A dsRNA targeting the BcPfy1 gene, Beauveria bassiana engineered strain Bb-dsPfy1 and their applications

By constructing the engineering strain Bb-dsPfy1 of the leucorrhizophrenia, the expression of dsRNA targeting the BcPfy1 gene was solved, and the problems of high cost, poor stability and low delivery efficiency of dsRNA in the agricultural field were solved, effectively preventing and controlling gray mold, and providing a cost-effective biopesticide solution.

CN119464320BActive Publication Date: 2025-06-24QINGDAO AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411565636.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-05
Publication Date
2025-06-24
Estimated Expiration
2044-11-05

AI Technical Summary

Technical Problem

The existing dsRNA application in the agricultural field has problems such as high cost, poor stability and low delivery efficiency, which limits its effective use in plant pest control.

Method used

The engineered strain Bb-dsPfy1 of the white coccyx was constructed, and the strain was used to express dsRNA targeting the BcPfy1 gene, and effectively interfere with and control the Ash Mold through efficient microbial synthesis and delivery.

Benefits of technology

It significantly inhibits the invasion and lesions of ash mold, reduces the biomass of ash mold, improves the stability and delivery efficiency of dsRNA, and provides a cost-effective biopesticide solution.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119464320B_ABST
    Figure CN119464320B_ABST
Patent Text Reader

Abstract

The present invention provides a dsRNA targeting the BcPfy1 gene, a Beauveria bassiana engineered strain Bb-dsPfy1, and their applications. The Beauveria bassiana engineered strain Bb-dsPfy1 uses the Beauveria bassiana QSE-F1 strain as the chassis strain, and this strain can colonize the tomato leaves. The dsRNA is a double-stranded RNA fragment designed with the Botrytis cinerea BcPfy1 gene as the target, which has the functions of interfering with the expression of the BcPfy1 gene and inhibiting the infection of Botrytis cinerea. This fragment is obtained by in vitro synthesis or synthesized in the QSE-F1 strain through two target gene sequences with the same sequence and opposite directions. The engineered strain Bb-dsPfy1 is obtained by using the ATMT technique to transfer a vector containing the target gene sequence into the Beauveria bassiana QSE-F1 strain, and it is an engineered strain capable of synthesizing dsRNA targeting BcPfy1. It is demonstrated by experiments in the present invention that the engineered strain can effectively interfere with the expression of the target gene BcPfy1 and has a significant control effect on the occurrence of tomato gray mold. This engineered strain can be used to prepare biological agents for controlling gray mold and has good market application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of crop disease prevention and control gene technology, and specifically relates to a dsRNA targeting the BcPfy1 gene, a Beauveria bassiana engineering strain Bb-dsPfy1, and their applications. Background Art

[0002] RNA interference (RNAi) technology is a relatively advanced gene regulation technology that can silence the expression of target genes through double-stranded RNA (dsRNA), and has potential application value in fields such as medicine and plant protection. RNA pesticides developed with RNAi technology use dsRNA specifically targeting key genes of pests as the active ingredient, and have the advantages of strong targeting, excellent efficacy, high environmental and ecological safety, and low resistance generation, and are considered the "third revolution" in the history of pesticide development. At present, there are mainly two ways to apply dsRNA in the agricultural field. One is to obtain transgenic plants expressing dsRNA through plant genetic transformation technology, and use the dsRNA expressed by the host to interfere with the expression of target genes of pests, that is, the host-induced gene silencing (HIGS) technology; the other is to directly spray dsRNA in vitro to silence target genes, that is, the spray-induced gene silencing (SIGS) technology. However, the lack of a mature genetic transformation system and the long transformation cycle in some crops greatly limit the popularization and application of the HIGS technology; the SIGS technology also has problems such as poor stability of dsRNA in the environment, low delivery efficiency to target organisms, and high costs for dsRNA synthesis and purification, which limit the commercialization process of the SIGS technology in the agricultural field. Therefore, in order to effectively utilize dsRNA in the prevention and control of plant diseases and pests, it is necessary to find more effective ways to apply dsRNA.

[0003] Using endophytes that are preponderantly colonized in plant tissues as chassis microorganisms, engineering strains that highly express dsRNA of pest target genes are constructed. By using microorganisms to efficiently synthesize dsRNA and deliver it to plant pests, problems such as high dsRNA synthesis cost, poor dsRNA stability, and short application interval can be effectively solved, which has great research and application value in the development and field application of RNA pesticides. Beauveria bassiana is a hyphomycete insect pathogenic fungus widely used in the biological control of agricultural and forestry pests and can parasitize in hundreds of insect bodies. At the same time, Beauveria bassiana can not only parasitize in pest bodies but also colonize in various plants such as corn and tomatoes, and it is a non-pathogenic plant endophyte. In recent years, studies have found that the colonization of Beauveria bassiana in plants can not only effectively control pests but also improve the disease resistance of plants, promote plant growth, and enhance the tolerance of plants to abiotic stresses. The biological characteristics of Beauveria bassiana have a good research foundation, and it has good safety for non-target organisms such as plants and the environment, making it a suitable chassis microorganism for constructing engineering strains. At the same time, Beauveria bassiana has the advantages of easy cultivation, easy large-scale production, and low production cost, making it have a wide application prospect in the biological control of plant diseases and pests. Summary of the Invention

[0004] The present invention aims to solve the above problems and provides a dsRNA targeting the BcPfy1 gene, an engineering strain of Beauveria bassiana Bb-dsPfy1, and their applications. The engineering strain Bb-dsPfy1 expresses dsRNA of the target gene BcPfy1 of Botrytis cinerea using the Beauveria bassiana QSE-F1 strain, and this engineering strain can effectively interfere with the expression of the target gene BcPfy1 and has a significant control effect on tomato gray mold.

[0005] To achieve the above invention purposes, the present invention is realized through the following solutions:

[0006] The present invention provides the application of the BcPfy1 gene in regulating the pathogenicity of Botrytis cinerea. The coding sequence of the BcPfy1 gene is shown as SEQ ID No.1, and the BcPfy1 gene can inhibit the occurrence of gray mold and reduce the pathogenicity of Botrytis cinerea.

[0007] The present invention uses the coding gene as the target gene for controlling Botrytis cinerea, designs and synthesizes dsRNA, and verifies the effect of dsRNA in controlling gray mold. The target gene is the coding gene encoding the conserved small molecule inhibitory protein profilin during the actin assembly process, abbreviated as BcPfy1, and the sequence is shown as SEQ ID No. 1.

[0008] The present invention also provides a dsRNA targeting the BcPfy1 gene. The dsRNA is synthesized in vitro using the target gene BcPfy1 as a synthesis template, and the sequence of the dsRNA is as shown in SEQ ID No. 4.

[0009] Furthermore, the sequence of the synthesis template of the dsRNA is as shown in SEQ ID No. 2.

[0010] The present invention also provides a Beauveria bassiana engineering strain Bb-dsPfy1 expressing dsRNA. The engineering strain Bb-dsPfy1 is obtained by transferring a dsRNA expression cassette capable of interfering with the expression of the target gene BcPfy1 into Beauveria bassiana, and the sequence of the dsRNA expression cassette of BcPfy1 is as shown in SEQ ID No. 7.

[0011] Furthermore, the Beauveria bassiana is strain QSE-F1, which is deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: M 20241661.

[0012] Furthermore, the construction method of the engineering strain Bb-dsPfy1 includes the following steps:

[0013] (1) The dsRNA expression cassette is composed of arm sequences with the same sequence and opposite directions at both ends and a central sequence that plays a connecting role in the middle, and an expression cassette containing dsRNA is constructed.

[0014] (2) The expression cassette containing dsRNA is ligated to the multiple cloning site of the pDHt-Bar vector containing the constitutive promoter oliC suitable for Beauveria bassiana to construct a plasmid containing the dsRNA expression cassette.

[0015] (3) The successfully constructed plasmid containing the dsRNA expression cassette is transferred into an Agrobacterium tumefaciens strain, and then the dsRNA expression cassette is transferred into Beauveria bassiana. Positive transformants are screened using a resistance plate containing herbicide to obtain the engineering strain Bb-dsPfy1 strain. The Beauveria bassiana is strain QSE-F1, which is deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: M 20241661.

[0016] Furthermore, the engineering strain is obtained by transferring the dsRNA expression cassette of the target gene BcPfy1 into strain QSE-F1 using the Agrobacterium tumefaciens-mediated transformation (ATMT) technology to obtain the Beauveria bassiana engineering strain Bb-dsPfy1.

[0017] Furthermore, the arm sequence is the coding sequence of the target gene BcPfy1, and the sequence is as shown in SEQ ID No.1; the central sequence is the first intron sequence of the endogenous gene BcTubulin of Botrytis cinerea, and the sequence is as shown in SEQ ID No.6.

[0018] The present invention also provides the application of the dsRNA targeting the BcPfy1 gene in the prevention and control of Botrytis cinerea.

[0019] Furthermore, when using the dsRNA to prevent and control Botrytis cinerea, adding 200 μg / ml of the target gene dsRNA to the conidia of Botrytis cinerea can significantly inhibit the infection of Botrytis cinerea on tomato leaves.

[0020] Furthermore, when using the dsRNA to prevent and control Botrytis cinerea, it is manifested that the lesions caused by the infection of Botrytis cinerea are significantly reduced, and the biomass of Botrytis cinerea on the lesions is significantly decreased.

[0021] The present invention also provides the application of the engineering strain Bb-dsPfy1 in the prevention and control of Botrytis cinerea.

[0022] Furthermore, when applying, the spore suspension of the engineering strain Bb-dsPfy1 is evenly sprayed on the entire tomato plant.

[0023] Furthermore, the preparation method of the spore suspension of the engineering strain Bb-dsPfy1 is as follows: inoculate the engineering strain Bb-dsPfy1 into YEPD liquid medium, shake and culture at 25 °C and 180 rpm for 4 days, filter the culture solution through three layers of wiped paper to remove mycelia, count the spores in the filtrate, and dilute with clear water to a spore concentration of 10 6 -10 7 cfu / ml before use.

[0024] Furthermore, the engineering strain Bb-dsPfy1 can effectively inhibit the expression of the target gene BcPfy1 of Botrytis cinerea, and further inhibit the infection of Botrytis cinerea.

[0025] Furthermore, when using the engineering strain Bb-dsPfy1 to prevent and control Botrytis cinerea, it is manifested that the lesions caused by the infection of Botrytis cinerea are significantly reduced, and the biomass of Botrytis cinerea on the lesions is significantly decreased.

[0026] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0027] 1. The dsRNA provided by the present invention can effectively inhibit the expression of the target gene BcPfy1 of Botrytis cinerea, and further effectively inhibit the occurrence of tomato Botrytis cinerea.

[0028] 2. The dsRNA that uses the plant endophyte Beauveria bassiana to express the key target gene of plant pathogens provided by the present invention is an effective solution to problems such as high cost of in vitro synthesized dsRNA, poor stability in the environment, and low delivery efficiency.

[0029] 3. Using the Beauveria bassiana strain QSE-F1 as the chassis bacterium, the present invention constructs an engineered Beauveria bassiana strain Bb-dsPfy1 capable of expressing dsRNA. The engineered strain can effectively inhibit the expression of the target gene of Botrytis cinerea, thereby inhibiting the occurrence of tomato gray mold.

[0030] 4. Using the biocontrol engineered strain Bb-dsPfy1 provided by the present invention as a strain fermentation broth for use, the preparation method and usage method are simple and convenient, and the effect is remarkable. It can be used alone or prepared with other materials into a biological agent for controlling tomato gray mold, and has good market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Detection of the control effect of dsRNA of the target gene BcPfy1 on tomato gray mold and the silencing effect on the target gene BcPfy1.

[0032] Figure 2 Schematic diagram of the construction of the expression framework for expressing dsRNA using the engineered bacterium.

[0033] Figure 3 Map of the pDHt-Bar vector.

[0034] Figure 4 PCR detection results of the positive transformants of the engineered strain. Among them, ITS is used as the internal reference gene of the strain.

[0035] Figure 5 Detection of the dsRNA expressed by the engineered strain through dot blot experiment.

[0036] Figure 6 Detection of the dsRNA expressed by the engineered strain through fluorescence quantitative PCR experiment. Among them, BcActin is used as the internal reference gene.

[0037] Figure 7 Detection of the in vitro control effect of the biocontrol engineered strain Bb-dsPfy1 on tomato gray mold and the silencing effect on the target gene BcPfy1.

[0038] Figure 8 Detection of the in vivo control effect of the biocontrol engineered strain Bb-dsPfy1 on tomato gray mold and schematic diagram of the classification of the disease severity level of gray mold. DETAILED DESCRIPTION OF THE INVENTION

[0039] The technical solutions of the present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments. Unless otherwise specified, the experimental methods in the following embodiments are all conventional methods and will not be elaborated; for unconventional experimental operations, the specific steps are described in detail later. The experimental materials, drugs, instruments, etc. used in the following embodiments are all commercially available products unless otherwise specified. The quantitative statistics in the following embodiments are all three repeated experiments, and the average value is taken.

[0040] Example 1

[0041] I. Isolation and screening of QSE-F1 strain

[0042] On October 2, 2022, 5 tomatoes were collected from a greenhouse in Qingdao. About 1 cm of stem was cut from the main stem of the plant, disinfected with 0.1% sodium hypochlorite for 3 min, 70% ethanol for 1 min, and washed three times with sterile water; then placed in a sterile mortar and ground into juice, and the juice was serially diluted with sterile water; 100 μl of the tissue suspension diluted 100-fold and 1000-fold respectively was evenly spread on PDA plates (200 g of potatoes were cut into pieces and boiled in boiling water for 15 min, the supernatant was taken after filtering with three layers of gauze, 20 g of glucose, 15 g of agar powder, added water to 1 L, autoclaved at 121 °C for 20 min), and cultured in an incubator at 28 °C for 24 - 48 h. Single colonies grown on the PDA plates were picked and inoculated onto new PDA plates to obtain single colonies.

[0043] The purified strain was inoculated into YEPD liquid medium (10 g of yeast powder, 20 g of peptone, 20 g of glucose, added water to 1 L, autoclaved at 121 °C for 20 min), and cultured with shaking at 25 °C and 180 rpm for 4 days. The culture solution was centrifuged at 12000 rpm, and the supernatant was further filtered through a 0.45 μm sterile filter to obtain a cell-free fermentation broth. The fermentation broth was mixed with PDA medium and poured into plates, and then inoculated with Botrytis cinerea mycelial cakes, and continued to be cultured in an incubator at 25 °C for 2 - 3 d. The inhibition of Botrytis cinerea mycelial growth was observed, and a strain with a strong inhibitory effect on Botrytis cinerea mycelial growth was obtained and named QSE-F1.

[0044] II. Classification and identification of QSE-F1 strain

[0045] 1. Strain morphological identification: The QSE-F1 strain was inoculated onto PDA medium and cultured at 28 °C. The formed colonies were flat, villous, thick in the middle and thin at the edges; the surface of the colonies was initially milky white and gradually turned light yellow with the increase of culture time. Spores began to be produced after 5 - 7 days, and the surface of the colonies was powdery milky white; The aerial hyphae of QSE-F1 were picked and observed under a microscope. The hyphae were colorless, transparent and septate, with a diameter of about 1.73 ± 0.27 μm; The conidia were mostly spherical and oval, with sizes of about 1.52 ± 0.17μm - 3.52 ± 0.23 μm.

[0046] 2. Molecular identification: The genomic DNA of the QSE-F1 strain was extracted and used as a template for PCR amplification; The PCR reaction system was as follows: 5×TransStart R FastPfu Buffer 10 μl; 10 mM dNTP mix 1 μl; Template 2 μl; Primer-F (10 μM) 1 μl; Primer-R (10 μM) 1 μl; TransStart R FastPfu DNA polymerase 1μl; ddH2 O 34 μl; Total 50 μl. The PCR reaction program was as follows: Pre-denaturation at 95 °C for 5 min; Denaturation at 95 °C for 30 s; Annealing at 58 °C for 30 s; Extension at 72 °C for 40 s; Final extension at 72 °C for 5 min; 34 cycles; Hold at 4 °C.

[0047] After the PCR products were run on a gel, the gel was cut and recovered, and the recovered products were sent to a sequencing company for sequencing. The sequences obtained by sequencing were respectively compared with the sequences in the NCBI database. The sequence of the strain to be detected had the highest homology with the sequence of Beauveria bassiana. According to the sequence alignment of the gene fragments, a phylogenetic evolution tree was constructed. Through comprehensive analysis, the strain QSE-F1 was identified as Beauveria bassiana.

[0048] The Beauveria bassiana QSE-F1 screened in the present invention was preserved. The preservation unit: China Center for Type Culture Collection; Address: Wuhan University, Wuhan, China; Preservation date: July 22, 2024; The preservation number of Beauveria bassiana QSE-F1 is CCTCC NO: M 20241661.

[0049] Example 2: Design, synthesis and effect verification of target gene dsRNA

[0050] 1. Design and synthesis of dsRNA fragment of target gene BcPfy

[0051] Download the protein-coding (CDS) sequence (Bcin01g00370.1) of gene BcPfy1 from the database EnsemblFungi (http: / / fungi.ensembl.org / index.html). The full length of this sequence is 393 bp, and the coding sequence is shown as SEQ ID No.1. Since the full length of this sequence is less than 500 bp, the upstream and downstream amplification primers for synthesizing dsRNA were designed with the full length as the template, and the T7 promoter sequence (TAATACGACTCACTATAGGGAGA) was added to the 5` end of the upstream and downstream primers. The amplification primers are shown in Table 1.

[0052] Extract the total RNA of Botrytis cinerea, reverse transcribe to obtain cDNA, and use the cDNA as a template to obtain the synthesis template of dsRNA through PCR amplification, agarose gel electrophoresis, and gel recovery. The sequence is shown as SEQ ID No. 2. Using the plasmid containing the green fluorescent protein (GFP) coding gene as a template, and the upstream and downstream primers added with the T7 promoter sequence, the synthesis template of GFP dsRNA was amplified. The sequence is shown as SEQ ID No. 3, and the primers used are shown in Table 1. Use the dsRNA in vitro synthesis kit to synthesize dsRNA of BcPfy1 and GFP respectively, named BcPfy1-dsRNA and GFP-dsRNA. According to the instructions in the kit, the T7 promoter starts transcription from the first guanine (G) after the core recognition sequence. That is, the sequence of BcPfy1-dsRNA obtained by in vitro transcription is shown as SEQ ID No.4, and the sequence of GFP-dsRNA is shown as SEQ ID No.5. The concentration of dsRNA was measured by a spectrophotometer, and the purity of dsRNA was detected by agarose gel electrophoresis.

[0053] Table 1 dsRNA template amplification primers

[0054]

[0055] BcPfy1 gene (SEQ ID No.1):

[0056] ATGTCGTGGCAGGCTTATATCGACACAAGTCTTTGCGGAAGCGGACATGTTGAGAAGGGAGCTATTTACAATTTGGAGGGAACCTCTTGCTGGGCCACCAGTCCTGATTTTGCGATCACCCCTGAAGAAATGGCTGAGGTCAAAAACGGACTTGATGGTAAAACAGACAGTCTATACGCAAATGGTTTACATATTGCAAAGGATAGATATGTTCTTACAAAGGTGGAGGATGATAATAAGATGCTCTATGCTAGAAAGGGCAAAGATGGTCTCGTCATCGGTAAAACTGTCCAAGCAATCATCGTAGCCCGATACGTCGACCCAATGATCGCCGGAAACACCGCCGAGACTGTTCAAAAATTGGTCGATTATCTCGTTAAAGTTGGCTACTAA

[0057] BcPfy1-dsRNA synthesis template (SEQ ID No.2):

[0058] TAATACGACTCACTATAGGGAGAATGTCGTGGCAGGCTTATATCGACACAAGTCTTTGCGGAAGCGGACATGTTGAGAAGGGAGCTATTTACAATTTGGAGGGAACCTCTTGCTGGGCCACCAGTCCTGATTTTGCGATCACCCCTGAAGAAATGGCTGAGGTCAAAAACGGACTTGATGGTAAAACAGACAGTCTATACGCAAATGGTTTACATATTGCAAAGGATAGATATGTTCTTACAAAGGTGGAGGATGATAATAAGATGCTCTATGCTAGAAAGGGCAAAGATGGTCTCGTCATCGGTAAAACTGTCCAAGCAATCATCGTAGCCCGATACGTCGACCCAATGATCGCCGGAAACACCGCCGAGACTGTTCAAAAATTGGTCGATTATCTCGTTAAAGTTGGCTACTCTCCCTATAGTGAGTCGTATTA

[0059] GFP-dsRNA synthesis template (SEQ ID No.3):

[0060] TAATACGACTCACTATAGGGAGATCGAACTCGATGGTGACGTCAATGGCCATAAGTTCTCAGTCAGCGGAGAGGGTGAGGGAGACGCTACATATGGTAAATTGACTCTTAAGTTCATCTGCACCACAGGTAAATTGCCTGTACCTTGGCCTACACTCGTCACCACCCTCACCTACGGAGTTCAATGCTTTTCCCGTTACCCAGATCACATGAAACAACATGACTTTTTCAAGTCTGCAATGCCAGAGGGATATGTCCAAGAGAGAACAATCTTCTTTAAGGATGACGGAAATTATAAGACTCGTGCCGAGGTTAAGTTCGAGGGTGATACTCTCGTCAACCGTATTGAGTTGAAGGGCATCGATTTCAAGGAAGACGGAAATATCCTCGGCCATAAGCTTGAATACAACTACAACAGTCACAACGTTTATATCATGGCCGACAAGCAAAAAAATGGAATCAAGGTCAACTTCAAAATCAGACACAACATTGAGGATGGCTCTGTTCAATTGGCAGATCACTACCAACAGAATACTCTCCCTATAGTGAGTCGTATTA。

[0061] BcPfy1-dsRNA sequence (SEQ ID No.4)

[0062] GAGAAUGUCGUGGCAGGCUUAUAUCGACACAAGUCUUUGCGGAAGCGGACAUGUUGAGAAGGGAGCUAUUUACAAUUUGGAGGGAACCUCUUGCUGGGCCACCAGUCCUGAUUUUGCGAUCACCCCUGAAGAAAUGGCUGAGGUCAAAAACGGACUUGAUGGUAAAACAGACAGUCUAUACGCAAAUGGUUUACAUAUUGCAAAGGAUAGAUAUGUUCUUACAAAGGUGGAGGAUGAUAAUAAGAUGCUCUAUGCUAGAAAGGGCAAAGAUGGUCUCGUCAUCGGUAAAACUGUCCAAGCAAUCAUCGUAGCCCGAUACGUCGACCCAAUGAUCGCCGGAAACACCGCCGAGACUGUUCAAAAAUUGGUCGAUUAUCUCGUUAAAGUUGGCUACUCUC

[0063] GFP-dsRNA sequence (SEQ ID No.5)

[0064] GAGAUCGAACUCGAUGGUGACGUCAAUGGCCAUAAGUUCUCAGUCAGCGGAGAGGGUGAGGGAGACGCUACAUAUGGUAAAUUGACUCUUAAGUUCAUCUGCACCACAGGUAAAUUGCCUGUACCUUGGCCUACACUCGUCACCACCCUCACCUACGGAGUUCAAUGCUUUUCCCGUUACCCAGAUCACAUGAAACAACAUGACUUUUUCAAGUCUGCAAUGCCAGAGGGAUAUGUCCAAGAGAGAACAAUCUUCUUUAAGGAUGACGGAAAUUAUAAGACUCGUGCCGAGGUUAAGUUCGAGGGUGAUACUCUCGUCAACCGUAUUGAGUUGAAGGGCAUCGAUUUCAAGGAAGACGGAAAUAUCCUCGGCCAUAAGCUUGAAUACAACUACAACAGUCACAACGUUUAUAUCAUGGCCGACAAGCAAAAAAAUGGAAUCAAGGUCAACUUCAAAAUCAGACACAACAUUGAGGAUGGCUCUGUUCAAUUGGCAGAUCACUACCAACAGAAUACUCUC。

[0065] 2. Verification of the effect of dsRNA on controlling Botrytis cinerea

[0066] Prepare a conidial suspension of Botrytis cinerea (10 6 cfu), divide it into two parts, and add BcPfy1-dsRNA and GFP-dsRNA with a final concentration of 200 μg / ml respectively. Select 4-week-old tomato seedlings with consistent growth, take 20 leaves and randomly divide them into 2 groups, with 10 tomato leaves in each group, and place them on moist filter paper. Respectively suck the spore suspensions containing BcPfy1-dsRNA and GFP-dsRNA, inoculate them onto the tomato leaves, and drop 6 μl of conidial suspension on each leaf. Keep it moist for 60 - 96 h, observe the infection situation of Botrytis cinerea, measure the diameter of the lesions by the cross method, and statistically analyze the lesion areas on the two groups of leaves. Take leaves of the same size containing lesions, extract total DNA, and detect the biomass of Botrytis cinerea in the leaves by fluorescence quantitative PCR. Extract the total RNA of Botrytis cinerea on the lesions, reverse transcribe to obtain cDNA, and detect the mRNA level of the target gene BcPfy1 by fluorescence quantitative PCR.

[0067] The results are as Figure 1 shown. In the group added with BcPfy1-dsRNA, the leaf lesions were significantly smaller than those in the group added with GFP-dsRNA; the biomass of Botrytis cinerea on the leaf lesions in the group added with BcPfy1-dsRNA was significantly lower than that on the leaves in the group added with GFP-dsRNA, indicating that BcPfy1-dsRNA has a significant control effect on Botrytis cinerea; adding BcPfy1-dsRNA resulted in a significant decrease in the mRNA level of the target gene BcPfy1 of Botrytis cinerea, indicating that BcPfy1-dsRNA can effectively interfere with the expression of the target gene.

[0068] Example 3: Preparation of the engineered Beauveria bassiana strain Bb-dsPfy1 expressing dsRNA

[0069] 1. Construction of plasmids containing dsRNA expression frameworks

[0070] Using the dsRNA coding genes of GFP or BcPfy1 as the arm sequences, and the first intron of the endogenous gene BcTubulin (Bcin01g08040) of Botrytis cinerea as the central sequence, and the central sequence is shown in SEQ ID No.6. Connect the arm sequences to both ends of the central sequence in the forward and reverse directions respectively to construct the expression framework of the target gene dsRNA. The specific structure is as Figure 2 shown. The dsRNA expression framework sequence of BcPfy1 is shown in SEQ ID No.7, and the dsRNA expression framework sequence of GFP is shown in SEQ IDNo.8.

[0071] The BcPfy1-dsRNA expression cassette and the GFP-dsRNA expression cassette were respectively ligated to the multiple cloning site (MCS) of the pDHt-Bar vector containing the constitutive promoter oliC suitable for Beauveria bassiana. The map of the pDHt-Bar vector is as Figure 3 shown, and the sequence is as shown in SEQ ID No. 9. The pDHt-Bar vector contains a herbicide resistance gene (Bar), which can be used as a selection marker to screen transformants.

[0072] Central sequence (SEQ ID No.6):

[0073] GTATGTATTCCTCTCTCTTCATTTACGATTTCTACGCCTTCTTGCAAGACGCGTCGACTTTACCCCTGAAAAGCACCCCACTATATATTTTTTAAAAGTAACATATCGCTGACCAAGTAACTTTTCAATCTACAG

[0074] BcPfy1-dsRNA expression cassette (SEQ ID No.7):

[0075] ATGTCGTGGCAGGCTTATATCGACACAAGTCTTTGCGGAAGCGGACATGTTGAGAAGGGAGCTATTTACAATTTGGAGGGAACCTCTTGCTGGGCCACCAGTCCTGATTTTGCGATCACCCCTGAAGAAATGGCTGAGGTCAAAAACGGACTTGATGGTAAAACAGACAGTCTATACGCAAATGGTTTACATATTGCAAAGGATAGATATGTTCTTACAAAGGTGGAGGATGATAATAAGATGCTCTATGCTAGAAAGGGCAAAGATGGTCTCGTCATCGGTAAAACTGTCCAAGCAATCATCGTAGCCCGATACGTCGACCCAATGATCGCCGGAAACACCGCCGAGACTGTTCAAAAATTGGTCGATTATCTCGTTAAAGTTGGCTACTAAAAGCTTGTATGTATTCCTCTCTCTTCATTTACGATTTCTACGCCTTCTTGCAAGACGCGTCGACTTTACCCCTGAAAAGCACCCCACTATATATTTTTTAAAAGTAACATATCGCTGACCAAGTAACTTTTCAATCTACAGCTCGAGTTAGTAGCCAACTTTAACGAGATAATCGACCAATTTTTGAACAGTCTCGGCGGTGTTTCCGGCGATCATTGGGTCGACGTATCGGGCTACGATGATTGCTTGGACAGTTTTACCGATGACGAGACCATCTTTGCCCTTTCTAGCATAGAGCATCTTATTATCATCCTCCACCTTTGTAAGAACATATCTATCCTTTGCAATATGTAAACCATTTGCGTATAGACTGTCTGTTTTACCATCAAGTCCGTTTTTGACCTCAGCCATTTCTTCAGGGGTGATCGCAAAATCAGGACTGGTGGCCCAGCAAGAGGTTCCCTCCAAATTGTAAATAGCTCCCTTCTCAACATGTCCGCTTCCGCAAAGACTTGTGTCGATATAAGCCTGCCACGACAT

[0076] GFP-dsRNA expression frame (SEQ ID No.8):

[0077]

[0078] 2. Transformation of Beauveria bassiana strain QSE-F1 with plasmids containing dsRNA expression cassettes

[0079] Plasmids containing GFP-dsRNA and BcPfy1-dsRNA expression cassettes were separately transferred into Agrobacterium tumefaciens strain AGL1. Then, the dsRNA expression cassettes were transferred into Beauveria bassiana strain QSE-F1 using the ATMT technique, and positive transformants were screened on resistance plates containing the herbicide (Basta). The target genes in the transformants were verified by PCR. The results were as follows Figure 4 shown. Bands of the same size as those on the plasmids were detected in different transformants, while no bands were detected in the wild-type QSE-F1 strain, indicating that the dsRNA expression cassettes were successfully transferred into the chassis strain. The chassis strains containing GFP-dsRNA and BcPfy1-dsRNA expression cassettes were named engineered strains Bb-dsGFP and Bb-dsPfy1, respectively.

[0080] 3. Detection of dsRNA expression in engineered strain Bb-dsPfy1

[0081] Total RNA was separately extracted from the wild-type QSE-F1 strain, Bb-dsGFP strain, and Bb-dsPfy1 strain of Beauveria bassiana. The dsRNA in the total RNA was detected using a dsRNA antibody (J2) through a dot blot experiment. The results were as follows Figure 5 shown. dsRNA was detected in the Bb-dsGFP and Bb-dsPfy1 strains, while no dsRNA was detected in the QSE-F1 strain, indicating that the two strains could successfully express dsRNA. The total RNA was reverse transcribed to obtain cDNA, and the target genes GFP and BcPfy1 were detected by fluorescence quantitative PCR. The results were as follows Figure 6 shown. Compared with the QSE-F1 strain, the Cq values for amplifying GFP in the Bb-dsGFP strain and BcPfy1 in the Bb-dsPfy1 strain were significantly reduced, indicating that the total RNA of the two engineered strains contained the RNA of the target genes.

[0082] Example 4: Application of the biocontrol engineered strain Bb-dsPfy1 in controlling Botrytis cinerea

[0083] 1. In vitro experiment on the control of tomato Botrytis cinerea by the engineered strain Bb-dsPfy1

[0084] The engineered strains Bb-dsGFP and Bb-dsPfy1 were inoculated into YEPD liquid medium and cultured with shaking at 25 °C and 180 rpm for 4 days. The culture broth was filtered through three layers of wiped paper to remove the mycelium, the spores in the filtrate were counted, and diluted with water to a spore concentration of 106 -10 7 cfu / ml to prepare a spore suspension of the engineered strain. The original fermentation broth needs to be diluted about 2 - 4 times, that is, the concentration of the fermentation broth is about 25 - 50%. Prepare a Botrytis cinerea conidia suspension (10 6 cfu), and mix it with the spore suspensions of the two engineered strains in equal volume. Select 4-week-old tomato seedlings with consistent growth, take 20 leaves and randomly divide them into 2 groups, with 10 tomato leaves in each group, and place them on moist filter paper. According to the method in Example 1, inoculate the tomato leaves, statistically analyze the lesion area, detect the biomass of Botrytis cinerea in the leaves, and detect the mRNA level of the Botrytis cinerea target gene. The results are as Figure 7 shown. Compared with the addition of the Bb-dsGFP spore suspension, the addition of the engineered strain Bb-dsPfy1 spore suspension significantly inhibited the occurrence of gray mold, significantly reduced the biomass of Botrytis cinerea on the lesions, and the mRNA level of the Botrytis cinerea target gene BcPfy1 was significantly decreased.

[0085] 2. Pot experiment of the engineered strain Bb-dsPfy1 in controlling tomato gray mold

[0086] Select 6 - 8-week-old potted tomato plants with consistent growth, and evenly spray the spore suspension of the engineered strain prepared by the above method on the whole plant. Each spore suspension of the engineered strain is used to treat 9 plants. Let it dry naturally for 12 h, take 6 μl of the Botrytis cinerea conidia suspension (10 6 cfu) and drop it onto the tomato leaves, and continue to culture it in a light incubator with a humidity above 85%. After 4 days of culture, observe the disease occurrence of the two groups of plants, and grade them according to the severity of leaf disease. The least diseased is grade I, and the most diseased is grade VI. The grading standard is as Figure 8 shown.

[0087] Statistically analyze the grading of diseased leaves of the two groups of tomato plants. The results are as Figure 8 shown. For the plants treated with the Bb-dsPfy1 spore suspension of the engineered strain, the most common leaf disease grade is grade III (35%), followed by grade IV (31%), and the proportion of grade VI diseased leaves is 0. The proportion of the first 3 grades exceeds 62%; while for the plants treated with the Bb-dsGFP spore suspension of the engineered strain, the most common leaf disease grade is grade VI (30%), and the proportion of the first 3 grades is only 43%. The results show that the treatment of tomato plants with the engineered strain Bb-dsPfy1 has a significant inhibitory effect on the occurrence of gray mold.

[0088] Based on all the above results, the dsRNA designed with the key gene BcPfy1 of Botrytis cinerea as the target can effectively inhibit the expression of the target gene, thereby suppressing the occurrence of gray mold; the engineered strain Bb-dsPfy1 obtained can express the dsRNA of the target gene, and has a significant control effect on the occurrence of tomato gray mold, and can be developed into a biocontrol agent as a biocontrol engineering strain for the effective prevention and control of tomato gray mold.

[0089] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, for those of ordinary skill in the art, it is still possible to modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions required to be protected by the present invention.

Claims

1. Application of the BcPfy1 gene in regulating the pathogenicity of Botrytis cinerea, characterized in that: The coding sequence of the BcPfy1 gene is shown in SEQ ID No. 1, and the regulation is to inhibit the occurrence of gray mold and reduce the pathogenicity of gray mold by inhibiting the expression of the BcPfy1 gene.

2. A dsRNA targeting the BcPfy1 gene, characterized in that: The nucleotide sequence of the dsRNA synthetic template is shown as SEQ ID No.2, and the sequence of the dsRNA is shown as SEQ ID No.

4.

3. An engineered strain of Beauveria bassiana Bb-dsPfy1 expressing dsRNA, characterized in that: The engineered strain Bb-dsPfy1 is obtained by transferring a dsRNA expression framework capable of interfering with the expression of the target gene BcPfy1 into Beauveria bassiana, the coding sequence of the target gene BcPfy1 is shown in SEQ ID No.1, and the dsRNA expression framework sequence is shown in SEQ ID No.7; the Beauveria bassiana is a QSE-F1 strain, which is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M 20241661.

4. The engineered strain of Beauveria bassiana Bb-dsPfy1 according to claim 3, characterized in that: The construction method of the engineering strain Bb-dsPfy1 comprises the following steps: (1) Constructing a dsRNA expression framework consisting of arm sequences with the same sequence at both ends and opposite directions and a central sequence in the middle that serves as a connector; (2) connecting the dsRNA expression framework to a plasmid suitable for transfer into Beauveria bassiana to construct a plasmid containing the dsRNA expression framework; (3) The successfully constructed plasmid containing the dsRNA expression framework is transferred into the Agrobacterium tumefaciens strain, and then the dsRNA expression framework is transferred into Beauveria bassiana. Positive transformants are screened using a resistance plate containing herbicide to obtain the engineered bacteria Bb-dsPfy1 strain; the Beauveria bassiana is a QSE-F1 strain, which is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: M 20241661.

5. The engineered strain of Beauveria bassiana Bb-dsPfy1 according to claim 4, characterized in that: The arm sequence is the coding sequence of the target gene BcPfy1, and the sequence is shown in SEQ ID No.1; the central sequence is shown in SEQ ID No.6, and the sequence of the dsRNA expression framework targeting the BcPfy1 gene is shown in SEQ ID No.

7.

6. Use of the dsRNA targeting the BcPfy1 gene according to claim 2 in preventing and controlling gray mold.

7. Use of the engineered strain Bb-dsPfy1 according to claim 3 in preventing and controlling gray mold.

8. The use according to claim 7, characterized in that: The application is to evenly spray the spore suspension of the engineering strain Bb-dsPfy1 on the entire plant.

9. The use according to claim 8, characterized in that: The preparation method of the spore suspension of the engineered strain Bb-dsPfy1 is as follows: the engineered strain is inoculated into a YEPD liquid culture medium and shaken for culture, the culture medium is filtered through filter paper to remove the mycelium, and the spore concentration of the engineered strain Bb-dsPfy1 is obtained to be 10 6 -10 7 cfu / ml of spore suspension.

Citation Information

Patent Citations

  • Bacillus velezensis QSE-21 for improving gray mold resistance of tomatoes and application of bacillus velezensis QSE-21

    CN112029686A