Method for increasing yield of L-histidine by strengthening escherichia coli C1 metabolic pathway

Abstract

The invention belongs to the technical field of biochemical engineering, and provides a method for increasing the yield of L-histidine by strengthening a metabolic pathway of escherichia coli C1. The content of a cofactor fTHF in cells is increased by increasing supply of C1 in escherichia coli, namely up-regulating expression of FolD, so that the yield and the yield of L-histidine are remarkably increased. The invention provides a new strategy for improving the fermentation level of L-histidine.

Description

Technical Field

[0001] The invention belongs to the technical field of biochemical engineering, and in particular relates to a method for increasing the yield of L-histidine by strengthening the metabolic pathway of Escherichia coli C1. Background Art

[0002] L-histidine is one of the 20 standard amino acids. It is a semi-essential amino acid for humans and an essential amino acid for some animals. L-histidine has the following functions: it can synthesize carbohydrates, form proteins and fats, transform into antibodies, hormones, creatine, nucleic acids and other ammonia-containing substances, oxidize into water, urea and carbon dioxide, produce energy, etc. It can also participate in immune regulation, clean up oxides in the metabolic process, participate in the formation of cell components, etc. Histidine also has the effects of protecting the heart, treating anemia and preventing osteoporosis. Therefore, L-histidine is widely used in various fields such as food and medicine. At present, the main production methods of L-histidine are protein hydrolysis, chemical synthesis and microbial fermentation. Compared with the first two preparation methods, microbial fermentation has the advantages of mild reaction conditions, high product purity and environmental friendliness, and is the preferred method for industrial production of L-histidine. Summary of the invention

[0003] The object of the present invention is to provide a method for increasing the production of L-histidine by strengthening the metabolic pathway of Escherichia coli C1.

[0004] The present invention is conceived as follows: In Escherichia coli, the production process of L-histidine uses glucose as a raw material, adenosine triphosphate (ATP) and 5-phosphoribosyl pyrophosphate (PRPP) as precursors, and undergoes ten steps of enzyme-catalyzed reactions to ultimately form L-histidine. The biosynthetic pathway of L-histidine is unique for amino acids because it is closely intertwined with other pathways such as purine biosynthesis and C1 metabolism. The C1 metabolic pathway provides two 10-formyltetrahydrofolate (fTHF) molecules as cofactors for the de novo synthesis of purines, so C1 supply is an important target for L-histidine production. In Escherichia coli, the bifunctional methylenetetrahydrofolate dehydrogenase / hydrolase (FolD, represented by folD FolD (encoded by FolD) catalyzes the interconversion of 5,10-methylenetetrahydrofolate (mTHF) and fTHF. Upregulation of FolD is expected to increase the supply of cofactor fTHF, thereby further improving the production and yield of L-histidine.

[0005] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides folD Application of genes in increasing the production of L-histidine in Escherichia coli; in, folD gene encoding methylenetetrahydrofolate dehydrogenase / hydrolase (i.e., bifunctional methylenetetrahydrofolate dehydrogenase / hydrolase, FolD); Escherichia coli folD The nucleotide sequence of the gene is: i) the nucleotide sequence shown in SEQ ID NO: 3; ii) a nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO: 3 and the nucleotide sequence expresses a protein with the same function; iii) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:3 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS at 65°C, and the membrane is washed with the solution; or iv) a nucleotide sequence that has more than 90% homology with the nucleotide sequence of i), ii) or iii) and expresses a protein with the same function.

[0006] Furthermore, by enhancing (upregulating) folD The expression of the gene was used to increase the production of L-histidine in Escherichia coli.

[0007] In the present invention, the method of enhancing gene expression can be selected from the following 1) to 6), or an optional combination: 1) by introducing a plasmid carrying the gene; 2) by increasing the copy number of the gene on the E. coli chromosome; 3) by changing the promoter sequence of the gene on the chromosome of E. coli; 4) by operably linking a strong promoter (such as Ptrc promoter, SEQ ID NO: 2) to the gene; 5) by introducing enhancers; 6) Enhanced by using genes or alleles encoding high activity of the corresponding enzyme or protein.

[0008] In a second aspect, the present invention provides an engineered Escherichia coli with high L-histidine production, wherein the engineered bacterium is produced by genetic engineering by enhancing (upregulating) the expression of folD constructed by the expression of genes.

[0009] The Escherichia coli is an Escherichia coli capable of producing histidine, and expresses the gene fragment shown in SEQ ID NO: 4 hisGDCBHAFI ( hisGDCBHAFI Is hisG , hisD , hisC , hisB , hisH , hisA , hisF , hisI A gene cluster consisting of eight genes) or expression hisG , hisD , hisC , hisB , hisH , hisA , hisF , hisI At least one gene in hisG , hisD , hisC , hisB , hisH , hisA , hisF , hisI The Gene IDs are 946549, 946531, 946551, 946552, 946544, 946521, 946516, and 946515 respectively.

[0010] In a specific embodiment of the present invention, the method for constructing the engineered bacteria comprises the following steps: (1) Using the genome of Escherichia coli MG1655 as a template, folD -UF (5′-ttggtactggatgcaatggc-3′) and folD -UR (5′-ctccttcttaaacattatacgagccggatgattaattgtcaaagcgacctcttgcgaagg-3′) was used as primer for PCR to obtain the gene fragment folD -UP is about 750 bp and the PCR product is purified; the genome of Escherichia coli MG1655 is used as a template, folD -DF(5′-ccggctcgtataatgtttaagaaggagatatacatatggcagcaaagattattgacgg-3′) and folD -DR (5′-gcgtcttcaaacacgacgtc-3′) was used as primer for PCR to obtain the gene fragment folD -DOWN about 750bp and PCR product purification; folD -UP, folD -DOWN to perform overlapping PCR to obtain the target fragment; (2) Plasmid pTarget was used as template (Jiang, Y., Chen, B., Duan, CL, Sun, BB, Yang, JJ, and Yang, S. (2015) Multigene editing in the Escherichia coligenome via the CRISPR-Cas9 system. Applied and Environmental Microbiology, 81: 2506–2514, purchased from Addgene) and primers folD -N20-F (5′-tcctaggtataatactagtcgcctattttgtcagaagcggttttagagctagaaatagc-3′) and folD -N20-R (5′-actagtattatacctaggactgagctagctgtcaag-3′) was amplified to obtain pTarget- folD Linearize the plasmid, pTarget- folD The linear plasmid was transformed into DH5α competent cells for self-ligation to obtain the pTarget- folD Positive transformants of plasmid; (3) Place the targeting fragment and plasmid pTarget- folD and plasmid pCas9 (Jiang, Y., Chen, B., Duan,CL, Sun, BB, Yang, JJ, and Yang, S. (2015). Multigene editing in theEscherichia coli genome via the CRISPR-Cas9 system. Applied and EnvironmentalMicrobiology, 81: 2506–2514, purchased from Addgene) were co-transformed into Escherichia coli MG1655, and the recombinant bacteria were named MG1655-Ptrc- folD ; (4) Using the genome of Escherichia coli MG1655 as a template and primers hisG-F (5′-atgttgaaaatcgctgtcccaaacaaaggctcg-3′) and hisI-R (5′-tcactgatgccgtttacgcaggttctcaattaccgtcgtt-3′) as primers, PCR was performed to obtain the gene fragment hisGDCBHAFI (hisGDCBHAFI is a histidine operon. Constructing the histidine operon expression plasmid pTrc99a-hisGDCBHAFI and introducing it into Escherichia coli MG1655 can obtain the histidine-producing strain MG1655 / pTrc99a-hisGDCBHAFI, so that histidine can be detected in the fermentation broth). The gene fragment was ligated into the vector pTrc99a (Budiardjo, SJ, Stevens, JJ, Calkins, AL, Ikujuni, AP, Wimalasena, VK, Firlar, E., Case, DA, Biteen, JS, Kaelber, JT,&Slusky, JSG (2022). Colicin E1 opens its hinge to plug TolC. eLife, 11, e73297, purchased from Addgene), the obtained recombinant plasmid was named pTrc99a-hisGDCBHAFI; (5) Transform the recombinant plasmid pTrc99a-hisGDCBHAFI into the strain MG1655-Ptrc- folD The obtained recombinant bacteria were named MG1655-Ptrc- folD / pTrc99a-hisGDCBHAFI, an engineered Escherichia coli bacterium with high L-histidine production.

[0011] In another specific embodiment of the present invention, the method for constructing the engineered bacteria comprises the following steps: (1) Using the genome of Escherichia coli MG1655 as a template and primers hisG-F (5′-atgttgaaaatcgctgtcccaaacaaaggctcg-3′) and hisI-R (5′-tcactgatgccgtttacgcaggttctcaattaccgtcgtt-3′) as primers, PCR was performed to obtain the gene fragment hisGDCBHAFI, which was then ligated to the vector pTrc99a. The resulting recombinant plasmid was named pTrc99a-hisGDCBHAFI. (2) The recombinant plasmid pTrc99a-hisGDCBHAFI was transformed into Escherichia coli MG1655, and the obtained recombinant bacteria were named MG1655 / pTrc99a-hisGDCBHAFI; (3) Using the genome of Escherichia coli MG1655 as a template, folD -F(5′-ggaattgtgagcggataacaaatggcagcaaagattattgacg-3′) and folD -R (5′-atccttactcgagtttggatccttactcatcctgtggatcatgatat-3′) was used as primer for PCR to obtain the gene fragment folD The gene fragment was connected to the vector pBbA1k (Lee, TS, Krupa, RA, Zhang, F., Hajimorad, M., Holtz, WJ, Prasad, N., Lee, SK, & Keasling, JD (2011). BglBrick vectors and datasheets: A synthetic biology platform for gene expression. Journal of Biological Engineering, 5, 12, purchased from Addgene), and the obtained recombinant plasmid was named pBbA1k- folD ; (4) Recombinant plasmid pBbA1k- folD Transformed into strain MG1655 / pTrc99a-hisGDCBHAFI, the obtained recombinant strain was named MG1655 / pTrc99a-hisGDCBHAFI pBbA1k- folD , that is, an engineered Escherichia coli that produces high L-histidine.

[0012] Preferably, the method for transforming E. coli is electroporation.

[0013] More preferably, the electric shock conditions are voltage 2.5 KV, resistance 200Ω, and capacitance 25 μF (the width of the electric shock cup is 2 mm).

[0014] In a third aspect, the present invention provides the use of the engineered bacteria in fermentation production of L-histidine or in increasing the fermentation yield of L-histidine.

[0015] In a fourth aspect, the present invention provides a method for increasing the production of L-histidine by strengthening the metabolic pathway of Escherichia coli C1. The method for strengthening the metabolic pathway of Escherichia coli C1 is to strengthen folD Gene expression.

[0016] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: The present invention provides a method for increasing the supply of C1 in Escherichia coli, by up-regulating the expression of FolD, so that the fTHF content in the cell is increased (increasing the supply of fTHF), and compared with the starting strain, the yield and yield of L-histidine are increased by 80.95% and 8.5% respectively. The present invention provides a new strategy for improving the fermentation level of L-histidine. DETAILED DESCRIPTION

[0017] The invention provides a method for improving the supply of C1 in Escherichia coli, and the fTHF content in the cell is increased by up-regulating the expression of FolD, thereby significantly improving the production and yield of L-histidine.

[0018] The present invention adopts the following technical solution: The present invention promotes the production and yield of L-histidine by up-regulating the expression of FolD and increasing the intracellular cofactor fTHF. The method comprises: (1) up-regulating the expression of the bifunctional methylenetetrahydrofolate dehydrogenase / hydrolase FolD in Escherichia coli; (2) fermenting and culturing the strain to detect the growth of the bacteria and the production of L-histidine.

[0019] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0020] Example 1 Escherichia coli folD The original promoter of In this example, the original promoter (sequence shown in SEQ ID NO: 1) of the bifunctional methylenetetrahydrofolate dehydrogenase / hydrolase FolD of Escherichia coli MG1655 ATCC 700926 was replaced with the Ptrc promoter (sequence shown in SEQ ID NO: 2).

[0021] The genome of Escherichia coli MG1655 was used as a template. folD -UF (ttggtactggatgcaatggc) and folD -UR (ctccttcttaaacattatacgagccggatgattaattgtcaaagcgacctcttgcgaagg) was used as primer for PCR to obtain the gene fragment folD -UP was about 750 bp and the PCR product was purified. The genome of Escherichia coli MG1655 was used as a template. folD -DF(ccggctcgtataatgtttaagaaggagatatacatatggcagcaaagattattgacgg) and folD -DR (gcgtcttcaaacacgacgtc) was used as primer for PCR to obtain the gene fragment folD -DOWN about 750bp and PCR product purification. folD -UP, folD -DOWN overlap PCR was performed to obtain the target fragment. Using plasmid pTarget as template and primers folD -N20-F (tcctaggtataatactagtcgcctattttgtcagaagcggttttagagctagaaatagc) and folD -N20-R (actagtattatacctaggactgagctagctgtcaag) was amplified to obtain pTarget- folD . Using an electroporator (Bio-Rad), the targeting fragment and plasmid pTarget- folD The plasmid pCas9 was transformed into Escherichia coli MG1655 by electroporation. The electroporation conditions were 2.5KV, 200Ω, and 25μF (the width of the electroporation cup was 2mm). The recombinant bacteria were screened and named MG1655-Ptrc- folD .

[0022] Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers hisG-F (atgttgaaaatcgctgtcccaaacaaaggctcg) and hisI-R (tcactgatgccgtttacgcaggttctcaattaccgtcgtt) to obtain the gene fragment hisGDCBHAFI, which was then connected to the vector pTrc99a. The resulting recombinant plasmid was named pTrc99a-hisGDCBHAFI. The recombinant plasmid pTrc99a-hisGDCBHAFI was transformed into MG1655 and MG1655-Ptrc99a by electroporation (conditions as above). folD The obtained recombinant strains were named MG1655 / pTrc99a-hisGDCBHAFI and MG1655-Ptrc- folD / pTrc99a-hisGDCBHAFI.

[0023] Example 2 Overexpression using plasmid in E. coli folD Gene In this example, a plasmid was used to overexpress the bifunctional methylenetetrahydrofolate dehydrogenase / hydrolase FolD of Escherichia coli.

[0024] The genome of Escherichia coli MG1655 was used as template and primers folD -F(ggaattgtgagcggataacaaatggcagcaaagattattgacg) and folD -R (atccttactcgagtttggatccttactcatcctgtggatcatgatat) was used for PCR to obtain the gene fragment folD (The sequence is shown in SEQ ID NO: 3), the fragment was connected to the vector pBbA1k, and the obtained recombinant plasmid was named pBbA1k- folD . The recombinant plasmid pBbA1k- folD The recombinant strain was transformed into MG1655 / pTrc99a-hisGDCBHAFI by electroporation (conditions as in Example 1), and the obtained recombinant strain was named MG1655 / pTrc99a-hisGDCBHAFI pBbA1k- folD .

[0025] Example 3 Production of L-histidine by fermentation of recombinant Escherichia coli The recombinant strains MG1655 / pTrc99a-hisGDCBHAFI, MG1655-Ptrc- folD / pTrc99a-hisGDCBHAFI and MG1655 / pTrc99a-hisGDCBHAFI pBbA1k- folD Culture overnight on LB plates. Pick a single colony from the fresh plate and inoculate it into a test tube containing 5 ml LB medium and culture at 37°C, 200 rpm for 12 hours.

[0026] Inoculate 5% of the inoculum into a 500 ml baffled shake flask containing 50 ml of fermentation medium and culture at 37°C and 200 rpm until OD 600 was 0.6, 0.1 mM IPTG was added and cultured for 48 h.

[0027] The fermentation medium formula includes: glucose 20g / L, magnesium sulfate heptahydrate 0.8g / L, diammonium hydrogen phosphate 4g / L, potassium dihydrogen phosphate 6.67g / L, potassium citrate 1.35g / L, 3-morpholinepropanesulfonic acid 20.9g / L, yeast powder 2.5g / L, ferrous sulfate heptahydrate 50mg / L, calcium chloride dihydrate 10mg / L, zinc sulfate heptahydrate 11mg / L, manganese sulfate tetrahydrate 2.5mg / L, copper sulfate pentahydrate 5mg / L, ammonium molybdate 0.5mg / L, sodium borate decahydrate 0.1mg / L.

[0028] During the fermentation process, the product concentration and the growth of the strain were detected by liquid chromatography, and the results are shown in Tables 1 and 2. As can be seen from Tables 1 and 2, after upregulating FolD, the strain MG1655-Ptrc- folD / pTrc99a-hisGDCBHAFI and MG1655 / pTrc99a-hisGDCBHAFI pBbA1k- folD Compared with the control strain MG1655 / pTrc99a-hisGDCBHAFI, the yield and production efficiency of L-histidine were greatly improved without affecting the growth of the bacteria.

[0029] Table 1 Growth of different strains (OD 600 )

[0030] Table 2 L-histidine production of different strains (g / L)

[0031] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. fol Application of genes in increasing the production of L-histidine in Escherichia coli; in, fol gene encoding methylenetetrahydrofolate dehydrogenase / hydrolase; Escherichia coli fol The nucleotide sequence of the gene is: i) the nucleotide sequence shown in SEQ ID NO: 3; ii) a nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO: 3 and the nucleotide sequence expresses a protein with the same function; iii) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:3 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS at 65°C, and the membrane is washed with the solution; or iv) a nucleotide sequence that has more than 90% homology with the nucleotide sequence of i), ii) or iii) and expresses a protein with the same function.

2. The use according to claim 1, characterized in that: By enhancing fol The expression of the gene was used to increase the production of L-histidine in Escherichia coli.

3. The use according to claim 2, characterized in that: The method of enhancing gene expression is selected from the following 1) to 6), or an optional combination: 1) by introducing a plasmid carrying the gene; 2) by increasing the copy number of the gene on the E. coli chromosome; 3) by changing the promoter sequence of the gene on the chromosome of E. coli; 4) by operably linking a strong promoter to the gene; 5) by introducing enhancers; 6) Enhanced by using genes or alleles encoding high activity of the corresponding enzyme or protein.

4. The use according to claim 3, characterized in that: The strong promoter includes the Ptrc promoter.

5. An engineered Escherichia coli strain that produces high L-histidine, characterized in that: The engineered bacteria are obtained by genetic engineering to enhance fol The expression of genes is constructed; The Escherichia coli is an Escherichia coli capable of producing histidine, and expresses the gene fragment shown in SEQ ID NO: 4 hisGDCBHAFI , or express hisG , hisD , hisC , hisB , his , hisA , hisF , hisI at least one gene in in, fol The gene is as described in claim 1.

6. The engineered bacteria according to claim 5, characterized in that The method of enhancing gene expression is selected from the following 1) to 6), or an optional combination: 1) by introducing a plasmid carrying the gene; 2) by increasing the copy number of the gene on the E. coli chromosome; 3) by changing the promoter sequence of the gene on the chromosome of E. coli; 4) by operably linking a strong promoter to the gene; 5) by introducing enhancers; 6) Enhanced by using genes or alleles encoding high activity of the corresponding enzyme or protein.

7. The engineered bacteria according to claim 5 or 6, characterized in that: The strong promoter includes the Ptrc promoter.

8. Use of the engineered bacteria according to any one of claims 5 to 7 in the fermentation production of L-histidine.

9. A method for increasing the production of L-histidine by strengthening the C1 metabolic pathway of Escherichia coli, characterized in that: The method for strengthening the metabolic pathway of Escherichia coli C1 is to enhance fol Gene expression; in, fol The gene is as described in claim 1.

10. The method according to claim 9, characterized in that The method of enhancing gene expression is selected from the following 1) to 6), or an optional combination: 1) by introducing a plasmid carrying the gene; 2) by increasing the copy number of the gene on the E. coli chromosome; 3) by changing the promoter sequence of the gene on the chromosome of E. coli; 4) by operably linking a strong promoter to the gene; 5) by introducing enhancers; 6) Enhanced by using genes or alleles encoding high activity of the corresponding enzyme or protein.

Images