Antisense oligonucleotide for inhibiting pathological scar and application of antisense oligonucleotide

Abstract

The invention discloses an antisense oligonucleotide ASO-SNHG26-1 (antisense oligonucleotide ASO) for treating human skin pathological scars, and the sequence of the antisense oligonucleotide ASO is as shown in SEQ ID NO.1. The antisense oligonucleotide ASO can be used for treating human skin pathological scars. The invention also discloses the antisense oligonucleotide ASO-SNHG26-2 for inhibiting the formation of the mouse scar, and the sequence of the antisense oligonucleotide ASO-SNHG26-2 is as shown in SEQ ID NO. 2. The two antisense oligonucleotide sequences are respectively used for inhibiting homologous long-chain non-coding RNA SNHG26 of human and mouse. The invention also discloses that the ASO-SNHG26-1 can inhibit expression of extracellular matrixes in keloid fibroblasts and keloid tissue cells cultured in vitro, and the ASO-SNHG26-2 can inhibit the area of mouse scars and expression of fibrosis markers. According to the application disclosed by the invention, the application that the ASO-SNHG26 is combined with a transfection reagent JetPEI to prepare the pathological scar medicine is proposed for the first time, and the application has a good application prospect.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a gene interference sequence, namely an antisense oligonucleotide (ASO) for inhibiting pathological scars, and its application in preparing a medicine for treating and preventing pathological scars. Background Art

[0002] Pathological scars include hypertrophic scars and keloids, which are clinically manifested as red nodular protrusions that affect appearance, and may be accompanied by discomfort such as itching and tingling, affecting the appearance and function of the affected part. At present, the mechanism of pathological scar formation has not been fully clarified, but it is generally believed that after skin damage, fibroblasts proliferate and differentiate into myofibroblasts, over-synthesize extracellular matrix, and local accumulation leads to pathological scars, among which the TGF-SMAD signaling pathway plays a core role. Therefore, anti-fibroblast extracellular matrix synthesis is the main direction of pathological scar treatment. At present, although methods such as surgery, radiotherapy and local hormone blockade can alleviate these symptoms to a certain extent, there is still a lack of highly targeted treatments with few side effects.

[0003] Nucleic acid drugs inhibit the expression of target RNA or target protein through gene silencing, thereby achieving the purpose of treating diseases. This type of drug includes antisense oligonucleotides (ASO), small interfering RNA (siRNA) and short hairpin RNA (shRNA) and other types. ASO is a single-stranded DNA or RNA molecule that directly binds to the target mRNA or long non-coding RNA to prevent its translation or induce RNase H-mediated degradation. Compared with siRNA and shRNA, ASO has many advantages. First, the single-stranded structure and chemical modification characteristics of ASO make it more stable and durable, reducing off-target effects. Secondly, ASO can enter the cell nucleus and directly bind to the target lncRNA in the cell nucleus, effectively silencing the expression of lncRNA in the nucleus. Therefore, ASO shows unique advantages in gene function research and therapeutic gene regulation.

[0004] In recent years, antisense oligonucleotide drug therapy has been used to treat a variety of diseases, such as spinal muscular atrophy (SMA), hereditary transthyretin-mediated amyloidosis (hATTR), and Parkinson's disease. For example, Nusinersen is an ASO for SMA that has been approved by the FDA for clinical treatment and has shown significant benefits in improving patients' motor function. Therefore, ASO gene silencing technology has a wide range of applications in the medical field.

[0005] Existing treatments for pathological scars lack high specificity, have limited efficacy, and have large side effects. Current treatments such as surgery, radiotherapy, and local hormone blockade can relieve symptoms, but cannot fundamentally inhibit the excessive accumulation of extracellular matrix in fibroblasts. Therefore, the present invention proposes to use antisense oligonucleotide technology to effectively inhibit the expression of key long-chain non-coding RNA in pathological scars through gene silencing, thereby reducing abnormal extracellular matrix synthesis in fibroblasts and solving the shortcomings of existing treatments. Summary of the invention

[0006] In order to solve the deficiencies of the prior art, the object of the present invention is to provide a new use of ASO-SNHG26 in the preparation of a drug for preventing and / or treating pathological scars.

[0007] The antisense oligonucleotide ASO-SNHG26 proposed in the present invention is a locked nucleotide modified nucleic acid drug. Compared with ordinary ASO, the locked nucleic acid (LNA) modification at both ends of ASO-SNHG26 enhances its affinity, specificity and stability of binding to mRNA, showing more significant gene silencing efficiency and specificity. At the same time, ASO combined with JetPEI transfection improves the in vivo delivery efficiency and further enhances the effect of inhibiting skin fibrosis.

[0008] Based on the mechanism of action of SNHG26 in the fibrosis process, the present invention proposes a new idea, that is, to develop a method for treating pathological scars for SNHG26. The theoretical basis of the present invention is that scar fibrosis can be effectively inhibited by gene silencing SNHG26. However, there are many technical challenges to achieve this goal, including designing specific ASO sequences and improving binding affinity and stability by locked nucleic acid (LNA) modification to overcome off-target effects and improve treatment efficiency. In addition, improving the in vivo delivery efficiency of ASO-SNHG26 is also one of the key issues. The present invention uses JetPEI as a transfection reagent to help achieve efficient delivery of ASO in target cells. As a cationic polymer, JetPEI can form nanoparticle complexes with ASO, and these complexes enter cells and eventually release ASO by interacting with anionic proteoglycans on the cell surface. The nanoparticles of JetPEI are less than 100nm and can effectively penetrate into tissues to reach target cells, ensuring that ASO effectively silences target genes. At the same time, the use of JetPEI is also highly safe and does not cause inflammatory response, making ASO-SNHG26 show good application prospects in the treatment of fibrosis.

[0009] In summary, the present invention proposes a novel ASO drug targeting human SNHG26 gene, which can inhibit the expression of human SNHG26 gene, and is effectively delivered by using JetPEI in combination, thereby inhibiting the extracellular matrix synthesis and fibrosis signaling pathway molecules of human keloid fibroblasts (KFs) and the expression of extracellular matrix in human keloid in vitro culture model. The present invention also proposes an ASO sequence targeting mouse SNHG26 gene, which can inhibit the expression of mouse SNHG26 gene, thereby reducing the scar area of ​​mouse scar model and the expression of mouse scar extracellular matrix.

[0010] In the first aspect, the present invention proposes an antisense oligonucleotide (ASO-SNHG26-1) for inhibiting human keloids, wherein the antisense oligonucleotide (ASO-SNHG26-1) forms an RNA double-strand against the target sequence of the human long non-coding RNA SNHG26 gene, and the sequence of the antisense oligonucleotide (ASO-SNHG26-1) is shown in SEQ ID NO.1: AACTCTGCATTGCTAG.

[0011] Specifically, the antisense oligonucleotide (ASO-SNHG26-1) can inhibit the expression of human SNHG26 gene, thereby inhibiting the extracellular matrix synthesis and fibrosis signaling pathway molecules of human keloid fibroblasts and the expression of extracellular matrix in the in vitro culture model of human keloid.

[0012] In the second aspect, the present invention also proposes an antisense oligonucleotide (ASO-SNHG26-2) for inhibiting common scars in mice. The antisense oligonucleotide (ASO-SNHG26-2) forms an RNA double-strand against the target sequence of the mouse long non-coding SNHG26 gene. The sequence of the antisense oligonucleotide (ASO-SNHG26-2) is shown in SEQ ID NO.2: CAGTTTAAGTTCAGACAGCC.

[0013] Specifically, the antisense oligonucleotide (ASO-SNHG26-2) can inhibit the expression of mouse SNHG26 gene, thereby inhibiting the scar area and the expression of fibrosis markers in mice.

[0014] In the third aspect, the ASO-SNHG26-1 for inhibiting human keloids of the present invention has a sequence as shown in SEQ ID NO.1, and its target sequence is shown in SEQ ID NO.3, namely CTAGCAATGCAGAGTT.

[0015] In the fourth aspect, the ASO-SNHG26-2 of the present invention, which inhibits common scars in mice, has a target sequence as shown in SEQ ID NO. 4, namely GGCTGTCTGAACTTAAACTG.

[0016] The present invention also proposes the use of the antisense oligonucleotide described above in the preparation of a drug for inhibiting pathological scar formation.

[0017] The present invention also proposes the use of the antisense oligonucleotide described above in the preparation of a drug for treating and preventing pathological scars.

[0018] The present invention also provides a drug / drug composition, namely ASO-SNHG26 / JetPEI, which comprises the antisense oligonucleotide as described above, and a transfection reagent JetPEI.

[0019] Furthermore, the drug / drug composition also includes a pharmaceutically acceptable carrier.

[0020] Among them, JetPEI is a cationic polymer-based transfection reagent, which is often used to deliver nucleic acids such as antisense oligonucleotides (ASO) to cells. JetPEI is based on polyethyleneimine (PEI) and promotes the intracellular uptake of nucleic acids by forming complexes with negatively charged nucleic acids. It is widely used in in vitro and in vivo experiments and has efficient delivery effects and low toxicity. In this patent, JetPEI is used as a drug carrier and mixed with ASO-SNHG26 for injection in human keloid in vitro culture models and mouse scar models to improve the targeted delivery effect, knockdown efficiency and therapeutic efficiency of ASO.

[0021] The present invention also proposes the use of the above-mentioned medicine / drug composition in the preparation of a medicine for inhibiting pathological scar formation.

[0022] The present invention also proposes the use of the above-mentioned medicine / drug composition in the preparation of medicine for treating and preventing pathological scars.

[0023] In the present invention, the pathological scars include hypertrophic scars and keloids.

[0024] Beneficial effects of the present invention: At the molecular level, extracellular matrix synthesis is the final pathway of fibrosis in almost all organs, so anti-extracellular matrix synthesis becomes the treatment target of fibrotic diseases. The present invention's research shows that in human keloid fibroblasts, the ASO-SNHG26-1 proposed by the present invention, as shown in SEQ ID NO.1, can significantly inhibit the synthesis of extracellular matrix and fibrosis signaling pathway molecules in human keloid fibroblasts. In the in vitro culture model of human keloid, the ASO-SNHG26-1 proposed by the present invention, as shown in SEQ ID NO.1, can significantly inhibit the expression of extracellular matrix in the in vitro model of keloid tissue. In the mouse scar model, the ASO-SNHG26-2 proposed by the present invention, as shown in SEQ ID NO.2, can significantly reduce the size of mouse scar area and inhibit the expression of extracellular matrix. The use of this locked nucleotide modified antisense oligonucleotide to specifically interfere with the SNGH26 gene of humans and mice can significantly inhibit the expression of extracellular matrix in skin tissue, thereby achieving the purpose of treating pathological scars, and is suitable for the prevention and treatment of skin fibrosis diseases such as hypertrophic scars and keloids. The locked nucleic acid (LNA) modification at both ends of the ASO-SNHG26 of the present invention enhances its affinity, specificity and stability of binding to mRNA, showing more significant gene silencing efficiency and specificity. The pharmaceutical carrier JetPEI of the present invention promotes the in vivo delivery efficiency of ASO-SNHG26 and has higher safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0026] Figure 1 This is a graph showing the expression level of SNHG26 in KFs after transfection with ASO-SNHG26-1 in Example 2 of the present invention.

[0027] FIG. 2 is a graph showing the expression levels of fibrosis markers in KFs cells after transfection with ASO-SNHG26-1 in Example 3 of the present invention: wherein, Figure 2A This is the qPCR graph of fibrosis markers in KFs cells after transfection with ASO-SNHG26-1. Figure 2B It is the WB image of fibrosis markers of KFs cells after transfection with ASO-SNHG2-1.

[0028] FIG3 is a graph showing the expression levels of fibrosis pathway molecules in KFs cells after transfection with ASO-SNHG26-1 in Example 4 of the present invention: Figure 3AThis is the qPCR graph of fibrosis signaling molecules in KFs cells after transfection with ASO-SNHG26-1. Figure 3B This is a WB image of fibrosis signaling molecules in KFs cells after transfection with ASO-SNHG26-1.

[0029] Figure 4 This is a WB expression level diagram of fibrosis markers after the in vitro culture model of human keloid tissue was transfected with ASO-SNHG26-1 / JetPEI in Example 5 of the present invention.

[0030] FIG5 is a graph showing the changes in scar area and expression levels of fibrosis markers in mice after injection of ASO-SNHG26-2 / JetPEI in Example 6 of the present invention: Figure 5A is the change in scar area in mice, Figure 5B This is the qPCR graph of mouse scar fibrosis markers. DETAILED DESCRIPTION

[0031] The present invention is further described in detail with reference to the following specific examples and drawings, and the protection content of the present invention is not limited to the following examples. It should be understood that these examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0032] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or under conditions recommended by the manufacturer. The materials and reagents used in the present examples are commercially available unless otherwise specified. The reagents used in the present examples are all analytical grade reagents and can be purchased from regular channels.

[0033] The following description of at least one exemplary embodiment is actually only illustrative and is by no means intended to limit the present invention and its application or use. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] In all examples shown and discussed herein, any specific values ​​should be interpreted as merely exemplary and not as limiting. Therefore, other examples of the exemplary embodiments may have different values.

[0035] The present invention discloses an antisense oligonucleotide ASO-SNHG26-1 (antisense oligonucleotide, ASO) for treating pathological scars on human skin, and its sequence is shown in SEQ ID NO.1. The present invention also discloses an antisense oligonucleotide ASO-SNHG26-2 for inhibiting scar formation in mice, and its sequence is shown in SEQ ID NO.2. The two antisense oligonucleotide sequences inhibit the homologous long-chain non-coding RNA SNHG26 of humans and mice, respectively. The present invention also discloses that the ASO-SNHG26-1 can inhibit the expression of extracellular matrix of keloid fibroblasts and keloid tissue cultured in vitro, and the ASO-SNHG26-2 can inhibit the area of ​​mouse scars and the expression of fibrosis markers. The present invention proposes for the first time that the use of ASO-SNHG26 to treat pathological scars has good application prospects.

[0036] ASO-SNHG26-1 of the present invention was designed by and purchased from QIAGEN of Germany; ASO-SNHG26-2 was designed by and purchased from GenePharma of Shanghai; JetPEI of the present invention was purchased from Polyplus-transfection Biotechnology Company of France.

[0037] Example 1 Extraction, culture and activation of keloid fibroblasts

[0038] (1) Experimental samples

[0039] Keloid tissues were obtained from patients who underwent surgical treatment for keloid in our hospital.

[0040] (2) Experimental methods:

[0041] 1) Extraction and culture of keloid cells

[0042] In a sterile clean bench, the fat layer of fresh keloid tissue was removed and rinsed with PBS solution (purchased from Gibco). The tissue was then cut into small pieces of about 6 mm and placed in an EP tube containing Dispase II (purchased from Roche) at 4°C overnight; the epidermis was peeled off the next day, and the remaining tissue was cut and spread flat in a 10 cm culture dish and adhered to the wall at room temperature for 30 minutes. After confirming that the tissue block was firmly attached, Fb complete medium (DMEM high-glucose basal medium (purchased from Gibco), 10% fetal bovine serum (purchased from Sigma), and double antibody (purchased from Gibco) were added, and cultured in an incubator at 37°C. After the cells were fully grown, they were digested with 0.05% trypsin (purchased from Gibco), neutralized with complete medium, and subcultured at a ratio of 1:1.

[0043] 2) Activation of keloid fibroblasts

[0044] 5 ng / ml TGF-β1 (purchased from RD) was added to the culture medium and incubated for 24 hours to induce the expression of extracellular matrix in human keloid fibroblasts KFs.

[0045] Example 2 Construction of ASO-SNHG26-1 transfected cell line of keloid fibroblasts

[0046] (1) Experimental methods:

[0047] KFs were seeded in 6-well plates or 24-well plates. When the cell density reached 60%, the cell culture medium was replaced with DMEM without serum and antibiotics. ASO-SNHG26-1 was transfected into KFs using RNAiMAX transfection reagent (purchased from Invitrogen), and ASO-Ctrl-1 was transfected as a control cell line. ASO sequences are shown in Table 1.

[0048] Table 1

[0049] ASO name Sequence (5'-3') ASO-Ctrl-1 (Ctrl-1 for short) AACACGTCTATACGC (SEQ ID NO. 5) ASO-SNHG26-1 (abbreviated as ASO-1) AACTCTGCATTGCTAG (SEQ ID NO.1)

[0050] (2) Experimental results:

[0051] Figure 1 The results showed that, compared with the control group (ASO-Ctrl-1), the expression of SNHG26 mRNA in the ASO-SNHG26-1 treated group was significantly decreased.

[0052] Example 3 Effect of ASO-SNHG26-1 on fibrosis markers in KFs

[0053] (1) Experimental methods:

[0054] ASO-SNHG26-1 was transfected into KFs using RNAiMAX transfection reagent, and TGF-β1 was added 24 h later to continue stimulating for 24 h, and total cellular RNA and total protein were extracted for subsequent analysis.

[0055] 1) qRT-PCR analysis

[0056] Total RNA was extracted from KFs using TRIzol reagent (purchased from Takara). cDNA was synthesized using 5×HiScript qRT SuperMix kit (purchased from Nanjing Novozyme). Gene amplification was performed using 2×ChamQ SYBR qPCRMasterMix (purchased from Nanjing Novozyme) according to the manufacturer's instructions. qPCR was performed on a Real-time PCR amplifier (purchased from Roche), and relative gene expression was calculated using the 2-ΔΔCT method. GADPH was used as an internal control. Primer sequences are shown in Table 2.

[0057] Table 2

[0058]

[0059]

[0060] 2) Western blot (WB) analysis

[0061] KFs were added with cOmplete TM Total protein was extracted with RIPA (Radioimmunoprecipitation Assay) strong lysis buffer (purchased from Beyotime) in ULTRAtablets (EDTA-free, glass bottled protease inhibitor cocktail, purchased from Roche). Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then transferred to PVDF membranes. After blocking with 5% skim milk powder, the membranes were incubated with primary antibodies such as COL1A1 (1:500, purchased from Proteintech), COL3A1 (1:500, purchased from Proteintech), FN (1:2000, purchased from Abcam), SMAD3 (1:500, purchased from Abmart), Tubulin (1:3000, purchased from Abmart) and GAPDH (1:2000, purchased from Proteintech) at 4°C overnight. The next day, the membranes were incubated with rabbit or mouse secondary antibodies (1:2000, purchased from Cellsignaling) for 1 hour at room temperature. Protein expression was observed using an enhanced chemiluminescence detection system (purchased from Biorad). The target protein expression was normalized to the relative expression of the internal control GAPDH.

[0062] (2) Experimental results:

[0063] Figure 2A It showed that by comparing with the control group, the mRNA expression of fibrosis markers in the ASO-SNHG26-1 treated group was significantly decreased;

[0064] Figure 2B The results showed that compared with the control group, the expression of fibrosis marker proteins in the ASO-SNHG26-1 treated group was significantly decreased.

[0065] Example 4 Effect of ASO-SNHG26-1 on KFs fibrosis pathway molecules

[0066] (1) Experimental methods:

[0067] ASO-SNHG26-1 was transfected into KFs using RNAiMAX transfection reagent, and total cellular RNA and total protein were extracted 24 h later for subsequent analysis.

[0068] (2) Experimental results:

[0069] Figure 3A It showed that, compared with the control group, the mRNA expression of multiple fibrosis pathway molecules in the SMAD family in the ASO-SNHG26-1 treatment group was significantly decreased;

[0070] Figure 3B The results showed that compared with the control group, the expression of SMAD3 protein, a fibrosis pathway molecule, in the ASO-SNHG26-1 treated group was significantly decreased.

[0071] Example 5 Effect of ASO-SNHG26-1 on fibrosis markers in an in vitro culture model of keloid tissue

[0072] (1) Experimental methods:

[0073] The operation was performed in a sterile clean bench, and the fat layer of fresh keloid tissue was removed. The tissue was washed three times with PBS solution containing three antibodies. 8mm trephine was used to trephine 12 equal-sized tissue blocks, and cultured in a 12-well plate containing complete culture medium. ASO-SNHG26-1 and JetPEI mixture was injected once on the day of tissue treatment, and ASO-SNHG26-1 and JetPEI mixture was injected once every other day. ASO-Ctrl-1 and JetPEI mixture was injected at the same time as the control group. On the 5th day after tissue treatment, total tissue protein was extracted for fibrosis marker expression analysis.

[0074] (2) Experimental results:

[0075] Figure 4 The results showed that compared with the control group, the expression of fibrosis marker proteins in the ASO-SNHG26-1 treated group was significantly decreased.

[0076] Example 6 Effect of ASO-SNHG26-2 on fibrosis in mouse scar model

[0077] (1) Experimental methods:

[0078] In an SPF environment, 8-week-old C57BL / 6 male mice were selected. After depilation of the back, a 6mm trephine wound was made on the upper back, and an 8mm inner diameter silicone ring was sutured around the wound to limit early wound contraction. After the wound was re-epithelialized (approximately 9 to 10 days after the wound), a mixture of ASO-SNHG26-2 and JetPEI was injected locally twice every other day. A mixture of ASO-Ctrl-2 and JetPEI was injected at the same time as the control group. When the wound was completely healed and the scar was basically formed (approximately 14 to 15 days after the wound), the lesion was photographed and the scar area was quantitatively analyzed using Image. After the experiment, the mice were euthanized, and the scar tissue was removed to extract total RNA to detect the mRNA expression of fibrosis markers. See Table 3 for the ASO sequence.

[0079] Table 3

[0080] ASO name Sequence (5'-3') ASO-Ctrl-2 (Ctrl-2 for short) GCGUATTATAGCCGATTAAC(SEQ ID NO.30) ASO-SNHG26-2 (abbreviated as ASO-2) CAGTTTAAGTTCAGACAGCC(SEQ ID NO.2)

[0081] (2) Experimental results:

[0082] Figure 5A It showed that by comparing with the control group, the scar area in the ASO-SNHG26-2 treated group was reduced;

[0083] Figure 5B It was shown that scar fibrosis markers were reduced in the ASO-SNHG26-2 treated group compared with the control group.

[0084] In summary, the above experimental results show that SNHG26 plays an important role in the synthesis of extracellular matrix, and ASO-SNHG26 targeting SNHG26 can effectively inhibit the synthesis of extracellular matrix, which is an important target for the treatment of pathological scars. The present invention proposes for the first time that ASO-SNHG26 / JetPEI has important applications in the preparation of drugs for the treatment or prevention of pathological scars.

[0085] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0086] As used in the present invention, the terms "include" and "comprising" are open expressions, that is, including the contents specified in the present invention but not excluding other contents.

[0087] As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items.

[0088] Although the embodiments of the present description have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present description, the scope of which is defined by the appended claims and their equivalents.

Claims

1. An antisense oligonucleotide for inhibiting human keloid, characterized in that: The antisense oligonucleotide forms an RNA double strand against the target sequence of the human long non-coding RNA SNHG26 gene, and its sequence is shown in SEQ ID NO.1, namely AACTCTGCATTGCTAG.

2. The antisense oligonucleotide according to claim 1, characterized in that The target sequence of the antisense oligonucleotide is shown in SEQ ID NO. 3, namely CTAGCAATGCAGAGTT.

3. The antisense oligonucleotide according to claim 1, characterized in that The antisense oligonucleotide can inhibit the expression of human SNHG26 gene, thereby inhibiting the synthesis of extracellular matrix of human keloid fibroblasts and the expression of fibrosis signaling pathway molecules and extracellular matrix of human keloid in vitro culture model.

4. An antisense oligonucleotide for inhibiting common scar in mice, characterized in that: The antisense oligonucleotide forms an RNA double strand against the target sequence of the mouse long non-coding SNHG26 gene, and its sequence is shown in SEQ ID NO.2, namely CAGTTTAAGTTCAGACAGCC.

5. The antisense oligonucleotide according to claim 4, characterized in that The target sequence of the antisense oligonucleotide is shown in SEQ ID NO.4, namely GGCTGTCTGAACTTAAACTG.

6. The antisense oligonucleotide according to claim 4, characterized in that The antisense oligonucleotide can inhibit the expression of mouse SNHG26 gene, thereby inhibiting the scar area and the expression of fibrosis markers in mice.

7. A drug / drug composition, characterized in that: The drug / drug composition comprises the antisense oligonucleotide according to any one of claims 1 to 6, and a transfection reagent JetPEI.

8. The drug / drug composition according to claim 7, characterized in that The medicament / pharmaceutical composition further comprises a pharmaceutically acceptable carrier.

9. An application, characterized in that, The applications include: (1) Use of the antisense oligonucleotide according to any one of claims 1 to 6 or the drug / drug composition according to claim 7 in the preparation of a drug for inhibiting pathological scar formation; (2) Use of the antisense oligonucleotide according to any one of claims 1 to 6 or the drug / drug composition according to claim 7 in the preparation of a drug for treating and preventing pathological scars.

10. The use according to claim 9, characterized in that The pathological scars include hypertrophic scars and keloids.

Images