Sorghum anthracnose susceptible gene SbABCA7, recombinant plasmid and application thereof

Abstract

The invention discloses a sorghum anthracnose susceptible gene SbABCA7, a recombinant plasmid and application of the sorghum anthracnose susceptible gene SbABCA7 and the recombinant plasmid. The sorghum anthracnose susceptible gene SbABCA7 is a sorghum susceptible gene, the nucleotide sequence of the sorghum susceptible gene SbABCA7 is SEQ ID NO.01, and the amino acid sequence of the SbABCA7 protein gene is SEQ ID NO.02. The invention further discloses a preparation method of the sorghum anthracnose susceptible gene SbABCA7. The susceptible gene SbABCA7 of the sorghum anthracnose can be subjected to amplification, recovery, plasmid recombination and homologous genetic transformation to obtain a positive sorghum plant; a primer designed by the susceptible gene SbABCA7 can be directly used as a molecular marker to quickly screen and identify sorghum anthracnose-resistant resources in a seedling stage; the sorghum susceptible gene can be mutated into a disease-resistant gene through a gene locus, and the SbABCA7 sorghum susceptible gene can be changed into the disease-resistant gene through technologies such as gene editing; the invention can provide a convenient method for rapidly screening materials, creating new materials and improving sorghum anthracnose-resistant varieties for sorghum anthracnose-resistant breeding research.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a sorghum anthracnose susceptible gene SbABCA7, a recombinant plasmid and applications thereof. Background Art

[0002] Sorghum is the fifth most widely grown cereal crop in the world and can be used as food, feed and industrial raw material. Anthracnose is one of the most serious diseases in sorghum growing areas around the world. It can occur at all growth stages of sorghum, causing sorghum yield reduction or even total crop failure. Studying the genetic mechanism of sorghum resistance to anthracnose and conducting breeding improvement is the most effective way to increase sorghum yield, save costs and increase efficiency, and prevent sorghum anthracnose.

[0003] Gene cloning technology provides a powerful tool for studying biological genetics and molecular biological mechanisms. Gene cloning of crop-related traits can be used to improve crop varieties and increase crop yields and stress resistance. Gene function analysis is an important means of studying the gene function of organisms. It can reveal the specific functions of genes and provide key information for understanding basic life processes such as growth and development, physiological metabolism, etc. Bioinformatics tools can be used to analyze gene sequences, protein functions, and system evolution, thereby discovering some new information and laws.

[0004] Susceptibility genes can be directly used as molecular markers to screen and identify sorghum resources. There are also many reports that gene loci can be mutated into disease-resistant genes. For example, Chen et al. found that a BSR-D1 rice blast susceptibility gene locus in nature mutated into a disease-resistant gene SNP33-G in rice. Eukaryotic translation initiation factor 4E (EIF4E) is a susceptibility factor for viral infection in many plant species. Hoffie et al. targeted mutagenesis of the EIF4E gene by Cas9 endonuclease in winter barley varieties susceptible to BaMMV / BaYMV led to the movement of the translation reading frame, resulting in the loss of EIF4E function and enhanced winter barley resistance to Bymovirus. Overexpression of TaRsfS, a ribosomal silencing factor (RsfS) homolog in wheat, reduces wheat resistance to powdery mildew and stripe rust, while TaRsfS knockout (TaRsfS-KO) increases wheat resistance to these two diseases without affecting key agronomic traits. The wheat GRAINWIDTH2 (TaGW2) homologous gene negatively regulates grain weight and mediates the ubiquitination of TaSGT1 to negatively regulate wheat leaf rust resistance. By editing TaGW2 with CRISPR / Cas9, grain weight and leaf rust resistance were increased simultaneously. This study showed that the sorghum anthracnose susceptible gene SbABCA7 may be transformed into a disease-resistant gene through gene editing and other technologies, which has certain potential uses in sorghum disease resistance breeding research, and its function will be further explored in the next step.

[0005] There are many reports on heterologous cloning of sorghum genes, such as cloning the sorghum nitrogen deficiency-specific induced gene SbMYB-like, constructing an overexpression vector, and transforming it into Arabidopsis to obtain an overexpression strain, which verifies that the gene plays an important role in promoting root elongation and flowering; cloning the sorghum deep rooting gene SbDRO1, overexpressing SbDRO1 in Arabidopsis can significantly improve the survival rate of Arabidopsis under drought conditions, and the root system of transgenic Arabidopsis is significantly more developed than that of the wild type; cloning the sorghum seed shattering Sh-B140 gene and transferring it into the Sudan grass variety Hiro-1. By observing the field phenotype of the T1 generation transgenic plants, it was found that the seed shattering intensity of the T1 plants was higher than that of Hiro-1, but significantly lower than that of the parent B140. However, there are few reports on homologous cloning in sorghum, and there has been no homologous cloning and functional analysis of sorghum anthracnose-related genes. The present invention discovered the sorghum anthracnose susceptibility gene SbABCA7 by genome-wide association analysis (GWAS) and transcriptome combined analysis, performed homologous cloning and vector construction, obtained SbABCA7 genetically transformed sorghum plants, and performed bioinformatics analysis on the gene, aiming to lay a foundation for the study of the biological function of the sorghum anthracnose resistance-related gene.

[0006] Susceptibility genes in plants are key genes for the occurrence of diseases. They will be overexpressed after direct contact with the effector proteins of pathogenic bacteria, and then activate the entire susceptibility pathway of the plant, eventually leading to plant disease. In the report of anthracnose infection in sorghum, previous studies did not find any susceptibility genes. The acquisition of sorghum anthracnose susceptibility genes can systematically analyze the molecular response mechanism of sorghum anthracnose, and can also identify sorghum anthracnose through sorghum susceptibility genes. At the same time, after cloning and transforming the susceptibility genes, the genetic mechanism of sorghum resistance to anthracnose can be analyzed, and the foundation can be laid for the study of sorghum anthracnose resistance genes and the genetic improvement of sorghum resistance to anthracnose. Summary of the invention

[0007] The purpose of the present invention is to provide a sorghum anthracnose susceptible gene SbABCA7, a recombinant plasmid and its application. The present invention transforms the sorghum anthracnose susceptible gene SbABCA7 into a recombinant plasmid to obtain a recombinant plasmid, which can act on sorghum plants to identify sorghum resistance to anthracnose.

[0008] The technical solution of the present invention is: a sorghum anthracnose susceptibility gene SbABCA7, the nucleotide sequence of the susceptibility gene SbABCA7 is SEQ ID NO.01, and the susceptibility gene SbABCA7 is a gene encoding a protein composed of the amino acid sequence shown in SEQ ID NO:2.

[0009] A recombinant plasmid comprising the gene sequence of the disease-susceptibility gene SbABCA7 according to claim 1.

[0010] The aforementioned method for constructing the recombinant plasmid is carried out according to the following steps:

[0011] (1) After PCR amplification of the disease-susceptible gene SbABCA7, the 2874 bp electrophoresis fragment was cut out and recovered, and the target fragment was recovered using the agarose gel DNA recovery kit DP209-03 from Tiangen Biochemical Technology Co., Ltd.;

[0012] (2) subjecting the target fragment to an enzyme digestion-ligation reaction to obtain a ligation product;

[0013] (3) The ligation product is mixed with competent E. coli cells, cultured in LLB liquid medium to restore the cells to normal growth state, and then the recombinant plasmid is transformed into plasmid colonies on LB solid medium plates;

[0014] (4) Using primers JJ-F and NOS-R, PCR amplification is performed on the plasmid colonies obtained in step (3), and PCR detection is performed; the positive bacterial plaques detected are picked out, separated and purified, and the plasmid is extracted.

[0015] In the above step (1), the PCR amplification reaction system is 25 μL of 2xPCR buffer, 10 μL of 2mM dNTPs, 1 μL of primer F, 1 μL of primer R, 1 μL of KOD-FX and 1 μL of BTx623 sorghum DNA template, and then ddH2O is added to prepare a 50 μL PCR amplification reaction system; the PCR amplification reaction conditions are: first pre-denaturation at 98°C for 3 min, then 98°C for 10 sec to 68°C for 3 min, cycle 32 times, and finally 68°C for 6 min; the nucleotide sequence of the primer F is SEQ ID NO.03, and the nucleotide sequence of the primer R is SEQ ID NO.04.

[0016] In the above step (2), the enzyme digestion-ligation reaction system is: 10×CutSmartBuffer 1.5μL, 10mMATP1.5μL, empty plasmid 100ng, target fragment 100ng, BsaI-HF 10U and 4DNAligase35U, added with H2O to make up to 15μL; the enzyme digestion-ligation reaction parameters are 37℃5min first, then 20℃5min.

[0017] In the above step (4), the colony PCR amplification system is as follows: take 10ul of 2XTaqMIX, 0.5ul of JJ-F primer and 0.5ul of NOS-R primer, pick up colonies and add them, add ddH2O to 20ul; the colony PCR amplification reaction parameters are pre-denaturation at 95°C for 5min, denaturation at 95°C for 530sec, annealing at 55°C for 30sec, extension at 72°C for 1min, and final extension at 72°C for 2min; the nucleotide sequence of the primer JJ-F is SEQIDNO.05, and the nucleotide sequence of the primer NOS-R is SEQIDNO.06.

[0018] The application of the aforementioned sorghum anthracnose susceptibility gene SbABCA7 and the aforementioned recombinant plasmid in homologous genetic transformation of sorghum.

[0019] The aforementioned application is characterized in that: after the sorghum-positive plants genetically transformed with the sorghum anthracnose susceptibility gene SbABCA7 are treated with a sorghum anthracnose pathogen spore solution, the gene is significantly overexpressed, and the sorghum-positive plants have significantly more lesions than the wild control sorghum plants; indicating that the sorghum anthracnose susceptibility gene SbABCA7 is a sorghum anthracnose susceptibility gene.

[0020] In the aforementioned application, after anthracnose-resistant sorghum and anthracnose-susceptible sorghum were treated with spore solution of sorghum anthracnose pathogenic bacteria, the sorghum anthracnose susceptibility gene SbABCA7 was significantly overexpressed in the susceptible sorghum, which can be used for rapid identification of anthracnose-susceptible sorghum resources.

[0021] The nucleotide sequences of the specific primers for detecting overexpression of the sorghum anthracnose susceptible gene SbABCA7 are SEQ ID NO.07 and SEQ ID NO.08.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] 1. The present invention discloses a sorghum anthracnose susceptible gene SbABCA7, a recombinant plasmid and an application thereof. SbABCA7 is a sorghum anthracnose susceptible gene. Primers designed with the susceptible gene can be directly used as molecular markers to quickly screen and identify sorghum anthracnose-resistant resources at the seedling stage, providing a convenient method for quickly screening materials for sorghum anthracnose-resistant breeding research and improving sorghum anthracnose-resistant varieties.

[0024] 2. So far, there have been no reports on sorghum anthracnose susceptible genes. Sorghum susceptibility genes can be mutated into disease-resistant genes through gene loci. The SbABCA7 sorghum susceptibility gene in the present invention may be transformed into a disease-resistant gene through gene editing and other technologies. It has certain potential uses in the research on sorghum disease-resistant breeding, and will help provide theoretical methods and new strategies for the creation of sorghum anthracnose-resistant germplasm. The next step will be to explore its functions.

[0025] 3. The susceptibility gene SbABCA7 for sorghum anthracnose was discovered for the first time, constructed into a recombinant plasmid, and genetically transformed into sorghum plants. This allows for more functional analysis of the susceptibility gene SbABCA7, which has far-reaching significance for the academic research on sorghum anthracnose and the improvement of sorghum anthracnose-resistant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 : SbABCA7 gene structure diagram (white box-UTR, red box-exon, line-intron);

[0027] Figure 2 : Plasmid vector map of SbABCA7 gene;

[0028] Figure 3 : T0 generation overexpression transformed seedlings and positive identification of SSbABCA7 (A: T0 seedlings of SbABCA7, B: electrophoresis diagram of identification of overexpression positive strains of SbABCA7);

[0029] Figure 4 : Expression level of SbABCA7 gene in positive sorghum;

[0030] Figure 5 : Pictures of wild-type (CK) and SbABCA7 transformed sorghum leaves on the 5th day after treatment with anthracnose pathogens (A: CK, B: SbABCA7);

[0031] Figure 6 : Specific expression of SbABCA7 gene in disease-resistant and disease-susceptible sorghum. DETAILED DESCRIPTION

[0032] The present invention is further described below in conjunction with the accompanying drawings and embodiments, but they are not intended to limit the present invention.

[0033] Example 1: Gene localization

[0034] Firstly, the anthracnose-resistant and anthracnose-susceptible sorghum seedlings were sprayed with 1.5x105 / ml spore solution of the isolated and identified sorghum anthracnose pathogen (Colletotrichum sublineolum) provided by the Plant Pathology Teaching and Research Section of Guizhou University, and the aboveground seedlings at 0h, 12h, 24h, 36h, and 48h were used for transcriptome analysis. Secondly, the aboveground seedlings at 0h, 24h, 36h, and 48h were used for broad-target metabolome analysis. The KEGG pathway enrichment in the transcriptome and metabolome was then jointly analyzed (p<0.05). A total of 18 pathways were obtained in the metabolome, which were reflected in variety-specific pathways, common pathways, and pathways induced at the same time. 36 pathways were obtained in the transcriptome, mainly flavonoid biosynthesis, ABC transporter, cyanoamino acid metabolism, etc.; 4 pathways (starch and sucrose metabolism, flavonoid biosynthesis, ABC transporter, cyanoamino acid metabolism) were enriched in both the transcriptome and the metabolome. Further analysis of the basal differences between varieties when not inoculated with sorghum anthracnose revealed that the two pathways obtained previously (starch and sucrose metabolism, flavonoid biosynthesis) were also enriched in the basal differences between the two varieties. In order to determine whether the effects of these two pathways after inoculation were entirely due to varietal differences and to screen potential disease resistance pathways, the number of genes induced at different times in different varieties was analyzed to see if they overlapped. After inoculation, a large number of genes in the flavonoid biosynthesis and starch and sucrose metabolism pathways were significantly affected compared with those without inoculation, especially down-regulating the expression of many genes. However, since the inoculation of sorghum anthracnose pathogens affected too many genes in the starch and sucrose metabolism pathways, the difficulty of gene screening was severely limited, so the flavonoid biosynthesis pathway was mainly studied. The analysis found that the flavonoid biosynthesis pathway, ABC transporter protein, and cyanoamino acid metabolism pathway were significantly enriched in the transcriptome and metabolome analysis of sorghum at different infection times, different resistant materials, and WGCNA, and previous studies have shown that these three pathways are all related to plant disease resistance.

[0035] Based on the mined flavonoid biosynthesis, ABC transporters, and cyanoamino acid metabolism pathways, the correlation cluster analysis between all DEGs and their genes was analyzed. In the ABCtransporters pathway, potential disease-related pathway genes were screened: Sobic.007G120000 was used as a candidate gene.

[0036] In addition, the expression trend analysis of FPKM expression and RT-qPCR relative expression was performed on the candidate Sobic.007G120000, and the 12 disease resistance-related genes with consistent expression trends in resistant and susceptible sorghum and huge expression differences between resistant and susceptible sorghum were screened. Comparison found that the maximum FPKM value and RT-qPCR relative expression of Sobic.007G120000 in susceptible sorghum were 8.61 times and 11 times that of resistant sorghum, respectively. Therefore, Sobic.007G120000 was selected as the sorghum anthracnose resistance-related gene for candidate genetic transformation analysis.

[0037] BlastP was used to search the NCBI (https: / / ngdc.cncb.ac.cn / sorgsd / browse) database and download the SBP15 sequences of other species; MEGA7.0 software was used to align the sequences with the muscle method and then construct an unrooted evolutionary tree by neighbor-joining (NJ) (bootstrap=1000). Homology alignment and neighbor-joining tree were used for analysis. The Sobic.007G120000 protein had the highest homology with MfABCA7 (ATP binding box A7) (Per.Ident=95.93%, E-value=0), so the Sobic.007G120000 gene can be regarded as the SbABCA7 gene. The nucleotide sequence of the gene SbABCA7 is SEQIDNO.01, and the amino acid sequence of the SbABCA7 protein gene is SEQIDNO.02.

[0038] The SbABCA7 gene was retrieved and screened from the genome browser in SorGSD (https: / / ngdc.cncb.ac.cn / sorgsd / browse) to analyze its gene characteristics, showing that it has a complete gene structure and multiple introns. There are 1154 SNPs and 124 Indel mutations in the SbABCA7 gene. There are no high-consequence type SNP variations; there are 17 moderate-consequence type SNP variations (missense variations) and 23 low-consequence type SNP variations (synonymous variations and protein-changing variations) in the coding region; and among the modification types, the upstream gene and downstream gene mutations are the most, followed by 3'UTR region and intron mutations, and the least is a small number of mutations in the 5'UTR region, but no coding region mutations. For Indel mutations, only modification types exist, among which the upstream gene and downstream gene mutations are the most, followed by intron mutations and a small number of mutations in the 3'UTR region, but no 5'UTR region and coding region mutations (Table 1, Figure 1 ).

[0039] Table 1SbABCA7 coding variation statistics.

[0040]

[0041]

[0042] Example 2: Construction of vectors of disease-susceptibility genes

[0043] 1. Design of vector primers, as shown in Table 2.

[0044] Table 2 Primer sequences for constructing vector

[0045]

[0046] 2. Amplification and recovery of target fragments

[0047] When recovering the fragments, the electrophoresis fragments of 2874 bp were cut out from the Sobic.007G120000 and SbABCA7 genes respectively, and the target fragments were recovered using the agarose gel DNA recovery kit (DP209-03) of Tiangen Biochemical Technology Co., Ltd.; the operation was performed according to the instructions of the kit.

[0048] The PCR reaction system was: 2xPCR buffer 25 μL, 2 mM dNTPs 10 μL, F 1 μlL, R 1 μlL, KOD-FX 1 μL, 1 μL of BTx623 sorghum DNA template, and ddH 2 O was added to 50 μL to obtain the PCR reaction;

[0049] PCR reaction conditions:

[0050]

[0051] 3. Enzyme Digestion-Ligation Reaction

[0052] Operate according to the enzyme digestion reaction system in Table 3, and then set the reaction according to the enzyme digestion-ligation reaction parameters in Table 4.

[0053] Table 3 Enzyme digestion reaction system

[0054]

[0055] Table 4 Enzyme digestion-ligation reaction parameters

[0056]

[0057] 4. Recombinant plasmid transformation

[0058] (1) Take a tube of 100 μL of DH5a competent E. coli cells and mix with 2-5 μL of ligation product and incubate on ice for 30 min;

[0059] (2) Rapidly place in a 42°C constant temperature water bath, heat shock for 90 seconds, and ice bath for 2 minutes;

[0060] (3) Add 500 μL of LB liquid culture medium and mix well;

[0061] (4) Cultivate at 37°C and 200 rpm for 45 min to allow the cells to return to normal growth;

[0062] (5) Spread the bacterial solution evenly on a Kana-resistant LB solid culture medium plate;

[0063] (6) After 30 minutes, place the cells in a 37°C incubator for overnight culture.

[0064] 5. Bacteria test

[0065] Use the primer pair JJ-F / NOS-R to perform colony PCR detection according to the following colony PCR amplification system and the parameters in Table 4; pick and shake the positive plaques detected.

[0066] Colony PCR amplification system: 2XTaqMIX10ul, JJ-F primer: 0.5ul, NOS-R primer 0.5ul, pick a small amount of colonies, add ddH2O to 20ul.

[0067] Table 5 Colony PCR reaction parameters

[0068]

[0069]

[0070] 6. Plasmid Extraction

[0071] (1) Pick a single clone from the LB solid medium plate and inoculate it into LB liquid medium with kanamycin resistance at a final concentration of 50 μg / mL, and culture it at 37°C overnight;

[0072] (2) Take 4 mL of activated bacterial solution, centrifuge at 10,000 rpm for 2 min at room temperature, and discard the supernatant completely;

[0073] (3) Take 250 μL of Solution I reagent containing RNase A to thoroughly resuspend the bacterial mass;

[0074] (4) Take 250 μL Solution II reagent to lyse the bacterial mass and gently invert it several times until the bacteria become transparent;

[0075] (5) Take 350 μL Solution III reagent and invert several times until white compact flocs are formed;

[0076] (6) Centrifuge at 12000 rpm for 10 min at room temperature and collect the supernatant;

[0077] (7) Take out the nucleic acid purification column from the kit and place it on the collection tube;

[0078] (8) Take the clarified supernatant from step 6 above and place it into a nucleic acid purification column, centrifuge at 12000 rpm for 1 min at room temperature, and discard the filtrate;

[0079] (9) Add 500 μL of Buffer W1 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;

[0080] (10) Take 700 μL of Buffer W2 and add it to the nucleic acid purification column. Centrifuge at 12000 rpm for 30 s at room temperature and discard the filtrate. (11) Repeat the above operation step 10.

[0081] (12) Place the nucleic acid purification column on the collection tube and centrifuge at 12000 rpm for 2 min at room temperature to remove as much residual liquid as possible;

[0082] (13) Discard the collection tube, place the nucleic acid purification column in a 1.5 mL EP tube, and add 50 μL of elution solution to elute the DNA attached to the nucleic acid purification column membrane (the elution solution can be preheated in a 65°C constant temperature water bath to help elute the DNA), and let it stand at room temperature for 2 min;

[0083] (14) Centrifuge at 12000 rpm for 2 min at room temperature to elute the DNA attached to the nucleic acid purification column membrane and store in a -40°C refrigerator for later use;

[0084] (15) Take a small amount of the recovered product and use 1% agarose gel electrophoresis to detect the quality of the plasmid extraction.

[0085] 7) Sequencing

[0086] The plasmid extracted from the positive plaque was subjected to Sanger sequencing and tested with sequencing primer eGFP-cx. If the sequencing result sequence was consistent with the target fragment sequence, the overexpression vector was successfully constructed. The vector map is shown in Figure 2 .

[0087] Example 3: Genetic transformation of sorghum

[0088] Agrobacterium containing plasmid vector was transferred into P8980182 sorghum. The stable genetic transformation of sorghum was completed with the help of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. It includes sorghum callus induction, Agrobacterium infection of callus tissue, resistant callus screening, and regeneration plant culture.

[0089] 1. Planting of genetically transformed sorghum and detection of gene overexpression

[0090] The T0 generation overexpression transformed sorghum plants were planted in the teaching experimental field of Guizhou University and routinely planted and managed. When the T0 generation sorghum grew to the jointing stage, leaves of 8 plants were taken for identification of positive plants. Bright bands were seen in all of them, and the size of the amplified product was consistent with the expected one. Figure 3 When sorghum plants reached the booting stage, leaves of the wild type (CK) and SbABCA7-positive strains (L1276-1, L1276-3, L1276-3) were taken for expression testing.

[0091] The test method is RT-qPCR, using ambion by life technologies Total RNA was extracted with Biosharp SYBR PCR Reagent (Lot. No. 338111), and reverse transcribed into cDNA using Beyotime's BeyoRTTMⅢ CDNA Reverse Transcription Kit (Beyotime, with gDNA EZeraser, Lot. No. D7185M). SbUBQ10 was used as the internal reference gene, and homologous cloned gene primers were used for qRT-PCR amplification using biosharp's Universal Fluorescence Quantitative PCR Kit (biosharp, Universal SYBR QPCR Master Mix, Lot. No. BL697A); the use of the above reagents was referred to the instructions. BIO-RAD CFX96 Real-Time cycler (c100 Touch Thermal cycler) was used to quantify gene expression levels. The 2 -ΔΔCT The method was used to determine the relative fold change in target gene expression.

[0092] Table 6 Primers for disease resistance-related genes of homologous cloning

[0093] Serial number name sequence SEQ ID NO.07 Forward primer (5′-3′) TCTACCTATAACAACAACACCGCATAC SEQ ID NO.08 Reverse primer (5′-3′) CAACATTTCCACTCCACTTCCTCTG

[0094] The leaves of the successfully transformed positive sorghum were selected for identification of the anthracnose resistance phenotype.

[0095] Example 4: Overexpression of SbABCA7 in positive strains

[0096] The results of the overexpression assay of the three overexpression strains of SbABCA7 gene are as follows: Figure 4 As shown. Compared with the wild-type CK, the expression levels of SbABCA7 in L1276-1, L1276-3, and L1276-3 were 564.65, 714.08, and 241.05 times of CK, respectively. This indicates that the constructed overexpression vector has an effect on SbABCA7 in sorghum, and by changing their expression levels, it ultimately leads to the production of effects. These materials can be used to further study the effects of mutation effects on agronomic traits and disease resistance of materials.

[0097] Example 5: Changes in lesions of overexpressing sorghum

[0098] The lesions were counted every 12 hours and it was found that at the 72nd hour, lesions began to appear on the leaf veins of the SbABCA7-positive strains and the control plants, but there were more lesions on the leaf veins of the positive strains than on the control leaves. At the 96th hour, lesions began to appear on the leaves of the SbABCA7-positive strains and the control plants, but there were more lesions on the leaves of the positive strains than on the control leaves. At the 120th hour, there were significantly more lesions on the leaves of the SbABCA7-positive strains than on the control leaves. Figure 5 ; This indicates that overexpression of SbABCA7 in sorghum will lead to an increase in sorghum lesions.

[0099] Example 6: Identification of SbABCA7 for Anthracnose Resistance in Sorghum

[0100] According to the nucleotide sequence of the susceptible gene SbABCA7, SEQ ID NO.01, a specific primer sequence of SEQ ID NO.07 was designed. Then, 1.5×10 5 The seedlings of anthracnose-resistant sorghum (DR) and anthracnose-susceptible sorghum (S) were sprayed with spore solution of 100 spores / ml. The aboveground parts of the plants were taken just before inoculation (0 h), 12, 24, 36, and 48 h after inoculation, and RNA was extracted. The specific expression of SbABCA7 gene in disease-resistant and disease-susceptible sorghum was analyzed by real-time fluorescence quantitative qPCR using SEQ ID NO.07 as primer. Figure 6 As shown, the relative expression level of SbABCA7 gene in susceptible sorghum was significantly higher than that in resistant sorghum at 12-48h. Based on the significant difference in the relative expression level of SbABCA7 gene in anthracnose-resistant and anthracnose-susceptible sorghum, whether sorghum is resistant / susceptible to anthracnose can be identified, and sorghum anthracnose-resistant resources can be quickly identified.

[0101]

[0102]

[0103]

[0104] Amino acid sequence of SbABCA7 protein gene

[0105] SEQ ID NO.02:

[0106] Met Asp Ala Pro Ala Pro Thr Arg Gly Pro Ala Ser Phe Leu Thr Gln AlaAsn Ala Leu Leu Arg

[0107] Lys Asn Leu Cys Phe Gln Lys Arg Asn Leu Lys Thr Asn Ile Gly Ile ThrLeu Phe Pro Val Leu Leu

[0108] Cys Val Ile Leu Val Val Leu Gln Gly Val Ile Asp Asn Glu Leu Asp LysPro Lys Tyr Arg Cys Gly

[0109] Cys Ala Cys Val Asp Pro Gly Pro Asp Ala Val Gly Asp Ala Cys Arg ArgThr Glu Cys Gly Val

[0110] Gln His Ser Thr Leu Asp Gln Val Gly Ser Cys Pro Ile Pro Asn Pro ThrPro Trp Pro Ala Leu Val

[0111] Gln Val Pro Arg Pro Glu Ser Arg Ala Val Arg Ile Ala Gly Gln Pro PheAsp Gly Leu Pro Asp Pro

[0112] Ser Cys Arg Asp Thr Gly Ser Cys Pro Ala Ala Val Leu Val Thr Gly AsnAsn Arg Ser Leu Ala

[0113] Gln Asn Leu Ser Gly Gly Leu Phe Pro Ala Ser Thr Ser Ser Leu Asn LeuThr Asp Tyr Leu Asp

[0114] Glu Leu Ser Arg Ile Val Ala Gly Ser Asp Thr Trp Pro Trp Thr Thr GluLeu Ile Glu Ser Ala Phe

[0115] Ile Pro Gly Asn Asn Leu Tyr Arg Leu Gln Ser Arg Cys Leu Ser Asn LeuThr Gln Thr Val Ser Phe

[0116] Asn Ala Gly Val Ile Pro Leu Gln Leu Asn Ile Asp Cys Val Gln Gly LeuPro Leu Trp Arg Glu Ser

[0117] Ala Ser Phe Val Asn Asp Glu Leu Phe Lys Gly Tyr Arg Gln Asn Gly GlyGly Ser Gly Gly Gly

[0118] Lys Thr Asn Glu Phe Val Ala Gly Tyr Asp Phe Leu Asn Thr Asn Met AsnGly Leu Glu Met Asn

[0119] Ile Trp Tyr Asn Ser Thr Tyr Asn Asn Asn Thr Ala Tyr Val Ser Ile SerLeu Leu Arg Val Pro Arg

[0120] Leu Val Asn Ala Ala Ser Asn Glu Tyr Ile Lys Phe Leu Arg Gly Ser GlyVal Glu Met Leu Leu Gln

[0121] Tyr Val Lys Glu Met Pro Lys Val Gly Thr Lys Leu Lys Phe Asp Leu SerSer Leu Leu Gly Ala

[0122] Leu Phe Phe Thr Trp Ile Ile Glu Leu Leu Phe Pro Val Ile Leu Thr TyrLeu Val Tyr Glu Lys Gln

[0123] Gln Lys Leu Lys Ile Met Met Lys Met His Gly Leu Lys Asp Gly Pro TyrTrp Leu Ile Ser Tyr Phe

[0124] Tyr Phe Phe Ala Leu Ser Ala Ile Tyr Met Ile Leu Phe Val Ile Phe GlySer Leu Ile Gly Leu Asp

[0125] Phe Phe Arg Lys Asn Asp Tyr Ser Leu Gln Phe Val Phe Tyr Phe Ile TyrIle Asn Leu Gln Ile Ser

[0126] Leu Ala Phe Leu Val Ala Ser Phe Phe Ser Ala Val Lys Thr Ala Thr ValVal Gly Tyr Ile Tyr Val

[0127] Phe Gly Ser Gly Leu Leu Gly Glu Phe Leu Leu Arg Phe Phe Val Glu AspThr Gly Phe Pro Lys

[0128] Gly Trp Ile Val Val Met Glu Ile Ile Pro Gly Phe Ser Leu Phe Arg GlyLeu Tyr Glu Phe Gly Gln

[0129] Tyr Ala Ser Ala Gly Asn Ser Met Gly Thr Thr Gly Met Lys Trp Ser AsnLeu Asp Asp Ser Leu

[0130] Asn Gly Met Arg Gly Val Leu Ile Ile Met Val Val Glu Trp Ala Ile LeuLeu Pro Leu Ala Phe Tyr

[0131] Val Asp Gln Val Ser Ser Leu Gly Gly Gly Phe Arg Lys Asn Ser Phe PhePhe Leu Ser Cys Phe

[0132] Lys Arg Arg Ala Leu Ser Leu Arg Arg Tyr Ser Phe Arg Arg Gln Glu SerLys Val Val Val Glu

[0133] Met Asp Asn Pro Asp Ala Val Gln Glu Arg Glu Val Val Glu Gln Leu LeuLeu Glu Pro Ile Ala

[0134] Asn Gln Ala Ile Leu Ser Asp Asn Leu Lys Lys Val Tyr His Gly Lys AspGly Asn Pro Asp Lys

[0135] Leu Ala Val Arg Gly Leu Ser Leu Ala Ile Pro Lys Gly Gln Cys Phe GlyMet Leu Gly Pro Asn Gly

[0136] Ala Gly Lys Thr Ser Phe Ile Ser Met Met Ile Gly Leu Ile Pro Pro ThrSer Gly Thr Ala Tyr Val His

[0137] Gly Met Asp Ile Arg Thr Asp Met Asp Glu Ile Tyr Thr Asn Met Gly ValCys Pro Gln His Asp

[0138] Leu Leu Trp Glu Thr Leu Thr Gly Arg Glu His Leu Leu Phe Tyr Gly ArgLeu Lys Asn Leu Lys

[0139] Gly Thr Glu Leu Leu Lys Ala Val Asp Asp Ser Leu Lys Ser Val Asn LeuPhe His Gly Gly Val

[0140] Gly Asp Lys Gln Val Gly Lys Tyr Ser Gly Gly Met Lys Arg Arg Leu SerVal Ala Ile Ser Leu Ile

[0141] Gly Asp Pro Lys Val Val Phe Met Asp Glu Pro Ser Thr Gly Leu Asp ProAla Ser Arg Asn Asn

[0142] Leu Trp Ser Val Val Lys Glu Ala Lys Arg Asn Arg Ala Ile Ile Leu ThrThr His Ser Met Glu Glu

[0143] Ala Glu Val Leu Cys Asp Arg Leu Gly Ile Phe Val Asp Gly Gly Phe GlnCys Leu Gly Asn Pro

[0144] Lys Glu Leu Lys Ala Arg Tyr Gly Gly Thr Tyr Val Leu Thr Met Thr ThrSer Ser Glu Asn Glu

[0145] Lys Glu Val Glu Gln Leu Val His His Leu Ser Pro Asn Ala Ser Arg IleTyr His Ile Ser Gly Thr

[0146] Gln Lys Phe Glu Leu Pro Lys Gln Asp Leu Lys Ile Ala Asp Val Phe HisAla Val Glu Ser Ala Lys

[0147] Cys Arg Phe Asn Ile Tyr Ala Trp Gly Leu Val Asp Thr Thr Leu Glu AspVal Phe Ile Lys Val Ala

[0148] Lys Gly Ala Gln Ala Phe Asn Val Val Thr

Claims

1. A sorghum anthracnose susceptibility gene SbABCA7, characterized in that: The nucleotide sequence of the disease-susceptible gene SbABCA7 is SEQ ID NO.01, and the disease-susceptible gene SbABCA7 is a gene encoding a protein consisting of the amino acid sequence shown in SEQ ID NO:

2.

2. A recombinant plasmid, characterized in that: The recombinant plasmid comprises the gene sequence of the disease-susceptibility gene SbABCA7 according to claim 1.

3. The method for constructing a recombinant plasmid according to claim 2, characterized in that: The construction method is carried out according to the following steps: (1) After PCR amplification of the disease-susceptible gene SbABCA7, the 2874 bp electrophoresis fragment was cut out and recovered, and the target fragment was recovered using the agarose gel DNA recovery kit DP209-03 from Tiangen Biochemical Technology Co., Ltd.; (2) subjecting the target fragment to an enzyme digestion-ligation reaction to obtain a ligation product; (3) The ligation product is mixed with competent E. coli cells, cultured in LLB liquid medium to restore the cells to normal growth state, and then the recombinant plasmid is transformed into plasmid colonies on LB solid medium plates; (4) Using primers JJ-F and NOS-R, PCR amplification is performed on the plasmid colonies obtained in step (3), and PCR detection is performed; the positive bacterial plaques detected are picked out, separated and purified, and the plasmid is extracted.

4. The method for constructing a recombinant plasmid according to claim 3, characterized in that: In the step (1), the PCR amplification reaction system is 25 μL of 2xPCR buffer, 10 μL of 2mM dNTPs, 1 μL of primer F, 1 μL of primer R, 1 μL of KOD-FX and 1 μL of BTx623 sorghum DNA template, and then ddH2O is added to prepare a 50 μL PCR amplification reaction system; the PCR amplification reaction conditions are: pre-denaturation at 98°C for 3 min, then at 98°C for 10 sec to 68°C for 3 min, for 32 cycles, and finally at 68°C for 6 min; the nucleotide sequence of the primer F is SEQ ID NO.03, and the nucleotide sequence of the primer R is SEQ ID NO.

04.

5. The method for constructing a recombinant plasmid according to claim 3, characterized in that: In the step (2), the enzyme digestion-ligation reaction system is: 10×CutSmartBuffer 1.5 μL, 10 mM ATP 1.5 μL, empty plasmid 100 ng, target fragment 100 ng, BsaI-HF 10 U and 4 DNA ligase 35 U, and H2O is added to make up to 15 μL; the enzyme digestion-ligation reaction parameters are first 37°C for 5 min, then 20°C for 5 min.

6. The method for constructing a recombinant plasmid according to claim 3, characterized in that: In the step (4), the colony PCR amplification system is as follows: 10ul of 2XTaqMIX, 0.5ul of JJ-F primer and 0.5ul of NOS-R primer are taken, a colony is picked and added, and ddH2O is added to 20ul; the colony PCR amplification reaction parameters are pre-denaturation at 95°C for 5min, denaturation at 95°C for 530sec, annealing at 55°C for 30sec, extension at 72°C for 1min, and final extension at 72°C for 2min; the nucleotide sequence of the primer JJ-F is SEQIDNO.05, and the nucleotide sequence of the primer NOS-R is SEQIDNO.

06.

7. Use of the sorghum anthracnose susceptibility gene SbABCA7 according to claim 1 and the recombinant plasmid according to claim 3 in homologous genetic transformation of sorghum.

8. The use according to claim 7, characterized in that: After being treated with a sorghum anthracnose pathogenic bacteria spore solution, the sorghum positive plants genetically transformed with the sorghum anthracnose pathogenic gene SbABCA7 showed significant overexpression of the gene, and the sorghum positive plants had significantly more lesions than the wild control sorghum plants, indicating that the sorghum anthracnose pathogenic gene SbABCA7 is a sorghum anthracnose pathogenic gene.

9. The use according to claim 7, characterized in that: After anthracnose-resistant sorghum and anthracnose-susceptible sorghum were treated with spore solution of sorghum anthracnose pathogenic bacteria, the sorghum anthracnose susceptibility gene SbABCA7 was significantly overexpressed in susceptible sorghum, which can be used to quickly identify anthracnose-susceptible sorghum resources.

10. The use according to claim 8 or 9, characterized in that: The nucleotide sequences of the specific primers for detecting overexpression of the sorghum anthracnose susceptible gene SbABCA7 are SEQ ID NO.07 and SEQ ID NO.08.

Images