Chicken PGC-1alpha gene promoters as well as construction method and application thereof

Abstract

The invention discloses a group of chicken PGC-1alpha gene promoters as well as a construction method and application thereof, and belongs to the field of gene engineering. The chicken PGC-1 alpha gene promoter is any one of A1-A5 sequences of which the nucleotide sequences are shown as SEQ ID NO: 1 to SEQ ID NO: 5. The promoter is applied to the promotion of expression of firefly luciferase in chicken preadipocytes, and is applied to the regulation and control of the chicken PGC-1 alpha gene promoter by a specific transcription factor PPAR gamma. The five PGC-1alpha gene promoters have promoter activity in chicken preadipocytes, and can directly regulate and control transcription expression of the chicken PGC-1alpha gene. The chicken PGC-1alpha promoter disclosed by the invention can predict the transcriptional activity of the PGC-1alpha at the in-vitro cellular level, so that the chicken PGC-1alpha promoter has potential application values for revealing a transcriptional regulation mechanism of the chicken PGC-1alpha, breeding low-abdominal-fat broilers, revealing molecular mechanisms after various human diseases occur and developing drugs for targeting PGC-1alpha expression.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and specifically relates to a group of chicken PGC-1α gene promoters and a construction method and application thereof. Background Art

[0002] The peroxisome proliferator-activated receptor (PPAR)γ coactivator-1 (PGC-1) family (PGC-1s) consists of three members, namely PGC-1α, PGC-1β and PGC-1-related coactivator (PRC). PGC-1 family members are conserved in higher vertebrates such as fish, amphibians, birds and mammals. The first member discovered was PGC-1α, which was named because of its physical interaction with PPARγ, which led to enhanced PPARγ transcriptional activity. PGC-1α is specifically expressed in organs with high energy demands, such as the heart, kidneys, brain and skeletal muscle. In all these organs, the expression of PGC-1α is highly regulated by multiple signal transduction pathways and hormones to maintain metabolic balance in a tissue-specific manner.

[0003] PGC-1α is probably best known for regulating mitochondrial function in brown adipose tissue and skeletal muscle. However, due to its role as a coactivator of many nuclear receptors and transcription factors, PGC-1α is also involved in the regulation of many tissue-specific functions, including adipogenesis, angiogenesis, gluconeogenesis, heme biosynthesis, etc. Mitochondrial dysfunction and impaired energy metabolism and thermogenesis are frequently observed in individuals with insulin resistance and obesity, and the abundance of PGC-1α is reduced in skeletal muscle of animals and humans with these diseases. Therefore, impaired PGC-1α function has been implicated in the pathogenesis of these global health problems.

[0004] Studies on adipose tissue formation have shown that PGC-1α plays an important regulatory role in mouse adipose tissue. PGC-1α transgenic mice exhibit obesity-resistant or insulin-sensitive phenotypes. The amount of epididymal white adipose tissue and total abdominal adipose tissue in PGC-1α knockout mice is significantly higher than that in wild-type mice. Lack of the PGC-1α gene shows impaired energy expenditure, leading to the development of obesity and hyperinsulinemia.

[0005] Chickens are not only important economic animals, but also important animal models for research in developmental biology and immunology. In the current broiler industry, due to long-term genetic selection, the growth rate and meat production of broilers have increased significantly, but this is accompanied by excessive abdominal fat accumulation in broilers. Excessive fat accumulation will reduce the feed conversion efficiency and meat quality of chickens, reduce the economic benefits of chicken farming enterprises, and reduce consumer purchasing desire. Therefore, understanding the molecular mechanism of broiler fat production and fat growth and development, reducing excessive abdominal fat deposition, and creating new low-fat broiler breeds have become one of the goals of broiler breeding development. Existing research results show that PGC-1α is expressed in the abdominal adipose tissue of broilers; in vitro cell level studies have shown that overexpression of PGC-1α promotes the proliferation of chicken preadipocytes. Regulating the expression level of the PGC-1α gene may be a potential means to control abdominal fat formation in broilers.

[0006] In summary, PGC-1α is a regulatory gene for the occurrence of multiple human diseases and a candidate gene for low-fat broiler breeding. Determining the promoter of the chicken PGC-1α gene has potential application value in revealing the transcriptional regulatory mechanism of chicken PGC-1α, breeding low-fat broiler chickens, revealing the molecular mechanisms behind the occurrence of some human diseases, and developing drugs targeting PGC-1α expression. Summary of the invention

[0007] The present invention provides a group of chicken PGC-1α gene promoters, which can directly regulate the transcriptional expression of the chicken PGC-1α gene to solve the problems existing in the above-mentioned prior art.

[0008] The technical scheme adopted by the present invention is as follows: a chicken PGC-1α gene promoter, wherein the chicken PGC-1α gene promoter is any one of the A1-A5 sequences shown in SEQ ID NO: 1-SEQ ID NO: 5 as a nucleotide sequence.

[0009] The present invention also provides a primer set for amplifying the chicken PGC-1α gene promoter as described above, the primer set comprising:

[0010] an upstream primer as shown in SEQ ID NO: 6 and a downstream primer as shown in SEQ ID NO: 11 for amplifying the A1 sequence;

[0011] an upstream primer as shown in SEQ ID NO: 7 and a downstream primer as shown in SEQ ID NO: 11 for amplifying the A2 sequence;

[0012] an upstream primer as shown in SEQ ID NO: 8 and a downstream primer as shown in SEQ ID NO: 11 for amplifying the A3 sequence;

[0013] an upstream primer as shown in SEQ ID NO: 9 and a downstream primer as shown in SEQ ID NO: 11 for amplifying the A4 sequence;

[0014] The upstream primer shown in SEQ ID NO: 10 and the downstream primer shown in SEQ ID NO: 11 for amplifying the A5 sequence.

[0015] The present invention also provides a kit, comprising the primer set as described above.

[0016] The present invention also provides a method for constructing the chicken PGC-1α gene promoter as described above, comprising the following steps: using DNA extracted from chicken whole blood as a template, using the primer set as described above to perform PCR amplification to obtain the chicken PGC-1α gene promoter.

[0017] The present invention also provides a recombinant vector comprising the chicken PGC-1α gene promoter as described above.

[0018] The present invention also provides a recombinant bacterium, comprising the recombinant vector as described above.

[0019] The present invention also provides an application of the chicken PGC-1α gene promoter as described above, which is applied to any of the following items: (1) applied to initiate the expression of firefly luciferase in chicken preadipocytes; (2) applied to the chicken PGC-1α gene promoter being regulated by a specific transcription factor PPARγ.

[0020] The present invention has the following technical effects and advantages: The chicken PGC-1α gene promoter disclosed in the present invention uses chicken whole blood DNA as a template, and uses primers to perform PCR amplification to obtain chicken PGC-1α promoter sequences (SEQ ID NO: 1-SEQ ID NO: 5), which are named as sequences A1-A5 respectively, and are constructed into a pGL3-basic vector using recombinant technology to obtain 5 luciferase reporter gene plasmids containing chicken PGC-1α promoter sequences (A1-A5) of different lengths. Through experimental verification, it was found that the 5 PGC-1α promoters all have promoter activity in chicken preadipocytes, indicating that these promoters can directly regulate the transcriptional expression of chicken PGC-1α, overexpression of PPARγ1 or PPARγ2 inhibits the activity of multiple chicken PGC-1α promoters disclosed in the present invention, and real-time RT-PCR analysis showed that overexpression of PPARγ1 or PPARγ2 inhibited the endogenous expression of PGC-1α in chicken preadipocytes, while knocking down PPARγ promoted the endogenous expression of PGC-1α; chromatin immunoprecipitation (ChIP)-PCR showed that PPARγ could bind to sequences in the (-1905bp / -1675bp), (-1275bp / -1079bp), (-799bp / -609bp), and (-690bp / -487bp) regions of the PGC-1α promoter in chicken preadipocytes. This indicates that PPARγ can regulate the expression of endogenous PGC-1α in chicken preadipocytes, which is consistent with the results of PPARγ regulating the chicken PGC-1α promoter reporter gene activity and mRNA expression disclosed in the present invention, indicating that the chicken PGC-1α promoter disclosed in the present invention can predict the transcriptional activity of PGC-1α at the in vitro cellular level. Therefore, this has potential application value in revealing the transcriptional regulation mechanism of chicken PGC-1α, breeding low-abdominal fat broilers, revealing the molecular mechanisms behind the occurrence of various human diseases and developing drugs targeting PGC-1α expression. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of the construction of the chicken PGC-1α promoter reporter gene vector and the physical map of the location of related sequences; where LUC refers to the firefly luciferin gene.

[0022] Figure 2 This is a graph showing the relative activity of the chicken PGC-1α gene promoter luciferase reporter gene; pGL3-basic without a promoter sequence was the negative control group, and “**” indicates a significant difference from pGL3-basic (P<0.01).

[0023] Figure 3Figure 1 shows the eukaryotic expression vectors pCMV-HA, pCMV-HA-PPARγ1 and pCMV-HA-PPARγ2 transfected into chicken preadipocytes, respectively. A shows the expression level of PPARγ gene mRNA in the cells, and B shows the expression level of PPARγ gene protein in the cells.

[0024] Figure 4 The figure shows the effect of overexpression of pCMV-HA-PPARγ1 and pCMV-HA-PPARγ2 on the activities of A1 and A2 promoters of PGC-1α gene.

[0025] Figure 5 The knockdown of PPARγ in chicken preadipocytes detected the mRNA (A) and protein (B) expression levels of the PPARγ gene in the cells.

[0026] Figure 6 The graph shows that overexpression of pCMV-HA-PPARγ1 and pCMV-HA-PPARγ2 inhibits the mRNA expression level of endogenous PGC-1α in chicken preadipocytes.

[0027] Figure 7 This figure shows that knocking down PPARγ promotes the mRNA expression level of endogenous PGC-1α in chicken preadipocytes.

[0028] Figure 8 Chromatin immunoprecipitation (ChIP) was performed in chicken preadipocytes using PPARγ antibody, and PCR analysis of the corresponding fragments was performed after the chromatin DNA fragments were recovered and purified. DETAILED DESCRIPTION

[0029] The chicken PGC-1α promoter disclosed in the present invention is obtained by using chicken whole blood DNA as a template and primers for PCR amplification to obtain chicken PGC-1α promoter sequences (SEQ ID NO: 1-SEQ ID NO: 5), which are named as sequences A1-A5 respectively, and are constructed into a pGL3-basic vector by recombination technology to obtain 5 plasmids containing luciferase reporter gene plasmids of different lengths of chicken PGC-1α gene promoter sequences (A1-A5). The present invention is further described in detail below with reference to the accompanying drawings of the specification. The experimental methods used in the following examples are all conventional methods unless otherwise specified, and the materials and reagents used can be obtained from commercial channels unless otherwise specified.

[0030] Example 1

[0031] Preparation of Chicken PGC-1α Gene Promoter

[0032] 1. PCR amplification of PGC-1α promoter Chicken genomic DNA was used as a template, and primers PGC-1α-F (SEQ ID NO: 6-SEQ ID NO: 10) and PGC-1α-R (SEQ ID NO: 11) were used to PCR amplify the PGC-1α promoter sequence, see the sequence listing SEQ ID NO: 1 to SEQ ID NO: 5 for details.

[0033] The reaction system is as follows:

[0034]

[0035] The PCR reaction conditions were:

[0036]

[0037] The PCR product was subjected to agarose gel electrophoresis, and the target band was recovered using the AXYGEN gel recovery and purification kit for later use. 3. Construction of PGC-1α gene promoter luciferase reporter gene vector

[0038] Using pGL3-basic vector as substrate, double digestion was performed using MluⅠ and Xho I restriction endonucleases.

[0039] The reaction system is as follows:

[0040]

[0041] The enzyme digestion conditions were: 37°C for 1 hour to obtain a linearized pGL3-basic vector that can be used for recombinant plasmid construction.

[0042] The One Step Cloning Kit of Vazyme was used and the reaction system was prepared on ice according to the instruction manual.

[0043] The reaction system is as follows:

[0044]

[0045] At 37°C, the reaction was continued for 30 minutes to obtain the recombinant product. After the reaction was completed, the centrifuge tube was immediately placed on ice for the next transformation. The transformation product was evenly spread on an ampicillin-resistant LB solid culture plate, the plate was inverted, and cultured at 37°C overnight. A single clone colony was picked and added to the LB liquid culture medium containing ampicillin and shaken for 4 to 5 hours before being sent for sequencing. After the plasmid sequencing was verified to be correct, it was stored for future use. The vector diagram is shown in the figure. Figure 1 shown.

[0046] Example 2

[0047] Analysis of PGC-1α gene promoter activity

[0048] 1. Activity verification of five different lengths of PGC-1α gene promoters (A1-A5)

[0049] Chicken preadipocytes in good growth condition were inoculated into 24-well cell culture plates. When the cells adhered to the wall and grew to a confluence of 70% to 90%, transfection was performed. According to the instructions of Lipofectamine 2000 transfection reagent, five PGC-1α gene promoter (A1-A5) reporter gene plasmids and pRL-CMV plasmid were co-transfected into the cells at a ratio of 100:1. After transfection for 48 hours, the firefly luciferase activity was detected according to the instructions of the dual luciferase detection system, and the Renilla luciferase activity was used for correction. The relative activity of the reporter gene is the ratio of the firefly luciferase activity to the Renilla luciferase reporter gene activity (Fluc / Rluc). The results of the reporter gene activity analysis showed that compared with the pGL3-basic empty vector, the pGL3-PGC-1α (A1-A5) reporter gene vectors all had higher activity (P<0.01), such as Figure 2 As shown, the results showed that the five constructed PGC-1α gene promoter (A1-A5) reporter gene plasmids had promoter activity.

[0050] 2. mRNA and protein verification of overexpression of transcription factors PPARγ1 and PPARγ2

[0051] Chicken preadipocytes in good growth condition were inoculated into 12-well cell culture plates at a density of 1×10 5 / well, 24h later, the eukaryotic expression vectors pCMV-HA, pCMV-HA-PPARγ1 and pCMV-HA-PPARγ2 were transfected into chicken preadipocytes according to the instructions of Lipofectamine 2000, and the total RNA of the cells was extracted using the RNAiso Plus (TaKaRa, Japan) kit 48h after transfection. The absorbance of the total RNA of the sample at 260nm and 280nm was measured by UV spectrophotometer, and the quality of the total RNA was evaluated according to the ratio (A260 / 280). Reverse transcription was performed using a reverse transcription kit (TaKaRa, Japan), 500ng of the extracted total RNA was taken, and the experiment was performed according to the steps in the kit instructions. The reaction conditions were: 37℃ for 10min, 85℃ for 5s, and finally kept at 4℃. After the reverse transcription was completed, the cDNA product was stored at -20℃.

[0052] According to the instructions of SYBR Green Pro Tag Hs premixed qPCR kit (Aikerui, Hunan), the cDNA obtained by reverse transcription was used as a template, and 10 μL of reaction system was prepared and added to a 96-well plate. The reaction conditions were as follows: 95°C for 30 s, 95°C for 5 s, 60°C for 30 s, and 40 cycles. The TATA-binding protein gene (TBP) was used as the internal reference gene. -ΔΔCt Methods The relative expression of target gene mRNA was calculated. PrimerPremier 5.0 software was used to design primers for gene expression detection. The primer pair sequences are shown in SEQ ID No. 12-SEQ ID No. 15. Figure 3 As shown in A, the PPARγ mRNA in cells transfected with pCMV-HA-PPARγ1 and pCMV-HA-PPARγ2 was significantly higher than that in the control group cells transfected with pCMV-HA.

[0053] The eukaryotic expression vectors pCMV-HA, pCMV-HA-PPARγ1, and pCMV-HA-PPARγ2 were transfected into chicken preadipocytes, and total cell protein was extracted 48 h after transfection. Western blotting experiments were performed using PPARγ antibodies, as shown in Figure 2. Figure 3 As shown in B, the expression of PPARγ protein in cells transfected with pCMV-HA-PPARγ1 and pCMV-HA-PPARγ2 was significantly higher than that in the control group cells transfected with pCMV-HA.

[0054] 3. Effects of transcription factors PPARγ1 and PPARγ2 on the activity of PGC-1α gene promoter (A1 and A2)

[0055] Chicken preadipocytes in good growth condition were inoculated into 24-well cell culture plates at a density of 2.5×10 4 After 24 hours, the PPARγ1 expression vector (pCMV-HA-PPARγ1) or PPARγ2 expression vector (pCMV-HA-PPARγ2) was co-transfected with pGL3-PGC-1α (A1 or A2) and pRL-CMV reporter gene vector into chicken preadipocytes according to the instructions of Lipofectamine 2000. Figure 4 As shown, the reporter gene assay results showed that overexpression of PPARγ could significantly inhibit the activity of pGL3-PGC-1α (A1 or A2) reporter gene vector (P<0.01).

[0056] 4. mRNA and protein verification of transcription factor PPARγ knockdown

[0057] We commissioned Shanghai Genetech to design and synthesize PPARγ siRNA interference fragments based on the CDS sequence of chicken PPARγ. We transfected siRNA-PPARγ interference fragments or irrelevant interference fragments (NC) into chicken preadipocytes. Real-time RT-PCR and Western blot results showed that compared with the NC group, Figure 5 As shown, siRNA-PPARγ could significantly knock down the mRNA and protein expression levels of PPARγ.

[0058] 5. Effects of overexpression and knockdown of PPARγ on the expression of endogenous PGC-1α in chicken preadipocytes

[0059] pCMV-HA-PPARγ1 plasmid, pCMV-HA-PPARγ2 plasmid, pCMV-HA plasmid, siRNA-PPARγ1 fragment and irrelevant interference fragment NC were transfected into chicken preadipocytes, and the cells were recovered after 48 hours. Real-time RT-PCR was used to analyze the expression level of PGC-1α in the cells. The TATA-binding protein gene (TBP) gene was used as the internal reference gene. -ΔΔCt Methods The relative expression of target gene mRNA was calculated. Primer Premier 5.0 software was used to design primers for gene expression detection. The primer pair sequences are shown in SEQ ID No. 14-SEQ ID No. 17. Figure 6 As shown, overexpression of PPARγ significantly inhibited the mRNA expression level of PGC-1α in chicken preadipocytes; Figure 7 As shown, knockdown of PPARγ expression significantly promoted the mRNA expression level of endogenous PGC-1α in chicken preadipocytes.

[0060] 6. Prediction of PPARγ binding sites on the PGC-1α gene promoter sequence.

[0061] First, the potential transcription factor binding sites of the PGC-1α(A1) fragment were predicted using the JASPAR database. The results showed that there were four potential binding sites for PPARγ, an important transcription factor controlling adipogenesis, in this region, with binding sequences of TCACCTTTGCCCCAGAT (-1793bp / -1777bp), TGCAAGACTTTTGAACCCAGC (-1201bp / -1181bp), GCTGGGTGTGGGGTCAG (-712bp / -696bp), and TCCCCTCCCCCCCCCCCC (-605bp / -588bp).

[0062] 7. Chromatin immunoprecipitation (ChIP)-PCR was used to study whether PPARγ could bind to the PGC-1α promoter.

[0063] Chicken preadipocytes were collected, fixed with formaldehyde at a final concentration of 1.25% for 10 minutes, and then 0.125 mol / L glycine was added for 5 minutes to terminate the cross-linking. According to the instructions of Simple ChIP Plus Enzymatic Chromatin IP Kit, nuclei were prepared and chromatin digested, and DNA was fragmented by ultrasound. The IP group used PPARγ antibody (CST, #2443), IgG as a negative control, and chromatin immunoprecipitation was performed using a magnetic bead method. After cross-linking was resolved, the sample DNA was purified using a DNA purification centrifugal column. No antibody treatment was performed, and the purified DNA was directly recovered after ultrasound as a positive control input. Primers were designed based on the position of the PPARγ binding site of the PGC-1α promoter. The primer pair sequences are such as SEQ ID No.18-SEQ ID No.25. qPCR was used to detect whether the transcription factor PPARγ binds to PGC-1α, and the data are expressed as a percentage of chromatin input. As shown in Figure 8 As shown, compared with the IgG group, the DNA fragments treated with PPARγ antibody were significantly enriched, indicating that PPARγ directly binds to the sequences in the (-1905bp / -1675bp), (-1275bp / -1079bp), (-799bp / -609bp), and (-690bp / -487bp) regions of the chicken PGC-1α promoter.

[0064] The above experiments prove that the chicken PGC-1α promoter (A1-A5) of the present invention has promoter activity in chicken preadipocytes, indicating that each promoter can directly regulate the transcriptional expression of chicken PGC-1α. Overexpression of PPARγ1 or PPARγ2 inhibits the activity of the chicken PGC-1α gene promoter and the mRNA expression of PGC-1α. Interference with PPARγ promotes the mRNA expression of PGC-1α. Further studies have shown that PPARγ regulates the expression of the PGC-1α gene in chicken adipose tissue by directly binding to the sequence of the PGC-1α promoter region.

Claims

1. A chicken PGC-1α gene promoter, characterized in that: The chicken PGC-1α gene promoter is any one of the A1-A5 sequences shown in SEQ ID NO: 1-SEQ ID NO: 5 as the nucleotide sequence.

2. A primer set, characterized in that: For amplifying the chicken PGC-1α gene promoter as claimed in claim 1, the primer set comprises: an upstream primer as shown in SEQ ID NO: 6 and a downstream primer as shown in SEQ ID NO: 11 for amplifying the A1 sequence; an upstream primer as shown in SEQ ID NO: 7 and a downstream primer as shown in SEQ ID NO: 11 for amplifying the A2 sequence; an upstream primer as shown in SEQ ID NO: 8 and a downstream primer as shown in SEQ ID NO: 11 for amplifying the A3 sequence; an upstream primer as shown in SEQ ID NO: 9 and a downstream primer as shown in SEQ ID NO: 11 for amplifying the A4 sequence; The upstream primer shown in SEQ ID NO: 10 and the downstream primer shown in SEQ ID NO: 11 for amplifying the A5 sequence.

3. A kit, characterized in that: Comprising the primer set as claimed in claim 2.

4. A method for constructing the chicken PGC-1α gene promoter as claimed in claim 1, characterized in that: The following steps are involved: The chicken PGC-1α gene promoter is obtained by using DNA extracted from chicken whole blood as a template and performing PCR amplification using the primer set as claimed in claim 3.

5. A recombinant vector, characterized in that: It comprises the chicken PGC-1α gene promoter as claimed in claim 1.

6. A recombinant bacterium, characterized in that: Comprising the recombinant vector according to claim 5.

7. A use of the chicken PGC-1α gene promoter as claimed in claim 1, characterized in that: The invention is used in any of the following items: (1) to initiate the expression of firefly luciferase in chicken preadipocytes; (2) the chicken PGC-1α gene promoter is regulated by a specific transcription factor PPARγ.

Images