0153] (1) The strain was induced to express CAT to obtain a crude enzyme solution.

[0154] (2) The total CAT detection kit was used to detect the enzyme activity of the CAT crude enzyme solution and the standard.

[0155] (3) The crude enzyme solution and the standard were placed in a metal bath, heated at 25°C, 35°C, 45°C, 55°C, 65°C, and 75°C for 10 min, and then the CAT enzyme activity was detected.

[0156] (4) The crude enzyme solution and the standard were placed in a metal bath, incubated at 50°C and 60°C for 20 min, 40 min, 60 min, 80 min, 100 min, and 120 min, and then the CAT activity was detected using the CAT kit. Each group was repeated three times.

[0157] (5) The enzyme activity was taken as 1 at 25°C. Thus, the relative enzyme activity of each temperature and incubation time was calculated.

[0158] Four, results explanation combined with drawings

[0159] 4.1 Construction of pET-28a-CAT

[0160] After PCR amplification, agarose gel electrophoresis was performed, and the results were as follows Figures 1-2 . Each temperature gradient can PCR the target band.

[0161] Subsequently, the gel was recovered using FastPure Gel DNA Extraction Mini kit according to the instructions. The target gene was cloned into pET-28a vector using seamless cloning technology. The target plasmid pET28a-CAT was obtained as shown in Figure 3 . Then the correct result was verified by sequencing as shown in Figure 4 .

[0162] 4.2 Expression of CAT protein in BL21(DE3)

[0163] After IPTG induction, SDS-PAGE electrophoresis analysis was performed to evaluate the expression of mutant stable CAT. As shown in Figure 5 , CAT protein was expressed in large quantities after IPTG induction, and CAT protein was expressed in large quantities in the supernatant, and a small amount was present in the broken precipitate. Therefore, CAT protein was expressed in a soluble manner.

[0164] 4.3 Enzyme activity detection of CAT crude enzyme solution and standard product and gray scale analysis

[0165] Take the above broken supernatant and standard product 0.1 g dissolved in 1*PBS, and detect its enzyme activity. The CAT enzyme activity of the CAT crude enzyme solution was detected to be 4474800 U / mL, and the standard product was 542400 U / mL. Then the same batch of samples were subjected to protein electrophoresis to obtain Figure 6 . It can be seen that the size of the CAT crude enzyme solution band is larger than that of the standard product band.

[0166] Subsequently, Image J was used to analyze the gray value, and then the CAT enzyme activity / gray value was used to obtain the comparison of enzyme activity. As shown in Figure 7 , the enzyme activity of the CAT crude enzyme solution is greater than that of the standard product.

[0167] 4.4 Acid and alkaline environment tolerance test of CAT crude enzyme solution and standard product

[0168] The acid and alkaline environment tolerance test of the crude enzyme solution was performed to evaluate the stability of CAT protein under extreme pH conditions. As shown in Figure 8 , in the acid environment of pH 3 for 30 min, CAT crude enzyme and standard product both maintained about 60% or more activity, showing good acid environment tolerance. CAT enzyme activity had a high point in the acid environment of pH 5, which was higher than that at pH 7.

[0169] In the test of alkaline environment, as shown in Figure 8As shown, the CAT crude enzyme and the standard product maintained more than about 60% activity under the alkaline environment of pH 11 for 30 min, showing high tolerance to alkaline environment. The CAT activity of the CAT crude enzyme had a high point under the weak alkaline environment of pH 8, which was higher than the CAT enzyme activity at pH 7.

[0170] 4.5 CAT crude enzyme liquid and standard product high-temperature environment tolerance test

[0171] Then, the CAT crude enzyme liquid and the standard product were subjected to high-temperature environment tolerance test, and heated at different temperatures for 10 min, and the results are shown in Table 4. Figure 9 The CAT crude enzyme liquid can be stable at 25-75℃, and the standard product is stable at 35-60℃.

[0172] The enzyme activity is the highest and then rapidly decreases.

[0173] Then, 50℃ and 60℃ heating were selected, and the CAT crude enzyme liquid and the standard product enzyme activity were observed within 100 min, as shown in Table 5. Figures 10-11 The CAT crude enzyme liquid enzyme activity tends to be stable within 100 min when heated at 50℃. It is the same as the standard product. The CAT crude enzyme liquid enzyme activity tends to be stable within 100 min when heated at 60℃. It is the same as the standard product stability, and the CAT crude enzyme liquid enzyme activity is obviously increased when heated at 60℃ for 20 min.

[0174] Five, test purposes and field applications

[0175] Through the above specific example test, it is found that the mutant high-stability catalase and the construction method thereof, the catalase, has high prokaryotic expression, can be directly synthesized, is suitable for large-scale preparation, has simple operation and good solubility. The effective range of the CAT standard product on the market is: temperature: 30-40℃, pH: 6.0-8.0, the most suitable range is: temperature: 35-40℃, pH: 6.5-7.0. The mutant high-stability catalase of the present application still has stable and highest enzyme activity at 60℃.

[0176] In the food production process, since CAT can decompose H2O2 into O2 and H2O, it is often used in cake baking to make the cake have fluffy pores. Before milk preservation and cheese making, the milk and cheese raw milk are sterilized and disinfected with H2O2, and then CAT is used to remove residual H2O2. Unlike heat sterilization, this sterilization and disinfection can be carried out at low temperature, which not only does not kill useful lactic acid bacteria, but also does not affect the action of lipase, protease and phosphatase.

[0177] In the pulp and paper industry, because the traditional chlorine bleaching agent used to react with residual lignin in the pulp to produce toxic pollutants such as chlorophenol, countries have begun to prohibit the use of chlorine bleaching agents in the pulp and paper industry, so in recent years the world paper industry has used H2O2 bleaching to replace the traditional bleaching method. The H2O2 remaining in the paper can be neutralized by CAT to meet the production standards for market.

[0178] After the clothes bleaching is finished, the residual H2O2 is often neutralized by CAT, which has the advantages of saving water, electricity, gas and labor compared with the traditional high-temperature water washing process to remove residual H2O2, greatly reducing the cost, improving the production efficiency, and reducing the pollution to the environment.

[0179] CAT can protect cells from the toxic effects of H2O2. Its enzyme provides an antioxidant defense function. Since the antioxidant complex containing peroxide dismutase can be used for treatment, which decomposes superoxide anion into H2O2, CAT can decompose H2O2 into non-toxic substances, so CAT is also considered to be used for treating oxidative damage diseases.

[0180] CAT has a large market demand, so how to quickly and low-cost produce a large amount of high-enzyme-activity CAT is a very important thing. The present application project finds a mutant hydrogen peroxide enzyme with high stability, which has high specific enzyme activity, heat resistance and acid and alkali resistance. It can save more cost in the production, transportation and storage process. The company can use fermentation and purification to quickly produce a large amount of CAT. This not only saves cost, but also greatly shortens the production time and increases the production efficiency. Therefore, the present application is a practical application with great significance.

[0181] Finally, it should be noted that the present application is not limited to the above embodiments, but can have many variations. All variations that can be directly derived or inferred from the disclosure of the present application by those of ordinary skill in the art should be considered as falling within the scope of the present application.

Claims

1. A mutant hyperstable catalase, characterized in that: The protein sequence of the catalase is: MEARKAPRLTTADGRPIGDNQNALTAGPRGPLLIQDVQLLEQIQHFNRERIPERVVHAKGSGAYGTFTVTNDVTRYTKAAFLSEVGKQTEVFVRFSTVAGERGAADAERDVRGFAVKFYTEEGNFDLVGNNTPVFFVRDPYKFQMFIHSQKRHPKTNLRDPDMQWDFWSLCPESLHQVTILFSDRGIPASYRHMNGYGSHTYSMYNDRGELFWVKFHFKTQQGIKCLTDEEAARLIGEDRETHQRDLYEAIERGDYPRWTLYIQVMTPEQAENFRWNPFDLTKVWPHAEFPLIEVGVLELNRNPENYFAEVEQAAFKPSAFVPGIGPSPDKMLQARLMSYADAHRYRLGVNYQQLKVNRPRCPVHHYQRDGFMAQIEGSGHPNYFPNSIPGSPQDDPIYKEPAWHLGEVIVDRYDSRKDHDDYTQAGNLYRLFDEGQKDRLARAIAASLGQARLEVQKRQLGHFYRADVDYGRRVARALGFDPAAAEAELGIDASVAG.

2. A method for constructing a mutant hyperstable catalase according to claim 1, characterized in that The construction method comprises the following steps: Step 1) obtaining a catalase sequence from a thermophilic bacterium in an NCBI database; Step 2) synthesizing a mutated amino acid sequence using codon optimization; Step 3) amplifying the target gene and the pET-28a vector by PCR; Step 4) cloning the target gene into the pET-28a vector by seamless cloning; Step 5) transforming into BL21 (DE3) for expression; Steps 1) to 2) specifically comprise: obtaining a catalase sequence WP_012845258.1 from a thermophilic bacterium in an NCBI database, mutating the 13th last amino acid I to A, then performing codon optimization with Escherichia coli as the host, and synthesizing the gene sequence on pGEX-4T-1, with TOP10 as the host bacteria, to obtain a plasmid containing the optimized target gene.

3. The method of constructing a mutant hyperstable catalase according to claim 2, wherein: Using the synthesized pGEX-4T-1-CAT plasmid as the template, the target gene CAT is amplified by PCR using primers, and a linearized vector fragment of pET28a containing homologous arms is amplified by PCR, and the product is electrophoresed by 1% agarose gel, and the size of the electrophoresis band of the product is compared with the expected size using ultraviolet detection, and if they are consistent, the product is recovered using a gel recovery kit.

4. The method of constructing a mutant hyperstable catalase according to claim 3, wherein: Seamless cloning: the target gene CAT obtained by PCR recovery and the linearized vector of pET28a containing homologous arms are connected by seamless cloning, and the reaction condition is 50℃ for 30 min.

5. The method of constructing a mutant hyperstable catalase according to claim 2, wherein: Step 5) specifically includes heat shock transformation of DH5a, plasmid extraction, heat shock transformation of BL21(DE3), strain induction expression; heat shock transformation of DH5a: the seamless cloning product is transformed into DH5a competent cells, and the specific steps are as follows: 1) Take DH5a competent cells from-80℃ refrigerator and place on ice for thawing; 2) Add the seamless cloning product to the thawed DH5a competent cells, shake the centrifuge tube wall to mix the seamless cloning product and DH5a competent cells well, place on ice for 30 min, and open the 42℃ water bath; 3) Heat shock in the 42℃ water bath for 45 s, immediately place on ice for 3-5 min after heat shock, add 700 uL medium, and culture at 37℃, 220 rpm for 60 min; 4) Centrifuge at 12000 rpm and 4℃ for 1 min, discard the supernatant, resuspend 200 uL, and inoculate on the corresponding resistant LB plate, and culture at 37℃ for 12 h; 5) Colony picking verification: pick a colony from the above LB plate into 5 mL LB medium, culture at 37℃, 220 rpm for 12 h, and identify, if the sequence is correct, return the bacteria and plasmid.

Citation Information

Patent Citations

  • Mutant with CasRx activity and application thereof

    CN118028267A

  • Novel nucleic acid molecules

    US20190040378A1