Application of SlMYB78 gene in regulating tomato resistance to Pseudomonas syringae pv. tomato

Abstract

The present invention belongs to the technical field of plant genetic engineering, and specifically relates to tomato SlMYB78 The application of the gene in regulating tomato resistance to Pseudomonas syringae pv. tomato. SlMYB78 The cDNA sequence of the gene is shown in SEQ ID NO. 1; the application method is to silence SlMYB78 Gene, weakened PstDC3000 Pathogen resistance. The present invention uses gene silencing technology to obtain SlMYB78 Gene-silenced transgenic tomato plants and demonstrated SlMYB78 Gene silenced strains PstDC3000 After pathogen infection, the accumulation of phenolamine metabolites and the synthesis of SA were reduced, significantly reducing disease resistance.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology and specifically relates to SlMYB78 Application of genes in regulating tomato resistance to Pseudomonas syringae pv. tomato. Background Art

[0002] tomato( Solanum lycopersicum L. ) is an annual herbaceous plant of the Solanaceae family, native to South America and widely cultivated in both northern and southern China. Due to its agricultural significance, it has become a key model organism for scientific research. During the domestication and improvement of tomatoes, due to the artificial selection of large-fruited tomatoes, some of the excellent traits such as flavor and disease resistance were lost in the process. For example, modern cultivars are resistant to Pseudomonas syringae ( Pseudomonas syringae ) are relatively sensitive to many pathogens, including tomato, and this sensitivity may have an adverse effect on tomato yield and quality.

[0003] Phenolamines are conjugates of hydroxycinnamic acid derivatives and polyamines (PAs), which are biosynthesized by hydroxycinnamoyltransferases (HCTs), which are key enzymes in the initial stage of the phenolamine biosynthetic pathway. In addition, the role of phenolamines in plant defense against biotic stress has been documented. For example, tyramine-derived phenolamines show strong resistance to Xanthomonas in rice. Although there have been many advances in the study of phenolamine biosynthesis pathways and resistance to biotic stress, there is still little research on its regulatory network, which still needs further study.

[0004] Salicylic acid (SA) is a key phytohormone in plant immunity and plays a key role in PstDC3000 Existing studies have revealed that SA and PA interact with each other in plant defense mechanisms, but the synergistic regulatory mechanism of phenolamines and SA during biosynthesis still needs to be further explored.

[0005] Tomato transcription factor SlMYB78 The gene cluster BGC2 associated with diFer-Spd has been published to be significantly associated with the diFer-Spd gene cluster. The Chinese patent application number 202411866276.8, "A bifunctional gene cluster for the biosynthesis of phenolamines and salicylic acid and its application", discloses that the gene cluster BGC2 is associated with the synthesis of phenolamines and SA, and overexpression of the key components of the phenolamine and salicylic acid biosynthesis gene cluster BGC2 SlEPS1 The gene can significantly enhance the accumulation of spermidine derivatives and SA in tomato plants, thereby enhancing Pst DC3000 Therefore, SlMYB78 The role of genes in the coordinated regulation of phenolamines and SA and the disease resistance of tomatoes is crucial. This not only helps to explore the adaptation and regulation mechanism of tomatoes to biotic stress, but also has important significance for improving the stress resistance of tomatoes themselves and meeting human nutritional needs. Summary of the invention

[0006] The technical problem to be solved by the present invention is: to provide a tomato transcription factor SlMYB78 , by positively regulating a bifunctional gene cluster for phenolamine and salicylic acid biosynthesis, the accumulation of phenolamines and SA is increased, ultimately improving the disease resistance of tomatoes.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] The present invention provides a tomato SlMYB78 Genes in regulating tomato resistance Pseudomonas Syringae pv. tomato DC3000 pathogens. In a certain embodiment, the present invention uses a metabolite-based mGWAS analysis method to study varieties with significant differences in phenolamine biosynthesis, and locates the substance diFer-Spd to SlMYB78 The gene of the present invention was obtained by amplifying the tomato cDNA using PCR technology. SlMYB78 Gene, the tomato SlMYB78 The cDNA sequence of the gene is shown in SEQ ID NO. 1;

[0009] The application route is to silence SlMYB78 Gene, weakened Pseudomonas syringae pv. tomato DC3000 pathogen resistance. In one embodiment, the present invention found SlMYB78 The gene regulates a double gene cluster for phenolamine and salicylic acid biosynthesis. This sequence was further constructed into the gene silencing vector RNAi and obtained by genetic transformation. SlMYB78 Gene silencing tomato lines found that the content of phenolamines and SA in tomatoes was reduced, and the transgenic tomato plants were Pseudomonas syringae pv. tomato DC3000 pathogen resistance is weakened.

[0010] Furthermore, the tomato SlMYB78 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.

[0011] The second aspect of the present invention provides the tomato SlMYB78 Genes in regulating tomato resistance Pseudomonas Syringae pv. tomato DC3000 pathogenic bacteria, wherein the application is SlMYB78 The gene positively regulates a phenolamine and salicylic acid biosynthesis double gene cluster, causing phenolamine substances and salicylic acid to accumulate highly in tomatoes, thereby improving the disease resistance of tomatoes; the phenolamine and salicylic acid biosynthesis double gene cluster includes five genes, the five genes are SlEPS1 , SlPBS3 , SlCoAOMT2 , SlCoOOMT3 and SlCoAOMT4 ,in, SlEPS1 The nucleotide sequence of the gene is shown in SEQ ID No.3, SlPBS3 The nucleotide sequence of the gene is shown in SEQ ID No. 4, SlCoAOMT2 The nucleotide sequence of the gene is shown in SEQ ID No. 5. SlCoOOMT3 The nucleotide sequence of the gene is shown in SEQ ID No. 6, SlCoAOMT4 The nucleotide sequence of the gene is shown in SEQ ID No. 7.

[0012] The third aspect of the present invention provides the tomato SlMYB78 Gene in resistance Pseudomonas syringae Application of pv.tomato DC3000 pathogen in tomato breeding.

[0013] Beneficial effects of the present invention:

[0014] The present invention is separated from tomato SlMYB78 The gene was first found to increase the accumulation of phenolamines and SA by positively regulating a bifunctional gene cluster for phenolamine and salicylic acid biosynthesis, thus improving the resistance of tomato plants to Pseudomonas syringae pv. tomato DC3000 pathogen resistance, and explored SlMYB78 The gene's mechanism of coordinated regulation of phenolamines and SA and its role in tomato disease resistance have laid the foundation for using this gene for genetic improvement of tomato resistance, enriched the genetic resources for tomato disease resistance breeding, and provided technical reference for the discovery of related genes in other crops and resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 : Figure 1 A in the figure is the GWAS result diagram of diFer-Spd association; Figure 1 The B in SlMYB78 Evolutionary tree analysis; Figure 1 The C in SlMYB78 Tissue expression profiling analysis; Figure 1 The D in SlMYB78 subcellular localization.

[0016] Figure 2 : Figure 2 A in is the vector map of the entry vector pDONER207; Figure 2 B in the figure is the vector map of the final vector Phis2 (GW); Figure 2 C in the figure is the vector map of the final vector pGADT7 (GW); Figure 2 D in the figure is the vector map of the final vector pH2GW7_dual_LUC.

[0017] Figure 3 : Figure 3 A in the figure is a promoter analysis of a double gene cluster regulating phenolamine and salicylic acid biosynthesis; Figure 3 The B in SlMYB78 Yeast one-hybrid analysis of promoter binding; Figure 3 The C in SlMYB78 Gel shift retardation analysis of promoter binding; Figure 3 The D in SlMYB78 Dual luciferase assay with a LUC reporter gene driven by a promoter of a dual gene cluster regulating phenolamine and salicylic acid biosynthesis.

[0018] Figure 4 : SlMYB78 Expression level and metabolite analysis of gene silenced strains: Figure 4 The A in the code is T2. SlMYB78 Identification of expression levels of silenced strains; Figure 4 B in the gene cluster is the gene of each component in SlMYB78-RI-1 and RI-2 The expression level in Figure 4 The C in SlMYB78-RI Cluster heat map of phenolamine content under normal conditions or drought stress, values ​​± mean SD, n = 3, *P<0.05 , **P<0.01 and ***P<0.001 (t-test).

[0019] Figure 5 : SlMYB78 Analysis of enhanced disease resistance in tomatoes: Figure 5 The A in the tomato plant is Pseudomonas Syringae pv. tomato after infection with DC3000 pathogen SlMYB78 The induced expression profile of Figure 5 The B in SlMYB78- RI-1 and RI-2 The silenced strains and WT plants Pseudomonas syringae The colony counts of pv. tomato DC3000 at 3 and 4 days after infection, with standard deviations based on three biological replicates; Figure 5 The C in SlMYB78-RI-1 and RI-2 The silenced strains and WT plants Pseudomonas syringae Phenotype of pv. tomato after infection with pathogen DC3000. DETAILED DESCRIPTION

[0020] The following examples define the present invention and describe the invention in isolating clones comprising SlMYB78 The DNA fragment of the complete coding region of the gene was verified by yeast one-hybrid, EMSA and LUC dual luciferase activity experiments. SlMYB78 The double gene cluster BGC2, which has the function of directly regulating the biosynthesis of phenolamines and salicylic acid, was subsequently silenced by genetic transformation and verified. SlMYB78 Regulate the accumulation of phenolamine and SA content. Pseudomonas syringae pv. tomatoDC3000 pathogen infection experiment confirmed SlMYB78-RI The disease resistance of tomatoes is reduced. According to the following description and these embodiments, those skilled in the art can determine the basic characteristics of the present invention, and can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention to make it suitable for different uses and conditions. The experimental methods in the following embodiments are conventional methods unless otherwise specified. The test materials used in the following embodiments are purchased from commercial channels unless otherwise specified.

[0021] Embodiment 1: SlMYB78 Discovery and preliminary analysis

[0022] The present invention technicians measured the metabolic profiles of 401 tomato materials from all over the world, performed statistical analysis on the measured data, and selected varieties with significant differences in phenolamine biosynthesis for whole genome association analysis. The results showed that diFer-Spd located in the downstream of the phenolamine biosynthesis pathway was significantly associated with a loci on chromosome 5, and the SNP near the lead SNP site region was a high linkage disequilibrium region (LD) Block, indicating that there are candidate genes regulating diFer-Spd in the Block region. Among these genes, the present invention technicians found Solyc05g055330 , speculate Solyc05g055330 Genes may affect the biosynthesis of phenolamines ( Figure 1 A). Afterwards, Solyc05g055330 Phylogenetic analysis showed that the protein encoded by this gene was clustered with AtMYB78 ( Figure 1 B), so it was named SlMYB78. Further tissue expression profile analysis revealed SlMYB78 It is mainly expressed in flowers. In addition, subcellular localization showed SlMYB78 Expressed in the nucleus ( Figure 1 C).

[0023] Example 2: Isolation of clones SlMYB78 Gene and construction of its related final vector

[0024] To obtain SlMYB78The coding sequence of the gene was obtained by planting the sequenced tomato variety MicroTom for one month, and then using TRIZOL reagent (purchased from Invitrogen) to extract total RNA from the leaves of the sequenced tomato variety MicroTom (the extraction method was in accordance with the TRIZOL reagent instructions), and using the reverse transcription kit Supermix (purchased from Beijing Quanshijin Company) to reverse transcribe the RNA into cDNA, the reaction conditions were: 42 ° C 30 min, 80 ° C 5 sec. Using the cDNA as a template, PCR amplification was performed using primers ONE593: AAAAAGCAGGCTTAATGGATTATCATGGTCAGAAAATTG and ONE594: AGAAAGCTGGGTATCACATGTCATTGTTCAATTGTTG, and the cDNA was obtained. SlMYB78 The full length coding sequence (CDS) of the gene (957 bp, see SEQ NO: 1). PCR reaction conditions: 94 ℃ pre-denaturation for 5 min; 98 ℃ 10 sec, 60 ℃ 30 sec, 68 ℃ 2 min, 32 cycles; 68 ℃ extension for 5 min. The amplified PCR product was connected to the pDonr207 entry vector through the BP reaction of Gateway cloning technology, transformed into Escherichia coli DH5α competent cells, and colony PCR was verified to obtain positive clones. The correct clones containing the candidate gene without mutations were obtained by sequencing (Haikou Qingke Biological Company). SlMYB78 The full-length cDNA of the gene was obtained. Then, pDonr207_ SlMYB78 ( Figure 2 A) Ligated into the final vector Phis2 (GW) ( Figure 2 B), vector pGADT7 (GW) ( Figure 2 C), and the final vector pH2GW7_dual_LUC ( Figure 2 D).

[0025] Embodiment 3: SlMYB78 Positive regulation of a gene cluster BGC2 responsible for the biosynthesis of phenolamines and salicylic acid

[0026] First, the promoters of the components of gene cluster BGC2 were analyzed. The gene cluster BGC2 includes five genes, which are SlEPS1 , SlPBS3 , SlCoAOMT2 , SlCoOOMT3 and SlCoAOMT4 ,in, SlEPS1 The nucleotide sequence of the gene is shown in SEQ ID No. 3. SlPBS3The nucleotide sequence of the gene is shown in SEQ ID No. 4, SlCoAOMT2 The nucleotide sequence of the gene is shown in SEQ ID No. 5. SlCoOOMT3 The nucleotide sequence of the gene is shown in SEQ ID No. 6, SlCoAOMT4 The nucleotide sequence of the gene is shown in SEQ ID No. 7. It was found that the promoters of each component contained MYB binding elements ( Figure 3 A). Subsequently, the pHIS2 final vector containing the promoters of the BGC2 component genes and SlMYB78 The pGADT7 vector was co-transformed into yeast competent cells. Empty vector pGADT7 and pHIS2 containing the corresponding promoter were used as negative controls. Transformed yeast clones were grown on SD-Leu-Trp and SD-Leu-Trp-His+3-AT (Sigma) plates, respectively. The plates were then incubated at 30 degrees Celsius for 3 days. SlMYB78 Can bind to the promoter of each component gene ( Figure 3 B).

[0027] Tomato SlMYB78-GST recombinant protein was prepared and purified, and EMSA experiments were performed. The binding reaction of 10 μL reaction system was carried out in binding buffer (1 M Tris-HCl, pH 8.0, 5 M NaCl, 1 M MgCl2, 10 mg / ml BSA, 100% glycerol, 1 M DTT), using 2 μL fusion protein and 2 μL FAM-labeled promoter fragment, and reacted in the dark at 25 ℃ for 30 min. After the samples were separated on a 5% polyacrylamide gel, they were imaged using an ODYSSEYFC instrument, and it was found that SlMYB78 Can bind to the motif on the promoter of each component gene ( Figure 3 C).

[0028] The vectors containing the promoters of the genes of each component of the gene cluster BGC2 were transformed into the Agrobacterium tumefaciens GV3101 strain. For co-infiltration, equal amounts of the strains were mixed and infiltrated into four-week-old tobacco leaves using a needleless syringe. After infiltration, the leaves were grown in the dark for 12 h under normal conditions and then in 16 h light / 8 h dark for 48 h. The firefly luciferase (LUC) and Renilla luciferase (REN) activities were determined according to the manufacturer's instructions (Promega, Madison, USA). SlMYB78 It regulates a gene cluster BGC2 responsible for the biosynthesis of phenolamines and salicylic acid ( Figure 3 D).

[0029] Embodiment 4: SlMYB78 Construction and transformation of gene silencing vector

[0030] The method for constructing the silencing vector is as follows: First, the positive clone pDonr207_ SlMYB78 The positive clones were connected to the silencing vector by LR reaction of Gateway cloning technology. SlMYB78-RI After the plasmid is sequenced correctly, it is used for transformation. That is, it is introduced into the tomato variety MicroTom through the Agrobacterium-mediated tomato genetic transformation system. After pre-cultivation, infection, co-cultivation, screening of calli with kanamycin resistance, differentiation, rooting, transplanting, and identification, transgenic plants are obtained. A total of 2 independent transgenic tomato plants were obtained in the transformation vector.

[0031] Specific steps: (1) Soaking: Soak several seeds of the tomato variety MicroTom in ddH20 for 3-4 h in advance, then pour out the water and add 75% alcohol to disinfect for 1 min, rinse with sterile water five times, add 20% NaClO to disinfect for 12 min (protect from light), and wash the seeds with sterile water five times after disinfection. After soaking for about two minutes each time, pour out the sterile water, move the seeds to a culture dish with dry sterile filter paper to slightly dry the water, transfer to germination medium 1 / 2 MS and culture in the dark for 2-3 days. After germination, culture in the light; (2) Cut seedlings for pre-culture: When the seeds germinate and grow to two mature cotyledons, cut off the leaf tips and leaf bases with scissors, and spread the cotyledons upside down on the pre-culture medium with the back of the leaves facing up, and pre-culture in the dark for about 1-2 days; (3) Agrobacterium culture: Pre-culture Agrobacterium LBA4404 (from Shanghai Weidi Biological, commercial strain) on YEB solid medium with corresponding resistance selection for two days, and the culture temperature is 28 °C; transfer the Agrobacterium to YEB liquid medium with corresponding resistance selection (see below for ingredients), and culture on a shaker at 28 °C for 24 hours; (4) Agrobacterium infection and co-cultivation: use liquid MS medium, adjust the Agrobacterium suspension to OD600 = 0.2, gently shake the cotyledons in the Agrobacterium suspension for 10 min, then transfer to sterilized filter paper to dry, and place on the co-cultivation medium for 2 days; (5) Screening culture: evenly spread the cotyledons on the co-cultivation medium on the screening medium, culture under weak light for two days, and then culture under light; change the medium every two weeks until adventitious buds grow from the callus tissue; (6) Rooting: cut off the grown adventitious buds, remove all surrounding callus tissue, try to keep it intact, and transfer to the rooting medium (insert medium) for rooting culture; (9) Transplanting: select healthy plants with roots, transplant them into nutrient soil, avoid large-scale water loss 5 days after transplanting, and identify them after the plants grow normally.

[0032] The specific identification steps are as follows: (1) DNA extraction: Cut leaves of about 1 cm in size and extract DNA using the CTAB method (see the recipe below). First, use 1.5 × CTAB extraction solution to heat and extract, then add chloroform and isoamyl alcohol to separate the organic phase, then use anhydrous ethanol to precipitate the DNA, and then wash with 75% ethanol to obtain a DNA solution. (2) Vector transformation identification: In order to verify whether the RNAi silencing vector has been transformed into the plant, PCR amplification identification is performed using vector-specific primers. The PCR reaction conditions are: 94 °C pre-denaturation for 5 min; 94 °C 30 sec, 60 °C 30 sec, 72 °C 1 min, 35 cycles; 72 °C extension for 5 min. Then, agarose gel electrophoresis was performed, and bands indicated that the vector had been transferred. (3) RNA extraction and reverse transcription: The RNA extraction and reverse transcription method in Example 2 was used to extract total RNA from the leaves of the vector-transferred plants and the leaves of the wild type and obtain cDNA. (4) qPCR was used to measure the change in expression level: SYBR Green qPCR Master Mix (purchased from Takara) was used for qPCR detection (the method of use was in accordance with the instructions of the above kit), and the real-time fluorescence quantitative PCR software Quantstudio TM was used. The tomato Ubiquitin3 gene SlUBI was used as the internal reference. The detection primer sequences were SlUBI-qRT-F: 5'-GCCAAAGAAGATCAAGCACA-3', SlUBI-qRT-R: 5'-TCAGCATTAGGGCACTCCTT-3', and the ΔΔCt method was used to calculate the expression level of the transgenic plants. SlMYB78 The relative expression level of . The decrease in expression level indicates that the silenced plants are obtained and the identification is completed ( Figure 4 A).

[0033] Table 1 Primers used for constructing vectors and quantitative detection in the present invention

[0034]

[0035] Preparation of reagents and culture media used in transformation:

[0036] (1) Abbreviations of reagents and solutions: The abbreviations of plant hormones used in the culture medium of the present invention are as follows: KN (Kanamycin); KT (Kinetin); IAA (Indole-3-acetic acid); 2,4-D (2,4-Dichlorophenoxyacetic acid); AS (Acetosringone); DMSO (Dimethyl Sulfoxide); Tim (Timentin); ZR (trans-Zeatin-riboside); IBA (3-Indolebutyric acid); KH2PO4 (potassium dihydrogen phosphate); MS (Murashige & Skoog).

[0037] (2) Main solution formula:

[0038] 1) Preparation of MS liquid medium

[0039] MS Base salt 4.33 g;

[0040] MS Vitamin 0.1031g;

[0041] Sucrose 30g;

[0042] Dissolve at room temperature and make up to 1000 ml with distilled water.

[0043] 2) ZR stock solution, IBA stock solution is 2 g / L; IAA stock solution, KH2PO4, 2,4-D stock solution, KT stock solution is 1g / L; Tim stock solution is 320 g / L; KN stock solution is 50 g / L; AS stock solution is 200 mM / L. All need to be filtered and sterilized.

[0044] (3) Culture medium formula for tomato genetic transformation:

[0045] 1) Pre- / Co-culture medium

[0046] MS liquid medium 1 L;

[0047] Agar powder (Agar) 6 g;

[0048] ZR 0.5ml;

[0049] IAA 0.1ml;

[0050] Adjust the pH value to 5.8, make up to 1000 ml, seal and sterilize.

[0051] 2) Screening culture medium

[0052] MS liquid medium 1 L;

[0053] Agar powder (Agar) 6 g;

[0054] ZR 0.5 ml;

[0055] IAA 0.1 ml;

[0056] Tim 0.6 ml;

[0057] KN 0.5 ml;

[0058] Adjust the pH value to 5.8, make up to 1000 ml, seal and sterilize.

[0059] 3) Rooting medium

[0060] MS liquid medium 1 L;

[0061] Gumpowder 2.5 g;

[0062] IBA 0.5 ml;

[0063] Tim 0.5 ml;

[0064] KN 0.5 ml;

[0065] Adjust the pH value to 5.8, make up to 1000 ml, seal and sterilize.

[0066] 4) YEB medium

[0067] Yeast extract 1 g;

[0068] Tryptone 5 g;

[0069] Beef extract 5 g;

[0070] Sucrose 5 g;

[0071] MgSO4•7H2O 0.5 g;

[0072] Agar powder (Agar) (added to solid) 15 g;

[0073] Adjust the pH value to 7.4, make up to 1000 ml, seal and sterilize.

[0074] 5) 1.5 × CTAB extraction solution

[0075] CTAB 15g;

[0076] 1 M Tris·HCl (pH 8.0) 75 ml;

[0077] 0.5 M EDTA (pH 8.0) 30 ml;

[0078] NaCl 61.4 g;

[0079] Add ddH2O to make up to 1000 ml.

[0080] Example 5: Transgenic SlMYB78-RI Plant gene expression analysis and metabolite analysis

[0081] Real-time quantitative PCR analysis was used to detect the expression of the gene in the plant. The silenced plants were propagated to obtain T2 transgenic plants. The results showed that compared with the control wild-type (non-transgenic tomato) MicroTom, the positive transformed plants had SlMYB78 The gene expression level was significantly reduced ( Figure 4 A).

[0082] To further verify SlMYB78 In tomatoes, the gene cluster BGC2 has the function of regulating the biosynthesis of phenolamines and salicylic acid. The present invention technicians selected SlMYB78-RI The expression levels of each gene cluster component gene in the T2 generation of transgenic materials were quantitatively analyzed. The results showed that compared with the wild-type materials, SlMYB78 In the silenced plants, each component gene showed a lower expression level ( Figure 4 B).

[0083] To explore SlMYB78 The present invention provides a method for studying the changes of phenolamine metabolites and SA in transgenic plants before and after infection by pathogens. SlMYB78 The silenced plants were tested by LC-MS. The metabolic clustering heat map showed that after pathogen infection SlMYB78 The accumulation of SA and phenolamine metabolites in the silenced strain was significantly lower than that in the wild type, especially in Fer-Spd ( Figure 4 C).

[0084] Embodiment 6: SlMYB78 Pathogen treatment of gene-silenced transgenic lines

[0085] To validate candidate genes SlMYB78 Whether it can improve the disease resistance of tomatoes, the researchers of the present invention studied the effect of SlMYB78 Pathogens of tomato Pseudomonas syringae pv.tomato DC3000 treatment.

[0086] The specific operation method of tomato pathogen treatment is as follows: SlMYB78 Transgenic tomato seeds and wild-type tomato seeds (MicroTom) were planted in plug trays. After germination, seedlings with the same growth were selected and transplanted into the same pot. The seedlings were cultured at a constant temperature of 24 °C and 16 h light / 8 h dark until they were four weeks old. The strain was inoculated on King's B solid medium containing 25 mg / L rifampicin and cultured at 28 °C for 2 days. A single colony was selected and inoculated into King's B liquid medium containing 25 mg / L rifampicin and cultured at 28 °C and 200 rpm for 8-12 h. Centrifuged at 4000 g for 5 min at 4 °C, discarded the supernatant, washed twice with 10 mmol / L MgCl2 solution, resuspended, and the bacterial concentration was adjusted to OD600 = 0.05. The bacterial suspension containing 0.03% SilwetL-77 was sprayed evenly on tomato leaves as the treatment group, and the control group was sprayed with 10 mmol / L MgCl2 solution containing 0.03% SilwetL-77. Tissue samples were collected at 0, 2, 4, 8, 12, 24, and 48 h, and RNA was extracted for qRT-PCR analysis.

[0087] Colony count determination: inoculation with tomato pathogens Pseudomonas syringae pv. tomato DC3000, fully expanded leaves were randomly sampled, disinfected with 70% ethanol for 10 sec, washed twice with sterile water, and thoroughly ground in 500 μL 10 mmol / L MgCl2 solution. Three biological replicates were set for each treatment. The ground solution was diluted to 10% of the original solution. -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 Dilute the samples sequentially and spot 10 μL of the samples on King's B solid medium containing 25 mg / L rifampicin. Incubate at 28°C for 2 days. Each dilution concentration has 3 replicates.

[0088] The results showed that after pathogen treatment, SlMYB78 The expression level of Figure 5 A). Colony count experiments show SlMYB78-RI The colony count of Figure 5 B). It can also be seen from the leaf phenotype SlMYB78-RI Pseudomonas aeruginosa Pseudomonas syringae pv. tomato DC3000 is more sensitive ( Figure 5 C).

[0089] The present invention is described in detail above. Definitions of Terms Related to the Present Invention Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the present invention belongs.

[0090] The term "protein" is used interchangeably herein to refer to a polymer of amino acid residues. The term applies to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are non-naturally encoded amino acids. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

[0091] The term "transformation" refers to a process by which a heterologous DNA sequence is introduced into a host cell or organism.

[0092] The term "expression" refers to the transcription and / or translation of an endogenous gene or a transgene in a plant cell.

[0093] For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principle of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departing from the disclosed scope in the application, and the changes made with conventional techniques known in the art.

Claims

1. A tomato SlMYB78 Genes in regulating tomato resistance Pseudomonas syringae pv. tomato DC3000 pathogenic bacteria, characterized in that The tomato SlMYB78 The cDNA sequence of the gene is shown in SEQ ID NO. 1; the application method is to silence the SlMYB78 Gene, weakened Pseudomonas syringae pv. tomatoDC3000 pathogen resistance.

2. The use according to claim 1, characterized in that: The tomato SlMYB78 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

3. The tomato according to claim 1 SlMYB78 Genes in regulating tomato resistance Pseudomonas syringae pv. tomatoDC3000 in pathogenic bacteria, characterized in that The application pathway is SlMYB78 The gene positively regulates a phenolamine and salicylic acid biosynthesis double gene cluster, causing phenolamine substances and salicylic acid to accumulate highly in tomatoes, thereby improving the disease resistance of tomatoes; the phenolamine and salicylic acid biosynthesis double gene cluster includes five genes, the five genes are SlEPS1 , SlPBS3 , SlCoAOMT2 , SlCoOOMT3 and SlCoAOMT4 ,in, SlEPS1 The nucleotide sequence of the gene is shown in SEQ ID No.

3. SlPBS3 The nucleotide sequence of the gene is shown in SEQ ID No. 4, SlCoAOMT2 The nucleotide sequence of the gene is shown in SEQ ID No.

5. SlCoOOMT3 The nucleotide sequence of the gene is shown in SEQ ID No. 6, SlCoAOMT4 The nucleotide sequence of the gene is shown in SEQ ID No.

7.

4. The tomato according to claim 1 SlMYB78 Gene in resistance Pseudomonas syringae Application of pv. tomato DC3000 pathogen in tomato breeding.

Images