A conjugative transfer method for Lactobacillus crispatus VB250 collected in situ from the vagina of healthy women

Abstract

The present invention relates to the field of biotechnology, and discloses a conjugation transfer method of Lactobacillus crispatus VB250 collected in situ from the vagina of a healthy woman, comprising: lactobacillus culture, donor bacteria culture, co-culture of donor bacteria and lactobacillus, and positive transformant screening, wherein the lactobacillus is selected from one of Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus crispatus and Lactobacillus delbrueckii, preferably Lactobacillus crispatus; the donor bacteria is Escherichia coli. In the co-culture of the donor bacteria and the lactobacillus, the lactobacillus liquid and the donor bacteria liquid are mixed in proportion and inoculated into a conjugation culture medium to obtain a mixed bacterial liquid; the mixed bacterial liquid is aerobically cultured and anaerobically cultured in the conjugation culture medium. The conjugation transfer method provided by the present invention solves the problem of low efficiency of exogenous gene transfer of lactobacillus in the prior art, significantly improves the conjugation transfer efficiency of lactobacillus, and has the characteristics of high efficiency, rapidity and convenience.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a conjugation transfer method of Lactobacillus crispatus VB250 collected in situ from the vagina of a healthy woman. Background Art

[0002] Lactobacillus crispatus ( Lactobacillus crispatus ), a Gram-positive bacillus belonging to the Lactobacillaceae family and the genus Lactobacillus, has no flagella, and its optimal growth temperature is 37°C. It has complex nutritional requirements and can degrade a variety of carbohydrates and produce L- and D-lactic acid isomers, which help maintain the acidic environment of the vagina and inhibit the proliferation of harmful bacteria. Lactobacillus crispatus is a facultative anaerobe, but grows better in an anaerobic environment.

[0003] Lactobacillus crispatus is of great significance in both industrial applications and medicine. At present, the use of synthetic biology technology to transfer vectors carrying exogenous genes into Lactobacillus crispatus has become a research hotspot. Therefore, efficient exogenous gene transfer methods have become a prerequisite for genetic manipulation. Due to the differences in the biochemical properties and molecular composition of strains of different species of Lactobacillus, different strains require different exogenous gene transfer methods. At present, the exogenous gene transfer method of Lactobacillus crispatus is mainly based on electrotransformation. For example, Chinese patent application CN110129249A (application date 2019.05.29) involves the use of lactic acid bacteria constitutive expression plasmid pMG36e to achieve electrotransformation of lactobacillus isolated from the vagina of healthy women. Since Gram-positive bacteria have thick cell walls and rich peptidoglycan content, gene transfer is very difficult and exogenous DNA has difficulty penetrating the cell wall and entering the cell, resulting in low electrotransformation efficiency. Secondly, Gram-positive bacteria that are more sensitive to oxygen, such as Lactobacillus crispatus, will inevitably come into contact with oxygen for a long time during electrotransformation operations. The electrotransformation efficiency may fluctuate due to slight changes in experimental conditions. Therefore, the consistency and repeatability of electrotransformation are generally poor.

[0004] Therefore, improving the efficiency of exogenous gene transfer of Lactobacillus crispatus has important application value for the further application of Lactobacillus crispatus. Summary of the invention

[0005] In order to solve the technical problem of low efficiency of exogenous gene transfer of Lactobacillus crispatus in the prior art, the present invention provides a conjugation transfer method of Lactobacillus crispatus, comprising: lactobacillus culture, donor bacteria culture, co-culture of donor bacteria and lactobacillus, and positive transformant screening.

[0006] The lactobacillus is selected from one of Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus crispatus and Lactobacillus delbrueckii, preferably Lactobacillus crispatus. The Lactobacillus crispatus is a naturally selected strain, a strain selected by a physical or chemical mutagenesis method, or a strain modified by a genetic engineering method; more preferably, Lactobacillus crispatus with a deposit number of CGMCC No. 26574, which was deposited in the General Microbiology Center of the China National Committee for the Preservation and Administration of Microbiological Cultures on February 20, 2023. For a specific description of the strain, refer to the applicant's previous patent application CN202310995709.9 (application date: 2023.08.09) and incorporate it into this article by citation.

[0007] The lactobacillus culture method comprises: inoculating the lactobacillus into an MRS culture medium, and culturing at 30-37°C, anaerobic conditions, and 50-100 rpm until the OD 600 It is 0.4-1.0.

[0008] The MRS medium refers to DeMan, Rogosa and Sharpe medium, and its specific ingredients include: yeast extract, glucose, peptone, beef extract, dipotassium hydrogen phosphate, diammonium hydrogen citrate, sodium acetate, magnesium sulfate, manganese sulfate, and Tween 80;

[0009] According to an embodiment of the present invention, the MRS medium preferably comprises: 0.5% yeast extract, 2% glucose, 1.0% peptone, 1.0% beef extract, 0.2% dipotassium hydrogen phosphate, 0.2% diammonium hydrogen citrate, 0.5% sodium acetate, 0.02% magnesium sulfate, 0.005% manganese sulfate, 0.1% Tween 80, and pH 6.2.

[0010] According to an embodiment of the present invention, the lactobacillus culture method is as follows: streak the Lactobacillus crispatus stored at -80°C on an MRS non-antibiotic plate, place it in an anaerobic box, and culture it at 37°C for 2 days. Transfer a single colony to MRS liquid culture medium, and culture the seed solution overnight at 100 rpm in an anaerobic box at 37°C. Transfer the seed solution to 50 mL MRS liquid culture medium at a 1% inoculation amount, and culture it in an anaerobic box at 37°C at 100 rpm until OD 600 The bacterial solution was centrifuged at 5000 rpm for 10 min, the supernatant was discarded, and the bacteria were resuspended in 3 mL of MRS liquid medium for later use.

[0011] The donor bacteria is Escherichia coli ( Escherichia coli); further, the donor bacteria is Escherichia coli containing an exogenous plasmid. The exogenous plasmid is a broad host plasmid commonly used in the art, including but not limited to pRK404, RSF1010, R388 and pMG160 and their derivative plasmids, such as pIND4, pBBR1MCS2, pRKSK1, pRECTX, pTrc99a, and more preferably pM11 (SEQ ID NO.1) and its derivative plasmids. The Escherichia coli is Escherichia coli ( Escherichia coli )S17-1.

[0012] According to an embodiment of the present invention, the donor bacteria culture and preparation method is:

[0013] 1) Preparation of competent cells: Place the S17 glycerol bacteria stored at -80℃ on ice, streak on LB non-antibiotic plates after thawing, and place the plates in a 37℃ incubator for overnight culture; pick a single colony and inoculate it into LB liquid culture medium, place it in a 37℃ shaker, and culture the overnight seed solution at 220 rpm; transfer 0.1% of the overnight cultured seed solution to 50 mL LB liquid culture medium, and culture it at 37℃, 220 rpm for 2-6 h until the OD600 is 0.4-1.0; transfer the bacterial solution to a 50 mL sterile centrifuge tube and let it stand on ice for 10 min; place the centrifuge tube in a 4℃ precooled centrifuge and centrifuge at 5000 rpm for 10 min; discard the supernatant, resuspend the cells with 10 mL precooled 0.1 M CaCl2 solution, and let it stand on ice for 30 min; place it in a 4℃ precooled centrifuge and centrifuge at 5000 rpm for 10 min; discard the supernatant, add 2 mL precooled 0.1 Gently resuspend the cells in CaCl2 solution and dispense 100 μL / tube on ice. The competent cells used at the time should always be kept on ice, and other competent cells should be stored at -80℃.

[0014] 2) Electroporation of competent cells: Add 2.5 μL of pM11-GFP plasmid (SEQ ID NO.2) to the competent cells, mix well by pipetting gently, transfer to a pre-cooled electroporation cup, and let stand on ice for 10 min; the pM11-GFP (SEQ ID NO.2) is a plasmid constructed independently by our laboratory; wipe the electrode of the electroporation cup dry, put it into the electroporator, set the voltage to 2.0 kV, add 900 μL of LB liquid culture medium to recover after electroporation, transfer the liquid to a 1.5 mL Eppendorf tube, and recover at 37°C, 220 rpm for 1 h; spread on an LB plate containing 400 μg / mL erythromycin resistance; and culture the plate in a 37°C incubator overnight.

[0015] The donor bacteria culture method is as follows: Escherichia coli is inoculated into LB medium and cultured at 30-37°C and 100-300rpm until OD 600It is 0.4-1.0.

[0016] The "LB medium" refers to "Luria-Bertani medium", which is basically composed of: tryptone, yeast extract, NaCl; preferably: tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH 7.0.

[0017] The co-culturing of the donor bacteria and the lactobacillus comprises the following steps:

[0018] 1) mixing a lactobacillus liquid and a donor bacterial liquid in a certain proportion and inoculating the mixture into a conjugation medium to obtain a mixed bacterial liquid; the ratio of the donor bacteria to the lactobacillus is 1000:1 to 1:1, preferably 100:1 to 10:1;

[0019] 2) The mixed bacterial liquid is first cultured aerobically in the conjugation medium and then anaerobically.

[0020] According to an embodiment of the present invention, the method for co-culturing the donor bacteria and Lactobacillus is as follows: the mixed bacterial liquid is mixed in proportion, centrifuged, resuspended, inoculated into a conjugation culture medium, aerobically cultured at 30-40°C for 0-1 hour, preferably 0-30 minutes, and then anaerobically cultured to obtain a conjugated bacterial liquid; the ratio is donor bacteria: Lactobacillus = 1000:1-1:1, preferably donor bacteria: Lactobacillus = 100:1-10:1.

[0021] The bonding medium is MRS medium, and its specific ingredients include: 0.5% yeast extract, 2% glucose, 1.0% peptone, 1.0% beef extract, 0.2% dipotassium hydrogen phosphate, 0.2% diammonium hydrogen citrate, 0.5% sodium acetate, 0.02% magnesium sulfate, 0.005% manganese sulfate, 0.1% Tween 80, 2% agar, pH 6.2.

[0022] The positive transformant screening is as follows: after eluting the conjugated bacterial solution, the solution is spread on a screening culture medium for screening and culturing to obtain conjugative transferants.

[0023] The screening medium can use a combination of a series of selective markers. For example, a combination of a resistance marker carried by an exogenous plasmid and nalidixic acid. The screening medium is an MRS double-resistance plate, and the specific ingredients include: 0.5% yeast extract, 2% glucose, 1.0% peptone, 1.0% beef extract, 0.2% dipotassium hydrogen phosphate, 0.2% diammonium hydrogen citrate, 0.5% sodium acetate, 0.02% magnesium sulfate, 0.005% manganese sulfate, 0.1% Tween 80, pH 6.2, sterilized at 121°C for 15 min. On this basis, 10 μg / mL erythromycin (resistance marker carried by the exogenous plasmid) and 50 μg / mL nalidixic acid are added.

[0024] According to a specific embodiment of the present invention, the positive transformant screening is as follows: the bacteria on the MRS double-antibody plate are washed with 1 mL of sterile water, and the stock solution, 10 -1 , 10 -2 Spread on MRS double-resistance plates with erythromycin concentration of 10 μg / mL + 50 μg / mL nalidixic acid. Add to anaerobic bags and culture at 37°C for 3-5 days; select transformants, inoculate on MRS double-resistance plates with 10 μg / mL erythromycin + 50 μg / mL nalidixic acid, add to anaerobic bags, and culture at 37°C for 3-5 days.

[0025] In the present invention, positive transformants are identified by using techniques known to those skilled in the art, such as PCR verification.

[0026] According to a specific embodiment of the present invention, the specific operation of identifying the positive transformant is: pick a single colony into 50 μL of sterile water, grind it three times with a grinder at 65 Hz, 180 s, place it in a 100°C water bath for 10 min, and centrifuge to obtain the supernatant as a template for PCR verification.

[0027] In the present invention, the calculation formula of the junction transition frequency is as follows: f )=N0 / N1

[0028] Where: N0 represents the number of transferred conjugates (CFU / mL); N1 represents the number of recipient bacteria (CFU / mL). BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is the agarose gel electrophoresis pattern of the PCR amplification products of the positive transformants in Example 1 of the present invention;

[0030] Figure 2 This is the agarose gel electrophoresis pattern of the PCR amplification products of the positive transformants in Example 2 of the present invention;

[0031] Figure 3 The conjugation transfer frequencies of different mixing ratios of donor bacteria and recipient bacteria in Example 3 of the present invention;

[0032] Figure 4 is the conjugation transfer frequency at different temperatures in the anaerobic culture of the donor bacteria and Lactobacillus co-culture in Example 4 of the present invention;

[0033] Figure 5 The conjugation transfer frequencies under different co-culture conditions in the co-culture of donor bacteria and Lactobacillus in Example 5 of the present invention are shown. DETAILED DESCRIPTION

[0034] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0035] Example 1 Donor bacteria culture and preparation

[0036] Preparation of Escherichia coli S17 competent cells: Place the S17 glycerol bacteria stored at -80℃ on ice, streak on LB non-antibiotic plates after thawing, and culture the plates in a 37℃ incubator overnight; pick a single colony and inoculate it into LB liquid culture medium, place it in a 37℃ shaker, and culture the overnight seed solution at 220 rpm; transfer 0.1% of the overnight cultured seed solution to 50 mL LB liquid culture medium, and culture it at 37℃, 220 rpm for 2-6 h until the OD 600 The concentration of the culture medium was 0.4-1.0; the bacterial solution was transferred to a 50 mL sterile centrifuge tube and allowed to stand on ice for 10 min; the centrifuge tube was placed in a 4°C precooled centrifuge and centrifuged at 5000 rpm for 10 min; the supernatant was discarded, the cells were resuspended with 10 mL precooled 0.1 M CaCl2 solution and allowed to stand on ice for 30 min; the tube was placed in a 4°C precooled centrifuge and centrifuged at 5000 rpm for 10 min; the supernatant was discarded, 2 mL precooled 0.1 CaCl2 solution was added to gently resuspend the cells, and 100 μL / tube was dispensed on ice. The competent cells used at the time were always placed on ice, and other competent cells were stored at -80°C.

[0037] Plasmid electrotransformation of Escherichia coli S17 competent cells: Add 2.5 μL of pM11-GFP plasmid (SEQ ID NO. 2, erythromycin resistance) to the competent cells, gently pipette to mix, transfer to a pre-cooled electroporation cup, and let stand on ice for 10 min; wipe the electrode of the electroporation cup dry, put it into the electroporator, set the voltage to 2.0 kV, add 900 μL of LB liquid culture medium after electroporation, transfer the liquid to a 1.5 mL Ep tube, and resuscitate in a shaker at 37°C and 220 rpm for 1 h; after resuscitation, spread on an LB solid plate containing 400 μg / mL erythromycin resistance; place the plate in a 37°C incubator for overnight culture.

[0038] Identification of positive transformants The transformants were picked for colony PCR. The PCR amplification system is shown in Table 1:

[0039] Table 1

[0040]

[0041] The PCR amplification program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 10 s, annealing at 58°C for 10 s, and extension at 72°C for 10 s, for 30 cycles; and extension at 72°C for 10 min.

[0042] The primers are as follows:

[0043] F: GTGAATAGCTCACTTATCAG (SEQ ID NO.3);

[0044] R: CATTCCTAATGTAATCCCGG (SEQ ID NO. 4).

[0045] The results are as follows Figure 1 As shown, the amplified product was identified by 1% agarose gel electrophoresis, and its size was 1000 bp, which was consistent with the size of the target fragment. It was then verified as a positive transformant by sequencing.

[0046] Example 2: Lactobacillus crispatus ( Lactobacillus crispatus ) VB250 engagement transfer

[0047] Lactobacillus culture: Streak Lactobacillus crispatus stored at -80℃ on MRS non-antibiotic plates and place in an anaerobic chamber at 37℃ for 2 days. Transfer a single colony to MRS liquid culture medium and culture the seed solution overnight at 100 rpm in an anaerobic chamber at 37℃. Transfer the seed solution to 50 mL MRS liquid culture medium at a 1% inoculum and culture in an anaerobic chamber at 37℃ at 100 rpm until OD 600 It is 0.4-1.0.

[0048] The bacterial solution was centrifuged at 5000 rpm for 10 min, the supernatant was discarded, and the bacteria were resuspended in 3 mL of MRS liquid medium for later use.

[0049] Donor bacteria culture The positive transformants in Example 1 were inoculated into LB liquid and cultured overnight at 37°C, 220 rpm; then transferred to 50 mL LB liquid culture medium at a 1% inoculum and cultured at 37°C, 220 rpm until OD 600 It is 0.4-1.0.

[0050] Co-culture of donor bacteria and Lactobacillus: Pre-cooled donor bacteria (Escherichia coli) and recipient bacteria (Lactobacillus crispatus) were mixed evenly in a ratio of 5:1; the mixed bacterial solution was centrifuged at 5000 rpm for 10 min and the supernatant was discarded; the bacteria were resuspended in MRS liquid culture medium and the volume was fixed to 0.8 mL; the resuspended bacterial solution was evenly spread on the MRS plate in a volume of 200 μL and placed in a 37°C anaerobic incubator for co-culture to obtain the conjugated bacterial solution.

[0051] After 1 day of screening for positive transformants, wash the bacteria off the plate with 1 mL of sterile water and separate the stock solution, 10 -1 , 10 -2 Spread on MRS double-resistance plates with erythromycin concentration of 10 μg / mL + 50 μg / mL nalidixic acid. Add to anaerobic bags and culture at 37°C for 3-5 days; select transformants, inoculate on MRS double-resistance plates with 10 μg / mL erythromycin + 50 μg / mL nalidixic acid, add to anaerobic bags, and culture at 37°C for 3-5 days.

[0052] Identification of positive transformants: Single colonies were picked into 50 μL sterile water, ground three times using a grinder at 65 Hz, 180 s, placed in a 100°C water bath for 10 min, and centrifuged to obtain the supernatant as a template for PCR verification. The PCR amplification system is shown in Table 2:

[0053] Table 2

[0054]

[0055] The PCR amplification procedure and primers used are the same as those in Example 1, namely:

[0056] Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 10 s, annealing at 58°C for 10 s, extension at 72°C for 10 s, 30 cycles; extension at 72°C for 10 min.

[0057] The primers are as follows:

[0058] F: GTGAATAGCTCACTTATCAG (SEQ ID NO.5);

[0059] R: CATTCCTAATGTAATCCCGG (SEQ ID NO. 6).

[0060] The results are as follows Figure 2 As shown, the amplified product was identified by 1% agarose gel electrophoresis, and its size was 1000 bp, which was consistent with the size of the target fragment. It was then verified as a positive transformant by sequencing.

[0061] The calculation formula of the joining transition frequency is:

[0062] Junction transfer frequency ( f )=N0 / N1

[0063] Where: N0 represents the number of transferred conjugates (CFU / mL); N1 represents the number of recipient bacteria (CFU / mL);

[0064] Under this condition, the conjugative transfer frequency of Lactobacillus crispatus was 3.9×10 -7 .

[0065] Example 3: Optimization of the mixing ratio of Lactobacillus and donor bacteria

[0066] In this example, the mixing ratio of the donor bacteria liquid and the recipient bacteria liquid in the co-culture of the donor bacteria and the lactobacillus was adjusted, and the remaining operation steps were consistent with those in Example 2. Finally, the conjugation transfer frequency results were measured as shown in Tables 3 and Figure 3 shown.

[0067] In this embodiment, the steps of co-culturing donor bacteria and lactobacillus are as follows:

[0068] Precooled donor bacteria (Escherichia coli) and recipient bacteria (Lactobacillus crispatus) were mixed evenly in different proportions (see Table 3 for proportions); the mixed bacterial solution was centrifuged at 5000 rpm for 10 min and the supernatant was discarded; the bacteria were resuspended in MRS liquid culture medium and the volume was adjusted to 0.8 mL; the resuspended bacterial solution was evenly spread on the MRS plate in a volume of 200 μL and placed in a 37°C anaerobic incubator for co-cultivation to obtain the conjugated bacterial solution.

[0069] Table 3

[0070]

[0071] It can be seen from this that the optimal mixing ratio of donor bacteria to recipient bacteria in the co-culture of donor bacteria and Lactobacillus is 100:1~10:1.

[0072] Example 4: Optimization of culture temperature for conjugative transfer of Lactobacillus crispatus

[0073] In this example, the strain ratio of donor bacteria and lactobacillus in co-culture and the temperature of anaerobic culture were adjusted, and the remaining operation steps were consistent with those in Example 2. Finally, the conjugation transfer frequency results were measured as shown in Table 4 and Figure 4 shown.

[0074] In this embodiment, the steps of co-culturing donor bacteria and lactobacillus are as follows:

[0075] Pre-cooled donor bacteria (Escherichia coli) and recipient bacteria (Lactobacillus crispatus) were mixed evenly in a ratio of 10:1; the mixed bacterial solution was centrifuged at 5000 rpm for 10 min and the supernatant was discarded; the bacteria were resuspended in MRS liquid culture medium and the volume was adjusted to 0.8 mL; the resuspended bacterial solution was evenly spread on the MRS plate in a volume of 200 μL and placed in an anaerobic box (temperature see Table 4) for co-cultivation to obtain the conjugated bacterial solution.

[0076] Table 4

[0077]

[0078] It can be seen from this that the optimal temperature for anaerobic culture in co-culture of donor bacteria and Lactobacillus is 30~37℃.

[0079] Example 5: Optimization of anaerobic culture time for conjugative transfer of Lactobacillus crispatus

[0080] In this example, the strain ratio and culture conditions in the co-culture of donor bacteria and lactobacillus were adjusted, and the remaining operation steps were consistent with those in Example 2. Finally, the conjugation transfer frequency results were measured as shown in Tables 5 and Figure 5 shown.

[0081] In this embodiment, the steps of co-culturing donor bacteria and lactobacillus are as follows:

[0082] Pre-cooled donor bacteria (Escherichia coli) and recipient bacteria (Lactobacillus crispatus) were mixed evenly in a ratio of 10:1; the mixed bacterial solution was centrifuged at 5000 rpm for 10 min and the supernatant was discarded; the bacteria were resuspended in MRS liquid culture medium and the volume was adjusted to 0.8 mL; the resuspended bacterial solution was evenly spread on the MRS plate in a volume of 200 μL for co-culture (see Table 5 for culture conditions) to obtain the conjugated bacterial solution.

[0083] Table 5

[0084]

[0085] It can be seen from this that the best co-culture condition for donor bacteria and Lactobacillus is aerobic culture at 30°C for 0 to 1 hour, and the better condition is aerobic culture for 0 to 30 minutes, followed by anaerobic culture.

[0086] SEQ ID NO.1

[0087]

[0088] SEQ ID NO. 2

[0089]

[0090] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0091] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and controls can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached claims.

Claims

1. A Lactobacillus crispatus ( Lactobacillus crispatus ) VB250 joint transfer method, including: Lactobacillus culture, donor bacteria culture, co-culture of donor bacteria and lactobacillus, and screening of positive transformants, characterized in that the lactobacillus is Lactobacillus crispatus VB250 with a preservation number of CGMCC No.26574; the donor bacteria is Escherichia coli S17-1 carrying a conjugative transfer plasmid, and the conjugative transfer plasmid is pM11 and its derivative plasmid; the pM11 nucleotide sequence is shown in SEQ ID NO.1; the co-culture of the donor bacteria and lactobacillus comprises the following steps: 1) mixing the donor bacteria and lactobacillus at a ratio of 100:1 to 10:1 and inoculating the mixture in a conjugation medium to obtain a mixed bacterial solution; 2) the mixed bacterial solution is first aerobically cultured in the conjugation medium for 0-30 minutes, and then anaerobically cultured to obtain a conjugated bacterial solution; the screening of positive transformants is to wash the conjugated bacterial solution and then apply it on a screening medium for screening culture.

2. The method for joint transfer according to claim 1, characterized in that: The lactobacillus culture method comprises: inoculating the lactobacillus into an MRS culture medium, and culturing at 30-37°C, anaerobic conditions, and 50-100 rpm until the OD 600 It is 0.4-1.

0.

3. The method for joint transfer according to claim 2, characterized in that: The specific components of the MRS culture medium include: yeast extract, glucose, peptone, beef extract, dipotassium hydrogen phosphate, diammonium hydrogen citrate, sodium acetate, magnesium sulfate, manganese sulfate, and Tween 80.

4. The method for joint transfer according to claim 3, characterized in that: The specific components of the MRS culture medium include: 0.5% yeast extract, 2% glucose, 1.0% peptone, 1.0% beef extract, 0.2% dipotassium hydrogen phosphate, 0.2% diammonium hydrogen citrate, 0.5% sodium acetate, 0.02% magnesium sulfate, 0.005% manganese sulfate, 0.1% Tween 80, pH 6.

2.

5. The method for joint transfer according to claim 1, characterized in that: The donor bacteria culture method is as follows: Escherichia coli is inoculated into LB medium and cultured at 30-37°C and 100-300rpm until OD 600 It is 0.4-1.

0.

6. The method for joint transfer according to claim 5, characterized in that: The specific components of the LB culture medium include: tryptone, yeast extract, and NaCl.

7. The method for joint transfer according to claim 6, characterized in that: The specific components of the LB medium include: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, pH 7.

0.

8. The method for joint transfer according to claim 1, characterized in that: The aerobic culture temperature is 30°C.

9. The method for joint transfer according to claim 1, characterized in that: The anaerobic culture temperature is 30-37°C.

10. The method for joint transfer according to claim 1, characterized in that: The screening medium is an MRS medium containing a resistance screening marker, and the antibiotics of the resistance screening marker are erythromycin and nalidixic acid.

Images