In-vivo and in-vitro combined method for efficiently synthesizing fucosylated N-glycoprotein

Abstract

The invention discloses a fucose modified tetrasaccharide N-glycoprotein glycosylation method capable of combining in vivo and in vitro, and belongs to the technical field of sugar engineering. The efficient utilization of the fucose transferase FutA is realized by combining in-vivo expression of Escherichia coli and in-vitro enzyme catalytic reaction. Through plasmid optimization and signal peptide introduction, directional release of FutA in a periplasmic cavity of Escherichia coli is promoted, and the yield of glycoprotein modified by Lewis sugar is remarkably improved. The method is simple and convenient in process and low in cost, and can be widely applied to industrial production of glycoprotein.

Description

Technical Field

[0001] The invention belongs to the technical field of sugar engineering, and particularly relates to a method for glycosylation of in vivo and in vitro combined fucose-modified tetrasaccharide N-glycoprotein. Background Art

[0002] N-glycosylation is an important post-translational modification process that significantly affects the function and stability of proteins by connecting sugar chains to relevant sites on proteins. N-glycoproteins carrying Lewis X antigens have significant advantages in the field of biomedicine and have demonstrated their unique advantages in the treatment of autoimmune diseases. Such antigens can bind to receptors in specific immune cells, exert immunosuppressive effects, and alleviate symptoms caused by certain autoimmune diseases. In addition, since the Lewis X antigen structure exists naturally in specific human cells and some pathogenic microorganisms, it also has good biocompatibility, which can provide a basis for the subsequent development of related therapeutic glycoproteins.

[0003] N-glycoproteins carrying Lewis X antigens can be obtained by fucosylation of Gal-β-1,4-GlcNAc-β-1,3-Gal-β-1,3-GlcNAc-N-glycoproteins containing human-like tetrasaccharide oligosaccharide chains. By introducing the α-1,3 fucosyltransferase FutA from Helicobacter pylori, fucosylation of N-glycoproteins can be achieved, and then N-glycoproteins carrying Lewis X antigens can be obtained. Therefore, the study of fucosylation of N-glycoproteins is extremely important. At present, the traditional method of producing fucosylated glycoproteins is usually produced in vivo through bacteria or yeast systems. Although this method can produce glycoproteins that meet human needs, it has problems such as difficult pathway construction, complex process, long cycle, and low yield. Although the chemical synthesis method has high precision, the production conditions are harsh and the cost requirements are extremely high, so it is difficult to achieve large-scale production. Summary of the invention

[0004] In order to solve the problems existing in the prior art, the purpose of the present invention is to provide a method for glycosylation of fucose-modified tetrasaccharide N-glycoproteins combined in vivo and in vitro. This method combines in vivo expression with in vitro reaction for the first time, simplifies the operation process and reduces costs. By optimizing the plasmid and introducing a signal peptide, the directional release of fucosyltransferase FutA in the periplasmic cavity of Escherichia coli is achieved, which significantly improves the synthesis efficiency of Lewis sugars. This innovative method is simple and inexpensive, achieving the purpose of low-cost and efficient production of fucose-modified N-glycoproteins.

[0005] To achieve the above object, the present invention is implemented through the following technical solutions:

[0006] In a first aspect, the present invention provides a method for in vivo and in vitro combined fucose-modified tetrasaccharide N-glycoprotein glycosylation, the method comprising the following steps:

[0007] A fucosyltransferase FutA fragment derived from Helicobacter pylori is introduced into a pIG6 plasmid; the plasmid is transferred into an Escherichia coli into which a glycosyltransferase gene and an oligosaccharide transferase gene are knocked in through gene editing, and a tetrasaccharide N-glycoprotein and a fucosyltransferase FutA are generated through induction culture; the bacterial liquid is centrifuged to concentrate the system, and the bacterial body is retained and resuspended with a small amount of LB liquid culture medium; protoplasts are prepared from the resuspended bacterial liquid, and Triton X-100 is added to increase the permeability of the cell membrane, so that the tetrasaccharide N-glycoprotein and the fucosyltransferase are released into the external environment; GDP-L-fucose is added to the external environment, and the fucosyltransferase FutA reacts with the tetrasaccharide N-glycoprotein under the action of the fucosyltransferase FutA to synthesize a glycoprotein modified with a Lewis sugar antigen.

[0008] Furthermore, the glycosyltransferase gene and oligosaccharide transferase gene are respectively the human-like oligosaccharide Gal-β-1,4-GlcNAc-β-1,3-Gal-β-1,3-GlcNAc-synthesis gene cluster lsgCDEF and the oligosaccharide transferase gene pglB.

[0009] Furthermore, the strain is Escherichia coli XL1-blue.

[0010] Further, the culture was induced in 100 mL LB liquid medium containing 0.2 mM IPTG for 24 hours; the culture conditions were that IPTG with a final concentration of 0.2 mM was added when the bacterial liquid OD was 0.6-0.8, and the culture was induced at 25°C and 220 rpm for 24 hours. Whether tetrasaccharide N-glycoprotein and fucosyltransferase were generated can be detected by SDSPAGE and Western blot.

[0011] Furthermore, the bacterial solution was concentrated by centrifugation at 8000 rpm for 10 minutes, and the bacteria were resuspended in 3 mL of LB liquid culture medium; 400 mL of LB culture medium was prepared by dissolving 4 g of tryptone, 2 g of yeast extract, and 4 g of sodium chloride in 400 mL of RO water.

[0012] Furthermore, lysozyme was added to the resuspended bacterial solution to a final concentration of 50 mg / mL, and heated to rupture the outer wall.

[0013] Further, 300 μL of Triton X-100 was added to break the outer membrane.

[0014] Furthermore, GDP-L-fucose was added to a final concentration of 1 mM to promote the reaction with tetrasaccharide N-glycoprotein under the action of fucosyltransferase FutA.

[0015] Secondly, a signal peptide OmpA sequence is added to the front end of the fucosyltransferase FutA sequence of the plasmid to improve the efficiency of FutA secretion into the periplasmic cavity, thereby increasing the effective concentration in the external system.

[0016] Thirdly, the introduction of the signal peptide OmpA sequence increases the yield of Lewis sugar antigen-modified N-glycoprotein by at least twice compared to when no signal peptide is added.

[0017] In a fourth aspect, the present invention improves the yield and efficiency of Lewis sugar antigen-modified N-glycoproteins.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention achieves efficient glycosylation modification of fucose-modified tetrasaccharide N-glycoprotein by combining in vivo expression with in vitro reaction. By optimizing the plasmid and introducing the signal peptide, the fucosyltransferase FutA is directedly released in the periplasmic cavity of Escherichia coli, thereby significantly improving the synthesis efficiency of Lewis sugar. It is easy to operate and low in cost, effectively solving the problems of high cost and complex process in the prior art, and realizing efficient and low-cost production of fucose-modified N-glycoprotein. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for describing the embodiments are briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention.

[0021] Figure 1 A map of the pIG6-FutA vector constructed in the present invention;

[0022] Figure 2 A map of the pIG6-OmpA-FutA vector constructed in the present invention;

[0023] Figure 3 This is the pIG6-FutA verification map and the fragment map constructed by the pIG6-OmpA-FutA vector, where M represents the 10000bp maker, Figure 3 Lane A 1 represents the result of pIG6-FutA digestion, using Nde I and Xho I restriction endonucleases to obtain two fragments with lengths of 4637 bp and 1266 bp; Figure 3 Lane B 1 represents the validation graph of the pIG6-OmpA-FutA reverse PCR pre-cut gel recovery result, with a fragment length of 5903 bp; Figure 3C Lane 1 represents the high-concentration recovered fragment after pIG6-OmpA-FutA reverse PCR, with a fragment length of 5963 bp, and Lane 2 represents the high- and low-concentration recovered fragments after pIG6-OmpA-FutA reverse PCR, with a fragment length of 5963 bp;

[0024] Figure 4 Mass spectrometry analysis of synthetic fucosylated N-glycoproteins combined in vitro and in vivo. Figure 4 A is a MALDI-TOF detection image of the protein produced by the chassis cells after the pIG6-FutA recombinant vector was transferred; Figure 4 B is the MALDI-TOF detection image of the protein produced by the chassis cells after the pIG6-OmpA-FutA recombinant vector was transferred into the chassis cells. DETAILED DESCRIPTION

[0025] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments, but this does not affect the protection scope of the present invention. Unless otherwise specified, the experimental equipment, materials, reagents, etc. involved in the present invention can be obtained from commercial channels.

[0026] Example 1 Construction of pIG6-FutA plasmid

[0027] The construction of a recombinant plasmid expressing α-1,3 fucosyltransferase specifically includes the following steps:

[0028] In this example, the coding gene of the α-1,3-fucosyltransferase (FutA) mutant of Helicobacter pylori 26695 was optimized by codon optimization, and the usage frequency of codons was optimized, restriction sites were avoided, the CG value content was ensured to be within a suitable range, and complex palindrome structures were avoided.

[0029] This gene is the gene of the α-1,3-fucosyltransferase (FutA) mutant of Helicobacter pylori 26695. We optimized the codons in terms of the frequency of use of its base sequence, avoiding restriction sites, ensuring that the CG value content is within the appropriate range, and avoiding the appearance of complex palindromic structures, making it more conducive to expression.

[0030] The base sequence is shown in the sequence table SEQ ID No. 1, and was submitted to Jiutian Gene Company for synthesis. The corresponding sites of the plasmid pIG6-pst3 constructed in our laboratory were inserted with Nde I and Xho I, respectively (refer to invention patent CN118028205A). After enzyme digestion analysis and identification, the corresponding recombinant plasmid pIG6-FutA was obtained. The enzyme digestion schematic diagram is shown in Figure 3 As shown in A, the spectrum is Figure 1 shown.

[0031] Example 2 Construction of pIG6-OmpA-FutA plasmid

[0032] In order to further increase the effective concentration of α-1,3 fucosyltransferase FutA in the extracellular environment, this example introduced the OmpA signal peptide before the FutA sequence by reverse PCR to construct the pIG6-OmpA-FutA plasmid vector, as shown in the figure. Figure 2 As shown, more FutA transferase can be secreted into the periplasmic cavity, so that FutA can reach the reaction system outside the cell more smoothly, effectively increasing its concentration in the system, thereby significantly improving the efficiency of the fucosylation reaction.

[0033] 1) Design of reverse PCR primers: According to the base sequence of the pIG6-FutA plasmid constructed in Example 1, reverse PCR primers were designed between the FutA sequence and the promoter sequence, which were:

[0034] SEQ ID No.2: OmpA F: gctggtttcgctaccgtagcgcaggccttccagccgctgctggatgcctttatt

[0035] SEQ ID No.3: OmpA R: cagtgccactgcaatcgcgatagctgtctttttcatatgtcctttttctaaaaaatatc

[0036] After amplification, the amplified product was recovered using a DNA gel recovery kit, and the electrophoresis image produced after agarose gel electrophoresis was as follows: Figure 3 As shown in B.

[0037] 2) Phosphorylation: Phosphorylate the recovered fragments with T4 phosphorylase, the system is as follows:

[0038] 10x T4 Polynucleotide Kinase 2μL, reverse PCR vector recovery fragment 50-100ng, 10mM ATP5μL, 10x Reaction Buffer Kinase 2μL, ddH2O to 20μL, react at 37℃ for 30min, react at 70℃ for 6min;

[0039] After phosphorylation, the phosphorylated product was purified using a DNA enzyme product purification kit, and the electrophoresis image produced after agarose gel electrophoresis was as follows: Figure 3 As shown in C.

[0040] 3) Construction of pIG6-OmpA-FutA recombinant plasmid vector: T4 ligation of the phosphorylated vector fragment, the system is as follows:

[0041] 10x T4 DNA ligase buffer 1μL, purified phosphorylated vector fragment 50-100ng, T4 DNA ligase 1μL, ddH2O to 10μL, react at 16℃ for 16h;

[0042] After connection, the obtained recombinant plasmid vector pIG6-OmpA-FutA was delivered to Sangon Biotech Co., Ltd. for detection, and the corresponding recombinant plasmid vector pIG6-OmpA-FutA was obtained after detection.

[0043] Example 3 In vitro and in vivo combined methods for fucosylation of N-glycosylated recombinant proteins

[0044] The vectors pIG6-FutA and pIG6-OmpA-FutA constructed in Example 1 and Example 2 were respectively transferred into the Escherichia coli chassis cell XE2ΔK constructed in this laboratory (refer to invention patent CN118028205A) to obtain recombinant Escherichia coli strains carrying fucosylated N-glycosylation modified recombinant protein expression vectors, and two groups of positive Escherichia coli strains with successful protein expression were screened as transformants.

[0045] The transformants were inoculated onto LB solid medium plates containing ampicillin (100 μg / mL) and cultured at 37°C for 16 hours. Monoclonal colonies were screened and selected for IPTG induction and in vitro fucosylation, which specifically included the following steps:

[0046] ① Pick a single colony of Escherichia coli containing the pIG6-FutA plasmid and a single colony of Escherichia coli containing the pIG6-OmpA-FutA plasmid, inoculate them into 10 mL of LB liquid culture medium containing ampicillin (100 μg / mL), and culture them at 37°C, 220 rpm overnight;

[0047] ② Take 1 mL of fresh bacterial solution and inoculate it into 100 mL LB liquid medium containing ampicillin (100 μg / mL) and culture at 37°C and 220 rpm until OD 600 When the pH value reached about 0.6-0.8, IPTG was added to a final concentration of 0.2 mM and induced at 25°C, 220 rpm for 24 h;

[0048] ③ After 24 hours of induction, centrifuge at 8000 rpm and 4°C for 10 minutes to collect the cells, and resuspend the cells in 3 mL of LB liquid medium to concentrate the system;

[0049] ④ Add lysozyme to the resuspended bacterial solution to a final concentration of 50 μg / mL, and place in a 37°C water bath for 30 min to break the outer wall of the bacterial cell to produce protoplasts, then add 300 μL TritonX-100 to break the outer membrane, and react at 30°C, 220 rpm overnight;

[0050] ⑤Add GDP-L-fucose to a final concentration of 1mM and MgCl2 to a final concentration of 5mM, and react overnight at 37°C and 220rpm

[0051] ⑥ Centrifuge at 12000 rpm and 4°C for 10 min and collect the supernatant of the fucose-modified N-glycosylated recombinant protein combined with the in vivo and in vitro methods.

[0052] The above supernatant expression components were purified by Ni column affinity chromatography to obtain fucose-modified N-glycosylated recombinant protein, and the nickel column was equilibrated with equilibration buffer for 10 column volumes, and the above supernatant was equilibrated and loaded onto the column at a low speed. After the sample was loaded onto the column, it was eluted with a buffer having a concentration of 20 mM imidazole for 20 column volumes, and then gradient eluted with buffers containing 40, 80, 120, 240, and 500 mM imidazole concentrations, respectively, and the eluate was collected. The separated and purified recombinant protein was the fucose-modified N-glycosylated recombinant protein.

[0053] Example 4 Comparison of production status of fucosylated N-glycosylated recombinant proteins

[0054] In order to detect the fucosylation efficiency of N-glycosylated recombinant proteins, the proteins produced in Example 3 were respectively subjected to MALDI-TOF detection, and the matrix solution contained 2,5-DHAP and diammonium hydrogen citrate. The proteins obtained by transferring the pIG6-FutA recombinant vector into the chassis cells were detected by MALDI-TOF. Figure 4 As shown in A, the molecular weights at 14762.7488, 14780.8081 (M+NH4), and 14785.6991 (M+Na) correspond to proteins further modified by fucosylated polysaccharides Gal-β-1,4-[Fuc-α1-3]GlcNAc-β-1,3Gal-β-1,3-GlcNAc-, indicating that about 8% of the glycosylated proteins were fucosylated. The proteins obtained by transferring the pIG6-OmpA-FutA recombinant vector into chassis cells were detected by MALDI-TOF. Figure 4As shown in Figure B, the molecular weights at 14692.0963, 14710.0771 (M+NH4), and 14715.2716 (M+Na) correspond to proteins further modified with fucosylated glycan Gal-β-1,4-[Fuc-α1-3]GlcNAc-β-1,3Gal-β-1,3-GlcNAc, indicating that about 15% of the fucosylation modification exists in the glycosylated protein. The efficiency of 8% is already very high, and the addition of OmpA makes the efficiency even higher.

[0055] The implementation of the present invention is not limited to this. According to the above content of the present invention, according to the common technical knowledge and general methods in the field, without departing from the above basic technical ideas of the present invention, the present invention can also have other implementations. Therefore, the present invention can also make other various forms of modification, replacement or change, all of which fall within the scope of protection of the present invention.

Claims

1. A method for in vitro and in vivo combined fucose-modified tetrasaccharide N-protein glycosylation, characterized in that: The method comprises the following steps: (1) Introducing the Fucosyltransferase FutA fragment from Helicobacter pylori into the pIG6 plasmid; (2) transferring the plasmid into a strain into which a glycosyltransferase gene and an oligosaccharide transferase gene have been knocked in through gene editing, and inducing the culture to produce tetrasaccharide N-glycoprotein and fucosyltransferase FutA; (3) Centrifuge the bacterial solution to concentrate the system, retain the bacteria and resuspend them in a small amount of LB liquid medium; (4) preparing protoplasts from the resuspended bacterial solution; (5) GDP-L-fucose is added to the external environment and reacts with tetrasaccharide N-glycoprotein under the action of fucosyltransferase FutA to synthesize glycoprotein modified with Lewis sugar antigen.

2. The method for in vivo and in vitro combined fucose-modified tetrasaccharide N-protein glycosylation according to claim 1, characterized in that: The glycosyltransferase gene and oligosaccharide transferase gene in step (2) are respectively the human-like oligosaccharide Gal-β-1,4-GlcNAc-β-1,3-Gal-β-1,3-GlcNAc-synthesis gene cluster lsgCDEF and the oligosaccharide transferase gene pglB.

3. The method for in vivo and in vitro combined fucose-modified tetrasaccharide N-protein glycosylation according to claim 1, characterized in that: The strain is Escherichia coli XL1-blue.

4. The method for in vivo and in vitro combined fucose-modified tetrasaccharide N-protein glycosylation according to claim 1, characterized in that: The induction culture in step (2) is carried out in 100 mL LB liquid culture medium containing 0.2 mM IPTG for 24 hours.

5. The method for in vivo and in vitro combined fucose-modified tetrasaccharide N-protein glycosylation according to claim 1, characterized in that: Step (3) Add lysozyme to the resuspended bacterial solution to a final concentration of 50 μg / mL and heat to rupture the outer wall.

6. The method for in vivo and in vitro combined fucose-modified tetrasaccharide N-protein glycosylation according to claim 1, characterized in that: Step (3) Add 300 μL Triton X-100 to break the outer membrane.

7. The method for in vivo and in vitro combined fucose-modified tetrasaccharide N-protein glycosylation according to claim 1, characterized in that: Step (4) GDP-L-fucose was added to a final concentration of 1 mM.

8. The method for in vivo and in vitro combined fucose-modified tetrasaccharide N-protein glycosylation according to claim 1, characterized in that: Step (1) adding a signal peptide OmpA sequence to the front end of the fucosyltransferase FutA sequence of the pIG6 plasmid.

Images