Application of sequence-specific primer in ABO blood type single-stranded sequencing

Abstract

The invention relates to the technical field of blood type gene sequencing, in particular to application of a sequence-specific primer in ABO blood type single-chain sequencing, and the sequence-specific primer comprises an upstream primer and a downstream primer, the application comprises the application of the sequence specific primer in performing PCR (Polymerase Chain Reaction) amplification on an A-type blood gene segment, a B-type blood gene segment and an O-type blood gene segment to obtain corresponding single chains. Compared with a cloning method and a single molecule sequencing method in the prior art, the sequence specific primer provided by the invention can be used for amplifying a specific blood type gene segment, separating out a corresponding single chain after amplification, and comparing through an allele database to obtain a determined allele, so that the blood type is determined; the blood type gene sequencing is carried out through the gene specific primer, the operation is simple and convenient, the cost is low, the accuracy is high, and popularization and use are facilitated.

Description

Technical Field

[0001] The present invention relates to the technical field of blood type gene sequencing, and in particular to the application of sequence-specific primers in ABO blood type single-strand sequencing. Background Art

[0002] In human blood type, the ABO blood type gene is located on the ninth chromosome of humans. The ABO blood type gene determines blood type by encoding glycosyltransferases located on the surface of red blood cells. The A blood type gene encodes N-acetylgalactosyltransferase, which produces A antigen on the surface of red blood cells. The B blood type gene product encodes α-1,3-D-galactosyltransferase, which produces B antigen on the surface of red blood cells. The O gene does not encode any enzyme. The ABO gene coding region consists of seven exons, and the sixth and seventh exons encode 45 and 230 amino acids respectively. They are the main parts that determine the glycosyltransferase function of the ABO blood type gene product and are also the main regions that produce ABO subtype gene mutations. The A, B, and O blood type genes have a high degree of homology. The cDNA sequences of the A and B genes differ by only 7 bases, which are mainly present in the seventh exon. The O gene has the same sequence as the A gene, except for the single base deletion at position 261 that causes a frameshift mutation. When using direct DNA sequencing to detect blood type genes, only the nucleotide sequences of two alleles can be obtained, among which single nucleotide polymorphism (SNP) sites can only appear in the form of overlapping peaks, but it is impossible to determine which chromosome chain these SNPs exist in, that is, it is impossible to accurately determine the genotype of the blood type. The current solution to this problem is to use the cloning method to amplify the fragment to be tested by PCR, connect the amplified product to the plasmid vector, transform the connected product into competent cells, culture it, and then select a part of the clones from multiple clones for sequence determination, so as to find out which SNPs are in the same chain.

[0003] However, the above detection method uses cloning to amplify the two chains and then separate them to detect which chain the SNP is located in. The process is complicated and involves connection, transformation, bacterial culture, etc. in molecular biology. It is also necessary to select more clones for sequencing to find the DNA sequence information of the two chains.

[0004] The serological reaction pattern refers to the specific pattern or result formed by the combination of antigen and antibody in the serological reaction. This reaction pattern can reflect the characteristics of antigen and antibody, including their specificity, reversibility of binding, optimal ratio and band phenomenon. The formation of the serological reaction pattern is based on the principle of highly specific binding between antigen and antibody. This binding reaction is carried out in vitro, using the known party (antigen or antibody) to detect the presence of the other party, which can be both qualitative and quantitative. This speculation depends on the characteristics of blood type serological reaction. If the possibility of subtype A is shown, the detected SNP can be classified as A gene, and the SNP of the blood type can be obtained, thereby determining the genotype. For samples that cannot be inferred to be subtype A or normal type A through serological reaction, this method cannot determine the blood type genotype of the sample. Summary of the invention

[0005] The present invention aims to solve at least one of the technical problems existing in the related art. To this end, the purpose of the present invention is to provide an application of sequence-specific primers in ABO blood type single-strand sequencing.

[0006] In order to achieve this purpose, the technical solution adopted by the present invention is: Application of sequence-specific primers in ABO blood type single-strand sequencing, wherein the sequence-specific primers include an upstream primer and a downstream primer; The application includes the application of sequence-specific primers in PCR amplification of A-type blood gene fragments, B-type blood gene fragments and O-type blood gene fragments to obtain corresponding single chains.

[0007] Furthermore, the gene fragment includes the seventh exon.

[0008] Furthermore, the base at the 3' end of the upstream primer used for amplifying the seventh exon of the A-type blood gene fragment is A, and the base A is inserted at the 467th position of the seventh exon.

[0009] Furthermore, the base at the 3' end of the upstream primer used for amplifying the seventh exon of the B-type blood gene fragment and the seventh exon of the O-type blood gene fragment is G, and the base G is inserted at the 467th position of the seventh exon.

[0010] Furthermore, the base at the 3' end of the upstream primer used for amplifying the seventh exon of the A-type blood gene fragment is G, and the base G is inserted at the 526th position of the seventh exon.

[0011] Furthermore, the base at the 3' end of the upstream primer used for amplifying the seventh exon of the B-type blood gene fragment is C, and the base C is inserted at the 526th position of the exon.

[0012] Furthermore, the base at the 3' end of the upstream primer used for amplifying the seventh exon of the O-type blood gene fragment is G, and the base G is inserted at the 526th position of the exon.

[0013] Further, the upstream primer is any one of P1-E7F, P3-467C, P4-467T, P5-526C and P6-526G, and the downstream primer is P2-E7R; The nucleotide sequence of P1-E7F is shown in SEQ ID NO. 1, and SEQ ID NO. 1 is as follows from 5' end to 3' end: AAGCCTTCCAATGGCCGCT; The nucleotide sequence of P2-E7R is shown in SEQ ID NO. 2, and SEQ ID NO. 2 is as follows from 5' end to 3' end: CTAAAACCAAGGGCGGGAGG; The nucleotide sequence of P3-467C is shown in SEQ ID NO. 3, and SEQ ID NO. 3 is as follows from 5' end to 3' end: GTCTTCACCGACCAGCC; The nucleotide sequence of P4-467T is shown in SEQ ID NO. 4, and SEQ ID NO. 4 is as follows from 5' end to 3' end: GTCTTCACCGACCAGCT; The nucleotide sequence of P5-526C is shown in SEQ ID NO. 5, and SEQ ID NO. 5 is as follows from 5' end to 3' end: TCAGTGCTGGAGGTGC; The nucleotide sequence of P6-526G is shown in SEQ ID NO.6, and SEQ ID NO.6 from 5' end to 3' end is as follows: TCAGTGCTGGAGGTGG.

[0014] Furthermore, the single strand is an amplified A-type blood gene fragment, and the upstream primer and downstream primer used for amplifying the A-type blood gene fragment are P4-467T and P2-E7R respectively.

[0015] Furthermore, the single strand is an amplified O-type blood gene fragment, and the upstream primer and downstream primer used for amplifying the O-type blood gene fragment are P3-467C and P2-E7R respectively.

[0016] The above one or more technical solutions in the embodiments of the present invention have at least one of the following technical effects: Compared with the cloning method in the prior art, the sequence-specific primers provided by the present invention can amplify specific blood type gene fragments, separate the corresponding single strands after amplification, and compare them through the allele database to obtain a certain allele, thereby determining the blood type. The blood type gene is sequenced by gene-specific primers, which is simple to operate, low in cost, and highly accurate, and is conducive to promotion and use. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the sequencing map of the 467th gene site of the seventh exon of the amplified A-type blood gene fragment provided in Example 1 of the present invention.

[0018] Figure 2 This is the sequencing map of the 829th gene site of the seventh exon of the amplified A-type blood gene fragment provided in Example 1 of the present invention.

[0019] Figure 3 This is the sequencing map of the 526th gene site of the seventh exon of the amplified B-type blood gene fragment provided in Example 2 of the present invention.

[0020] Figure 4 This is the sequencing map of the 657th gene site of the seventh exon of the amplified B-type blood gene fragment provided in Example 2 of the present invention.

[0021] Figure 5 This is the sequencing map of the 703rd gene site of the seventh exon of the amplified B-type blood gene fragment provided in Example 2 of the present invention.

[0022] Figure 6 It is the 796th gene site and 803 sequencing map of the seventh exon of the amplified B-type blood gene fragment provided in Example 2 of the present invention.

[0023] Figure 7 This is the sequencing map of the 905th gene site of the seventh exon of the amplified B-type blood gene fragment provided in Example 2 of the present invention.

[0024] Figure 8 This is the sequencing map of the 930th gene site of the seventh exon of the amplified B-type blood gene fragment provided in Example 2 of the present invention.

[0025] Fig. 9 This is the Sanger sequencing map of the 526th gene site of the amplified sequence provided in Comparative Example 1 of the present invention.

[0026] Fig.10 This is the Sanger sequencing map of the 657th gene site of the amplified sequence provided in Comparative Example 1 of the present invention.

[0027] Fig.11 This is the Sanger sequencing map of the 703rd gene site of the amplified sequence provided in Comparative Example 1 of the present invention.

[0028] Fig.12 It is the Sanger sequencing map of the 796th gene site and the 803rd gene site of the amplified sequence provided in Comparative Example 1 of the present invention.

[0029] Fig.13 This is the Sanger sequencing map of the 905th gene site of the amplified sequence provided in Comparative Example 1 of the present invention.

[0030] Fig.14 This is the Sanger sequencing map of the 930th gene site of the amplified sequence provided in Comparative Example 1 of the present invention.

[0031] Fig.15 This is the Sanger sequencing map of the 467th gene site of the amplified sequence provided in Comparative Example 1 of the present invention.

[0032] Fig.16 This is the Sanger sequencing map of the 829th gene site of the amplified sequence provided in Comparative Example 1 of the present invention. DETAILED DESCRIPTION

[0033] In order to make the purpose, technical scheme and advantages of the present invention clearer, the technical scheme of the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. The following embodiments are used to illustrate the present invention, but cannot be used to limit the scope of the present invention.

[0034] In the following examples, the experimental methods used are conventional methods unless otherwise specified, and the materials, reagents, etc. used are all available from commercial sources unless otherwise specified.

[0035] The PCR systems used in the following examples and comparative examples are shown in Table 1: The PCR reaction procedures used in the following examples and comparative examples are shown in Table 2: The reference sequence of the ABO blood type gene is A102, and its cDNA sequence is shown in SEQ ID NO.7. The specific sequence of SEQ ID NO.7 is as follows: The present invention utilizes the SNP existing in the ABO gene and designs sequence-specific primers. The application includes using the sequence-specific primers to perform PCR amplification on the A blood type gene fragment and the O blood type gene fragment, the B blood type gene fragment and the O blood type gene fragment, respectively, and then performing Sanger sequence sequencing on the amplified single strands. The obtained sequencing results are compared with the reference sequence to determine the type of the blood type gene.

[0036] The polymorphism of ABO blood type gene is mainly reflected in the seventh exon, among which the most common blood type gene with phenotype A in my country is A102, and the base of this allele at the 467th position is T, while the base of O and B genes at this position is C. By amplifying the seventh exon and directly sequencing it, all SNPs of the seventh exon can be obtained. Combined with the blood type serological reaction pattern, it can be inferred whether the SNPs other than the normal A and O genes belong to the A gene chain or the O gene chain, and then the blood type genotype can be obtained.

[0037] When the template DNA is amplified by PCR technology, the primer has a high requirement for the 3' end base when it is combined with the template, and it must be paired with the template to successfully complete the subsequent extension reaction of PCR. The present invention utilizes this feature to design a sequence-specific primer, which includes an upstream primer and a downstream primer. As shown in Table 3, the base at the 3' end of the upstream primer falls on the 467th position, wherein the base at the 3' end of the upstream primer is designed to be A, and the base at the 3' end of the downstream primer is designed to be G, and the downstream primer falls on the end of the seventh exon, thereby completing the amplification of the fragment. The two pairs of primers are used to complete the amplification of different alleles in samples containing A genes and O genes, and the single strand of the A-type allele can be amplified separately from the genome to achieve the effect of distinguishing the two strands. Then the amplified fragment is sequenced to achieve the effect of single-stranded sequencing.

[0038] Similarly, for the blood type gene with a B-type phenotype, the base at position 526 is G. When designing the primer, the base at the 3' end of the upstream primer that binds to this site is designed to be C. For type O and type A, the base at this site is C. When designing the primer, the base at the 3' end of the upstream primer that binds to this site is designed to be G. This allows the single strand of the B-type allele to be amplified separately from the genome, thereby achieving the effect of distinguishing the two strands.

[0039] Table 3 Sequence-specific primers

[0040] By specially designing the primer sequences as described above, single-stranded DNA sequences can be obtained by direct sequencing after PCR amplification, thereby completing the accurate determination of blood type alleles.

[0041] Example 1 A blood type gene and O blood type gene are distinguished.

[0042] The part of the seventh exon of the ABO blood type gene involving SNP is amplified, and the PCR amplification system is described in Table 1, wherein the upstream primer and the downstream primer for amplifying the A type blood gene fragment are P4-467T and P2-E7R, respectively, and the upstream primer and the downstream primer for amplifying the O type blood gene fragment are P3-467C and P2-E7R, respectively, and the PCR reaction procedure is described in Table 2. By selectively amplifying the exons with the upstream primer and the downstream primer, the two chains of the A type blood gene fragment and the O type blood gene fragment can be amplified separately, and the two single chains obtained by amplification are recovered and directly sequenced to obtain the SNP of each chain, wherein 467T and 829A are in the same chain, as shown in Table 2. Figure 1 and Figure 2 shown.

[0043] The SNPs were analyzed and combined with the ABO allele information in the International Society of Blood Transfusion (ISBT) ABO blood type allele database to obtain the ABO blood type gene of the sample: ABO*O.01.01 / A2.20 .

[0044] Example 2 The B gene and the O gene were distinguished.

[0045] The part of the seventh exon of the ABO blood type gene involving SNP is amplified, and the upstream primer and downstream primer for amplifying the B gene are P6-526G and P2-E7R respectively, and the upstream primer and downstream primer for amplifying the O gene are P5-526C and P2-E7R respectively. The PCR reaction system is the same as the reaction system of Example 1 except for the different primers selected, and the reaction procedure is the same as the reaction procedure of Example 1. By selectively amplifying the exons with the upstream primer and the downstream primer, the B blood type gene fragment and the O blood type gene fragment can be amplified separately, and the two single chains obtained by amplification are recovered and directly sequenced to obtain the SNP of each chain, wherein 526G, 657T, 703A, 796A, 803C, 905G and 930A are in the same chain, such as Figures 3 to 8 shown.

[0046] The SNPs were analyzed and combined with the ABO allele information in the ABO blood type allele database in ISBT, the ABO blood type gene of the sample was obtained as follows: ABO*O.01.01 / BW.27 .

[0047] Comparative Example 1 The seventh exon of ABO blood type was amplified for the sample to be tested. The upstream and downstream primers were P1-E7F and P2-E7R, respectively. This pair of primers can completely amplify the seventh exon. The composition of the reaction system is shown in Table 1, and the reaction process is shown in Table 2.

[0048] The above PCR reaction product was subjected to DNA agarose gel electrophoresis, and the specific process was as follows: Weigh 1g agarose, add 40ml 1×TAE buffer, heat to boiling, add 4ul nucleic acid dye ethidium bromide after it stops boiling, pour into a mold to make 2.5% agarose gel. Perform agarose gel electrophoresis on the PCR reaction product in the previous step. Put the prepared gel into the electrophoresis tank, add 1×TAE buffer, add 5ul PCR product mixed with 6× loading buffer to the spot well, the electrophoresis conditions are 110V constant voltage, 15min, the amplified fragment is 794bp, compared with the marker in the gel, the fragment size is correct.

[0049] The PCR amplification products were directly sequenced to obtain overlapping peaks of 526C>G; 657C>T; 703G>A; 796C>A; 803G>C; 905A>G; 930G>A, that is, overlapping peaks appeared at the 526th, 657th, 703rd, 796th, 803rd, 905th and 930th gene loci, such as Figures 9 to 14 As shown, compared with the reference sequence A102, the polymorphisms of 526C, 526G, 657C, 657T, 703G, 703A, 796C, 796A, 803G, 803C, 905A, 905G, 930G and 930A cannot determine which two SNPs belong to the same chromosome chain, and thus the definite blood type genotype cannot be obtained.

[0050] Comparative Example 2 The PCR reaction product in Comparative Example 1 was delivered to a sequencing company, and a fragment recovery operation was first performed, and the target PCR band was excised and recovered. The method was as shown in the SanPrep column PCR product purification kit.

[0051] The recovery process of sequencing products is as follows: add 2µL 125mM EDTA and 2µL 3M NaAc to the reaction system solution in each 96-well plate, add 50µL anhydrous ethanol, cover, shake 4 times, and place at room temperature for 15 min. Centrifuge at 3000×g at 4℃ for 30 min in a plate centrifuge; invert the 96-well plate, centrifuge to 185×g, turn off the power, and stop centrifugation. Add 70µL 70% ethanol solution, centrifuge at 3000×g at 4℃ for 15 min; immediately invert the 96-well plate, centrifuge to 185×g, turn off the power, repeat the operation once, place at room temperature, wait for the ethanol to evaporate, add 10 µL high-purity formamide (Hi-Di Formamide) to dissolve the DNA, and transfer the DNA solution to the PCR instrument for denaturation. The denaturation process is 95℃ for 4 min and 4℃ for 4 min.

[0052] Sequencing: The denatured DNA was sequenced using a 3730XL genetic analyzer.

[0053] Compared with the reference sequence, the direct sequencing results are 467C>T; 829G>A; that is, overlapping peaks appear at the 467th gene site and the 829th gene site, such as Figure 15 to Figure 16 Compared with the reference sequence, polymorphisms of 467C, 467T, 829G and 829A appeared. It was impossible to determine which two SNPs belonged to the same chromosome chain, and therefore it was impossible to obtain a definite blood type genotype.

[0054] It can be seen from Comparative Example 1, Comparative Example 2, Example 1 and Implementation 2 that, compared with the cloning method and the single molecule sequencing method for detecting the ABO blood type gene, the present invention uses gene-specific primers to perform PCR amplification on the A blood type gene fragment, the B blood type gene fragment and the O blood type gene fragment to obtain the corresponding single strands, uses specific primers to complete the amplification of different alleles of the A blood type gene fragment, the B blood type gene fragment and the O blood type gene fragment, and then performs sequence determination on the corresponding amplified single strands, which can accurately determine the blood type of the measured gene fragment, simplify the detection procedure of the ABO blood type gene, and ensure the accuracy of blood type detection.

[0055] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of sequence-specific primers in ABO blood type single-strand sequencing, characterized in that: The sequence-specific primers include an upstream primer and a downstream primer; The application includes the application of sequence-specific primers in PCR amplification of A-type blood gene fragments, B-type blood gene fragments and O-type blood gene fragments to obtain corresponding single chains.

2. Use of the sequence-specific primer according to claim 1 in ABO blood type single-strand sequencing, characterized in that: The gene fragment includes the seventh exon.

3. Use of the sequence-specific primer according to claim 2 in ABO blood type single-strand sequencing, characterized in that: The base at the 3' end of the upstream primer used for amplifying the seventh exon of the A-type blood gene fragment is A, and the base A is inserted at the 467th position of the seventh exon.

4. Use of the sequence-specific primer according to claim 2 in ABO blood type single-strand sequencing, characterized in that: The base at the 3' end of the upstream primer used for amplifying the seventh exon of the B-type blood gene fragment and the seventh exon of the O-type blood gene fragment is G, and the base G is inserted at the 467th position of the seventh exon.

5. Use of the sequence-specific primer according to claim 2 in ABO blood type single-strand sequencing, characterized in that: The base at the 3' end of the upstream primer used for amplifying the seventh exon of the A-type blood gene fragment is G, and the base G is inserted at the 526th position of the seventh exon.

6. Use of the sequence-specific primer according to claim 2 in ABO blood type single-strand sequencing, characterized in that: The base at the 3' end of the upstream primer used for amplifying the seventh exon of the B-type blood gene fragment is C, and the base C is inserted at the 526th position of the exon.

7. Use of the sequence-specific primer according to claim 2 in ABO blood type single-strand sequencing, characterized in that: The base at the 3' end of the upstream primer used for amplifying the seventh exon of the O-type blood gene fragment is G, and the base G is inserted at the 526th position of the exon.

8. Use of the sequence-specific primer according to claim 1 in ABO blood type single-strand sequencing, characterized in that: The upstream primer is any one of P1-E7F, P3-467C, P4-467T, P5-526C and P6-526G, and the downstream primer is P2-E7R; The nucleotide sequence of P1-E7F is shown in SEQ ID NO.1; The nucleotide sequence of P2-E7R is shown in SEQ ID NO.2; The nucleotide sequence of P3-467C is shown in SEQ ID NO.3; The nucleotide sequence of P4-467T is shown in SEQ ID NO.4; The nucleotide sequence of P5-526C is shown in SEQ ID NO.5; The nucleotide sequence of P6-526G is shown in SEQ ID NO.

6.

9. Use of the sequence-specific primer according to claim 1 in ABO blood type single-strand sequencing, characterized in that: The single strand is an amplified A-type blood gene fragment, and the upstream primer and downstream primer used for amplifying the A-type blood gene fragment are P4-467T and P2-E7R respectively.

10. Use of the sequence-specific primer according to claim 1 in ABO blood type single-strand sequencing, characterized in that: The single strand is an amplified O-type blood gene fragment, and the upstream primer and downstream primer used for amplifying the O-type blood gene fragment are P3-467C and P2-E7R respectively.

Images