Specific primer group for detecting resistant alopecurus ramosulatus, LAMP kit and method for detecting resistant alopecurus ramosulatus

Abstract

The invention relates to a specific primer group for detecting resistant alopecurus macrostachyus, and an LAMP (loop-mediated isothermal amplification) kit and method thereof. The specific primer group comprises a first specific primer pair consisting of a forward outer primer F3 and a reverse outer primer B3, and a second specific primer pair consisting of a forward inner primer FIP and a reverse inner primer BIP. The specific primer group provided by the invention can be well used for detecting field resistant alopecurus ramosissimus population, can timely discover whether the field resistant alopecurus ramosissimus population with Ile-1781-Thr mutation exists in the field or not, and controls the spreading of the field resistant alopecurus ramosissimus population, and meanwhile, the specific primer group can be prepared into an LAMP kit, and is convenient to use, simple and convenient to operate and high in specificity. The sensitivity is high and the price is low.

Description

Technical Field

[0001] The invention relates to the field of agricultural science and technology, and in particular to a specific primer set for detecting resistant large-eared alopecuroides, a LAMP kit and a method thereof. Background Art

[0002] Alopecurus myosuroides Huds. is an annual weed belonging to the genus Alopecurus in the Poaceae family. Its ecological niche overlaps with wheat in the Huanghuaihai region of my country. Its emergence, tillering, and jointing are similar to those of wheat. Its spikelets are pointed and slender at maturity, resembling a mouse's tail, so it is also known as mouse-tailed Alopecurus. Its plant height is slightly higher than the wheat spike layer, and its stems are thin and weak and prone to lodging. When it lods, it can also cause wheat to lodg, thus affecting its yield.

[0003] Fenoxaprop-P-ethyl is an acetyl-CoA carboxylase (ACCase) inhibitor herbicide. Since the 2000s, it has become the leading agent for controlling grass weeds such as Alopecurus paniculatus in wheat fields in my country. However, the long-term use of fenoxaprop-P-ethyl alone will not only make Alopecurus paniculatus gradually resistant to fenoxaprop-P-ethyl, but also show cross-resistance to other agents. Studies have found that resistance mutations in the herbicide target enzyme gene ACCase are an important cause of Alopecurus paniculatus resistance, among which Ile-1781-Thr mutation is one of the main mutations that cause Alopecurus paniculatus resistance to herbicides such as fenoxaprop-P-ethyl.

[0004] In order to control the spread of resistant Alopecurus in the field, it is necessary to promptly detect whether there are resistant Alopecurus populations in the field. However, the current detection method of resistant Alopecurus mainly relies on traditional gene amplification and sequencing, which requires expensive polymerase chain reaction (PCR) instruments. The process is cumbersome, time-consuming, and has low sensitivity. In addition, the test results are easily affected by other types of weeds with Ile-1781-Thr mutations. Summary of the invention

[0005] Based on this, it is necessary to provide a specific primer set and its LAMP (loop-mediated isothermal amplification) kit and method for detecting resistant Alopecurus alopecurus in order to address the above problems; the specific primer set can quickly and specifically detect resistant Alopecurus alopecurus with Ile-1781-Thr mutation, and is easy to operate, highly sensitive and inexpensive.

[0006] A specific primer set for detecting resistant Alopecurus paniculatus, comprising a first specific primer pair consisting of a forward outer primer F3 and a reverse outer primer B3, and a second specific primer pair consisting of a forward inner primer FIP and a reverse inner primer BIP, wherein:

[0007] The nucleotide sequence of the forward outer primer F3 is: 5'GGACTAGGTGTGGAGtgCAC3';

[0008] The nucleotide sequence of the reverse external primer B3 is: 5'TGGGAGCTGTACACTTCC3';

[0009] The nucleotide sequence of the forward inner primer FIP is: 5'CCGTCCAGTAACAAATGTAAGTGTAGTGCTGCTATTGCCAGTG3';

[0010] The nucleotide sequence of the reverse inner primer BIP is: 5'CCTATCTTGCTCGACTTGGCATGTTCAGGGCAGAAAACC3'.

[0011] A LAMP kit for detecting resistant Alopecurus paniculatus comprises the specific primer set as described above.

[0012] In one embodiment, the mass ratio of the first specific primer pair to the second specific primer pair is 1:50-5:4.

[0013] In one embodiment, in the LAMP kit, the concentration of the forward outer primer F3 is 3 μmol / L-7 μmol / L, the concentration of the reverse outer primer B3 is 3 μmol / L-7 μmol / L, the concentration of the forward inner primer FIP is 35 μmol / L-45 μmol / L, and the concentration of the reverse inner primer BIP is 35 μmol / L-45 μmol / L.

[0014] In one embodiment, the LAMP kit also includes Isothermal Amplification Buffer, dNTPs, MgSO 4 , betaine, Bst DNA polymerase, genomic DNA and water.

[0015] A method for detecting resistant large-eared Alopecuroides, comprising the following steps:

[0016] Extracting genomic DNA from the sample to be tested as template DNA;

[0017] The template DNA is configured with the specific primer set as described above to form a LAMP reaction system, or the template DNA is configured with the LAMP kit as described above to form a LAMP reaction system;

[0018] Allowing the LAMP reaction system to perform an amplification reaction to obtain an amplification product;

[0019] The amplified product is subjected to gel electrophoresis and the result is analyzed based on the bands, or a fluorescent dye is added to the amplified product to obtain a reaction product and the result is analyzed based on the color of the reaction product.

[0020] In one embodiment, based on the volume of 25 μL of the LAMP reaction system, the system includes 1× Isothermal Amplification Buffer, 0.8 mmol / L dNTPs, 14 mmol / L-22 mmol / L MgSO 4 , 0.32mol / L-0.96mol / L betaine, 0.1μmol / L-0.5μmol / L first specific primer set, 0.8μmol / L-3.2μmol / L second specific primer set, 0.16U / μL-0.48U / μL Bst DNA polymerase, 0.5μL-1.5μL template DNA, and the balance is water.

[0021] In one embodiment, in the step of performing an amplification reaction in the LAMP reaction system, the temperature is 60° C.-65° C., and the time is 40 min-50 min;

[0022] Alternatively, the amplification reaction step of the LAMP reaction system is divided into two stages, the temperature of the first stage is 60°C-65°C, the time is 40min-50min, and the temperature of the second stage is 80°C, the time is 10min.

[0023] In one embodiment, in the step of adding a fluorescent dye to the amplification product, 0.01 mL of the fluorescent dye is added per mL of the amplification product.

[0024] In one embodiment, the fluorescent dye is selected from at least one of SYBR Green I, HNB or calcein.

[0025] The specific primer set provided by the present invention can be used for detecting resistant big-eared foxtail with Ile-1781-Thr mutation in a LAMP reaction system. Since the specific primer set provided by the present invention can specifically identify six independent regions of the ACCase gene of the resistant big-eared foxtail, the specificity and sensitivity are extremely high. When the specific primer set provided by the present invention is used for detecting resistant big-eared foxtail with Ile-1781-Thr mutation in a LAMP reaction system, on the one hand, the resistant big-eared foxtail with Ile-1781-Thr mutation can be specifically detected without being affected by other resistant weeds such as multiflora ryegrass with Ile-1781-Thr mutation. On the other hand, the detection lower limit can reach 1.2×10 -8 Below ng / μL, with extremely high sensitivity.

[0026] Therefore, the specific primer set provided by the present invention can be well used to detect resistant Alopecurus australis populations in the field, and can timely discover whether there are resistant Alopecurus australis populations with Ile-1781-Thr mutations in the field, so as to control the spread of resistant Alopecurus australis populations in the field; at the same time, the specific primer set of the present invention can be prepared into a LAMP kit, which is easy to use, simple to operate, highly sensitive and inexpensive. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0028] Figure 1 The electrophoresis pattern of the resistant Alopecurus australis detected by the LAMP kit in Example 1 of the present invention, wherein M is a 2000 bp marker, R is a resistant Alopecurus australis DNA with an Ile-1781-Thr mutation, S is a sensitive Alopecurus australis DNA without an Ile-1781-Thr mutation, and CK is a sterile water control without DNA added;

[0029] Figure 2 This is a graph showing the detection result of resistant Alopecurus australis under normal light using a LAMP kit in Example 1 of the present invention, wherein R is resistant Alopecurus australis DNA with an Ile-1781-Thr mutation, S is sensitive Alopecurus australis DNA without an Ile-1781-Thr mutation, and CK is a sterile water control without DNA added;

[0030] Figure 3This is the electrophoresis pattern of the sensitivity of the detection method for testing resistant Alopecurus sibiricus in Example 1 of the present invention, wherein from left to right are 2000bp Marker, concentration 1.2×10 -1 ng / μL、1.2×10 -2 ng / μL、1.2×10 -3 ng / μL、1.2×10 -4 ng / μL、1.2×10 -5 ng / μL、1.2×10 -6 ng / μL、1.2×10 -7 ng / μL、1.2×10 -8 ng / μL、1.2×10 -9 ng / μL、1.2×10 -10 ng / μL of resistant Alopecurus alopecurus DNA with Ile-1781-Thr mutation, CK is the sterile water control without DNA added;

[0031] Figure 4 This is a normal light test result diagram of the sensitivity of the detection method for testing resistant big-eared Alopecurus in Example 1 of the present invention, wherein from left to right are concentrations of 1.2×10 -1 ng / μL、1.2×10 -2 ng / μL、1.2×10 -3 ng / μL、1.2×10 -4 ng / μL、1.2×10 -5 ng / μL、1.2×10 -6 ng / μL、1.2×10 -7 ng / μL、1.2×10 -8 ng / μL、1.2×10 - 9 ng / μL、1.2×10 -10 ng / μL of resistant Alopecurus alopecurus DNA with Ile-1781-Thr mutation, CK is the sterile water control without DNA added;

[0032] Figure 5 This is the electrophoresis pattern of the PCR amplification sensitivity of the test of resistant Alopecurus alopecurus in Example 1 of the present invention, wherein from left to right are 2000bp Marker, concentration 1.2×10 -1 ng / μL、1.2×10 -2 ng / μL、1.2×10 -3 ng / μL、1.2×10 -4 ng / μL、1.2×10 -5 ng / μL、1.2×10 -6 ng / μL、1.2×10-7 ng / μL、1.2×10 -8 ng / μL、1.2×10 - 9 ng / μL of resistant Alopecurus alopecurus DNA with Ile-1781-Thr mutation, and CK is the sterile water control without added DNA. DETAILED DESCRIPTION

[0033] For ease of understanding of the present invention, the present invention will be described in more detail below. However, it should be understood that the present invention can be implemented in many different forms and is not limited to the embodiments or examples described herein. On the contrary, the purpose of providing these embodiments or examples is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific implementation methods or embodiments, and are not intended to limit the present invention. The optional scope of the term "and / or" used herein includes any one of two or more related listed items, and also includes any and all combinations of related listed items, and the combinations include any two related listed items, any more related listed items, or all related listed items.

[0035] The present invention uses the genome sequence of sensitive Alopecurus australis acetyl-CoA carboxylase (ACCase) without mutation in the GenBank database (accession number AJ310767) as a reference sequence, and designs a specific primer set for detecting resistant Alopecurus australis provided by the present invention according to the reference sequence. The specific primer set includes a first specific primer pair consisting of a forward outer primer F3 and a reverse outer primer B3, and a second specific primer pair consisting of a forward inner primer FIP and a reverse inner primer BIP, wherein:

[0036] The nucleotide sequence of the forward outer primer F3 was: 5′GGACTAGGTGTGGAGtgCAC3′;

[0037] The nucleotide sequence of the reverse outer primer B3 was: 5′TGGGAGCTGTACACTTCC3′;

[0038] The nucleotide sequence of the forward inner primer FIP is: 5'CCGTCCAGTAACAAATGTAAGTGTAGTGCTGCTATTGCCAGTG3';

[0039] The nucleotide sequence of the reverse inner primer BIP is: 5'CCTATCTTGCTCGACTTGGCATGTTCAGGGCAGAAAACC3'.

[0040] The above-mentioned specific primer set can be used for detecting resistant big-eared foxtail with Ile-1781-Thr mutation in LAMP reaction system. Since the specific primer set provided by the present invention can specifically identify 6 independent regions of ACCase gene of resistant big-eared foxtail, the specificity and sensitivity are extremely high. When the specific primer set provided by the present invention is used for detecting resistant big-eared foxtail with Ile-1781-Thr mutation in LAMP reaction system, on the one hand, resistant big-eared foxtail with Ile-1781-Thr mutation can be specifically detected without being affected by other resistant weeds such as multiflora ryegrass with Ile-1781-Thr mutation. On the other hand, the detection limit can reach 1.2×10 -8 Below ng / μL, with extremely high sensitivity.

[0041] Therefore, the specific primer set provided by the present invention can be well used to detect resistant Alopecurus australis populations in the field, and can timely discover whether there are resistant Alopecurus australis populations with Ile-1781-Thr mutations in the field, so as to control the spread of resistant Alopecurus australis populations in the field.

[0042] The present invention also provides a LAMP kit for detecting resistant Alopecurus australis, comprising the above-mentioned specific primer set. The LAMP kit is convenient to use and easy to operate, with high sensitivity and low price when used to detect resistant Alopecurus australis population with Ile-1781-Thr mutation.

[0043] In order to make the LAMP kit for detecting resistant Alopecurus macrostachya have a lower detection limit, the mass ratio of the first specific primer pair to the second specific primer pair is preferably 1:50-5:4.

[0044] In one embodiment, in the LAMP kit for detecting resistant Alopecuroides, the concentration of the forward outer primer F3 is 3 μmol / L-7 μmol / L, the concentration of the reverse outer primer B3 is 3 μmol / L-7 μmol / L, the concentration of the forward inner primer FIP is 35 μmol / L-45 μmol / L, and the concentration of the reverse inner primer BIP is 35 μmol / L-45 μmol / L.

[0045] In one embodiment, the LAMP kit for detecting resistant Alopecurus paniculatus further includes Isothermal Amplification Buffer, dNTPs (deoxyribonucleoside triphosphates), MgSO 4, betaine, Bst DNA polymerase, genomic DNA and water. The present invention has no special limitation on this. Those skilled in the art can configure a LAMP reaction system of corresponding concentration as needed when using it.

[0046] In order to avoid the presence of other DNA interfering with the detection results, preferably, the water in the LAMP kit for detecting resistant Alopecurus macrostachya is sterile water.

[0047] The LAMP kit for detecting resistant big-eared foxtail provided by the present invention can quickly and specifically detect resistant big-eared foxtail with Ile-1781-Thr mutation, avoids the influence of the malignant weed resistant big-eared foxtail on economic crops, and ensures the healthy development of economic crops in farmland; meanwhile, the LAMP kit for detecting resistant big-eared foxtail provided by the present invention is easy to use, simple to operate, highly sensitive and inexpensive.

[0048] The present invention also provides a method for detecting resistant Alopecuroides, comprising the following steps:

[0049] S10, extracting genomic DNA of the sample to be tested as template DNA;

[0050] S20, configuring the template DNA with the specific primer set as described above or with the LAMP kit as described above to form a LAMP reaction system;

[0051] S30, performing an amplification reaction on the LAMP reaction system to obtain an amplification product;

[0052] S40, performing gel electrophoresis on the amplified product and analyzing the result according to the bands, or adding fluorescent dye to the amplified product to obtain a reaction product and analyzing the result according to the color of the reaction product.

[0053] In step S10, the present invention does not impose any particular limitation on the method for extracting genomic DNA of the sample to be tested. In one embodiment, the genomic DNA of the sample to be tested can be extracted by the CTAB method or a DNA extraction kit.

[0054] In step S20, in order to meet the requirements of visualization of the reaction results and to save costs to the greatest extent, in one embodiment, the volume of the above-mentioned LAMP reaction system is 25 μL, which includes 1× Isothermal Amplification Buffer, 0.8 mmol / L dNTPs, 14 mmol / L-22 mmol / L MgSO 4, 0.32mol / L-0.96mol / L betaine, 0.1μmol / L-0.5μmol / L first specific primer set, 0.8μmol / L-3.2μmol / L second specific primer set, 0.16U / μL-0.48U / μL Bst DNA polymerase, 0.5μL-1.5μL template DNA, and the balance is water.

[0055] In order to avoid the presence of other DNA interfering with the detection results, preferably, the water in the above LAMP reaction system is sterile water.

[0056] In step S30, in order to provide mild reaction conditions and maximize the detection efficiency, in the step of amplification reaction of the LAMP reaction system, the temperature is preferably 60°C-65°C, and the time is preferably 40min-50min; alternatively, the step of amplification reaction of the LAMP reaction system is divided into two stages, the temperature of the first stage is preferably 60°C-65°C, the time is preferably 40min-50min, and the temperature of the second stage is preferably 80°C, and the time is preferably 10min.

[0057] In step S40, according to the band analysis results, the amplified product may be subjected to gel electrophoresis using 2%-3% agarose gel.

[0058] Specifically, the agarose gel plate preparation method includes the following steps: preparing agarose gel at a ratio of 2%-3%, weighing 1.0g-1.5g agarose with an analytical balance, adding it to 50mL of 1×TBE buffer and shaking it, heating it in a microwave oven until it is completely dissolved, adding 3μL-4μL of nucleic acid dye to the agarose gel solution and mixing it, pouring it into the gel groove of the medium gel plate, inserting a comb with an appropriate number of teeth, cooling it at room temperature and standing it for 15min-20min, and after solidification, pulling out the combs on both sides at the same time to remove excess gel at the edge, and the preparation is completed.

[0059] The specific operation method of gel electrophoresis includes the following steps: placing the prepared agarose gel into the electrophoresis tank, adding 1×TBE buffer to cover the gel, adding 5μL-10μL of DNA Marker 2000, adding 5μL-10μL of the amplified product of the sample to be tested, performing nucleic acid electrophoresis at a constant voltage of 80V-100V for 60min-90min, and observing and recording the amplified bands of each sample to be tested through a gel imaging system, and analyzing the identification results.

[0060] Alternatively, when the results are analyzed based on the color of the reaction product, in one embodiment, 0.1 mL of fluorescent dye is added per mL of amplification product.

[0061] In one embodiment, the fluorescent dye is selected from at least one of SYBR Green I, HNB or calcein, and the fluorescent dye can present different colors according to the changes in the components in the reaction solution. When the color of the reaction product is orange-red, it indicates that the sample to be tested does not contain the DNA of resistant big-eared oats, and the test result is negative. When the color is yellow, it indicates that the sample to be tested contains the DNA of resistant big-eared oats, and the test result is positive.

[0062] The advantage of LAMP reaction is that it is carried out under constant temperature conditions. The experiment can be carried out in a constant temperature water bath or equipment with a stable heat source. The result can be determined by the color change of the reaction product, and there is no need for expensive instruments such as PCR instruments. Not only is the amplification reaction extremely fast, generally completed within 1 hour, but the amount of product produced by amplification is large, and the result can even be determined by the naked eye without electrophoresis, only by adding fluorescent dyes.

[0063] The method for detecting resistant big-eared alopecuroides provided by the invention can quickly and specifically detect resistant big-eared alopecuroides with Ile-1781-Thr mutation, and has the advantages of simple and rapid operation, high sensitivity and low price.

[0064] Hereinafter, the specific primer set and LAMP kit and method for detecting resistant Alopecurus macrostachya will be further described through the following specific examples.

[0065] Example 1

[0066] (1) Design of specific primer sets for LAMP reaction

[0067] Based on the Ile-1781-Thr mutation type in which the 1781th amino acid of the ACCase gene of Alopecuroides resistant to fenoxaprop-ethyl mutated from Ile to Thr, LAMP primers were designed. The mutation site of the primer was located at the 3' end of the forward outer primer F3. Two base mismatch mutations were introduced. LAMP reaction was carried out using DNA of sensitive and resistant populations of Alopecuroides as templates, and a LAMP primer set that can specifically identify Alopecuroides resistant to fenoxaprop-ethyl containing the Ile-1781-Thr mutation was selected.

[0068] The selected primer sequences are as follows:

[0069] F3 is: 5'GGACTAGGTGTGGAGtgCAC3';

[0070] B3 is: 5'TGGGAGCTGTACACTTCC3';

[0071] The FIP is: 5'CCGTCCAGTAACAAATGTAAGTGTAGTGCTGCTATTGCCAGT G3';

[0072] The BIP is: 5'CCTATCTTGCTCGACTTGGCATGTTCAGGGCAGAAAACC3'.

[0073] Among them, in the 3' end base of the forward outer primer F3, the 20th base C is the point mutation base of Alopecurus macrostachya resistance to fenoxaprop-ethyl, and the 16th and 17th bases "TG" are artificially set mismatch mutation bases.

[0074] (2) LAMP kit system optimization

[0075] The optimal reaction time and temperature were used as optimization indicators to optimize the MgSO 4 , betaine, primer pairs F3 / B3 and FIP / BIP, and Bst DNA polymerase were optimized by single-factor experiments.

[0076] MgSO 4 Optimization: Select 3.5μL, 4μL, 4.5μL, 5μL, and 5.5μL of 100mmol / L MgSO 4 , 5 μL of betaine with a concentration of 4 mol / L, 1 μL of primer pair F3 and B3 with a concentration of 5 μmol / L, 2 μL of primer pair FIP and BIP with a concentration of 40 μmol / L, and 1 μL of Bst DNA polymerase with an enzyme activity of 8 U / μL.

[0077] Betaine was optimized by selecting 2 μL, 3 μL, 4 μL, 5 μL, and 6 μL of 4 mol / L betaine and 4 μL of 100 mmol / L MgSO 4 , 1 μL of primer pair F3 and B3 with a concentration of 5 μmol / L, 2 μL of primer pair FIP and BIP with a concentration of 40 μmol / L, and 1 μL of Bst DNA polymerase with an enzyme activity of 8 U / μL.

[0078] The primer pairs F3 and B3 were optimized by selecting 0.5 μL, 1 μL, 1.5 μL, 2 μL, and 2.5 μL of 5 μmol / L primer pairs F3 and B3, and 4 μL of 100 mmol / L MgSO 4 , 5 μL of betaine with a concentration of 4 mol / L, 2 μL of primer pair FIP and BIP with a concentration of 40 μmol / L, and 1 μL of Bst DNA polymerase with an enzyme activity of 8 U / μL.

[0079] The primer pairs FIP and BIP were optimized by selecting 0.5 μL, 1 μL, 1.5 μL, and 2 μL of primer pairs FIP and BIP at a concentration of 40 μmol / L, and 4 μL of MgSO at a concentration of 100 mmol / L. 4 , 5 μL of betaine with a concentration of 4 mol / L, 1 μL of primer pair F3 and B3 with a concentration of 5 μmol / L, and 1 μL of Bst DNA polymerase with an enzyme activity of 8 U / μL.

[0080] Optimize Bst DNA polymerase: select 0.5 μL, 1 μL, and 1.5 μL of Bst DNA polymerase with an enzyme activity of 8 U / μL, and 4 μL of 100 mmol / L MgSO 4 , 5 μL of betaine at a concentration of 4 mol / L, 1 μL of primer pair F3 and B3 at a concentration of 5 μmol / L, and 2 μL of primer pair FIP and BIP at a concentration of 40 μmol / L.

[0081] The LAMP reaction conditions were optimized: taking reaction sensitivity as the optimization index, the temperatures of 60℃, 61℃, 62℃, 63℃, 64℃, and 65℃ were selected for reaction time of 50 min, and then a secondary reaction was carried out at a temperature of 80℃ for 10 min. After selecting the optimal temperature, the reaction times of 40min, 45min, and 50min were selected, and then a secondary reaction was carried out at a temperature of 80℃ for 10 min to select the optimal reaction temperature and time.

[0082] Through the above optimization, the optimal system of LAMP kit was obtained: 10×isothermal amplification buffer 2.5μL, 10mmol / L dNTPs 2μL, 100mmol / L MgSO 4 4.5μL, 4μL of 4mol / L betaine, 1.5μL of 5μmol / L F3, 1.5μL of 5μmol / L B3, 1μL of 40μmol / L FIP, 1μL of 40μmol / L BIP, 1μL of 8U / μL Bst DNA polymerase, 1μL of genomic DNA, add sterile water to prepare, the total volume is 25μL, and store at -20℃ for 1 year; the optimal reaction conditions for LAMP are: 64℃, 50min.

[0083] (3) LAMP kit sensitivity test

[0084] In order to determine the sensitivity of the LAMP kit, the sensitivity was compared with that of the common PCR amplification products. The optimized LAMP kit was used, and the genomic DNA of the resistant Alopecurus alopecurus containing the Ile-1781-Thr mutation was used as the template DNA. The template DNA was diluted with sterile water to a concentration of 1.2×10 -1 ng / μL、1.2×10 -2 ng / μL、1.2×10 -3 ng / μL、1.2×10 -4 ng / μL、1.2×10 -5 ng / μL、1.2×10 -6 ng / μL、1.2×10 -7 ng / μL、1.2×10 -8 ng / μL、1.2×10 -9 ng / μL、1.2×10 -10 ng / μL, the diluted template DNA was used as the amplification template, and 1μL of the diluted template DNA was taken for LAMP and amplification. The LAMP conditions were: the first stage temperature was 64℃, the time was 50min, the second stage temperature was 80℃, the time was 10min; the PCR amplification conditions were: 94℃ pre-denaturation for 2min, 94℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 20s, 72℃ final extension for 2min, from denaturation to extension for a total of 35 cycles, the results are as follows Figure 3 , Figure 4 , Figure 5 shown.

[0085] The electrophoretic pattern of the above LAMP kit for detecting resistant Alopecurus serrata is as follows Figure 1 As shown in the figure, the results of the LAMP kit testing resistant Alopecurus alopecurus under normal light are shown in the figure Figure 2 As shown, the colors of the resistant population R, sensitive population S, and sterile water control CK are yellow, orange-red, and orange-red, respectively. Figure 1 , Figure 2 It can be seen that the LAMP kit optimized in this example can detect the Ile-1781-Thr mutation of resistant Alopecurus paniculata, which proves that the LAMP kit optimized in this example is effective.

[0086] The electrophoretic pattern of the sensitivity of the above-mentioned test method for detecting resistant Alopecurus sibiricus is as follows: Figure 3 As shown in the figure, the test results under normal light for testing the sensitivity of the detection method for resistant big-eared foxtail millet are as follows Figure 4 As shown, the electrophoresis pattern of the PCR amplification sensitivity of the test resistant Alopecurus sibiricus is as follows Figure 5 As shown. Figure 3 , Figure 4 and Figure 5 It can be seen that the minimum detection limit of LAMP in this embodiment can reach 1.2×10 -8 ng / μL, while the detection limit of common PCR amplification is 1.2×10 -3 ng / μL, so the LAMP detection method in this embodiment has high sensitivity.

[0087] In summary, the specific primer set provided by the present invention can quickly and specifically detect resistant Alopecurus macrostachya with Ile-1781-Thr mutation, and has simple operation, high sensitivity and low price.

[0088] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0089] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A specific primer set for detecting resistant Alopecurus paniculatus, characterized in that: The specific primer set includes a first specific primer pair consisting of a forward outer primer F3 and a reverse outer primer B3, and a second specific primer pair consisting of a forward inner primer FIP and a reverse inner primer BIP, wherein: The nucleotide sequence of the forward outer primer F3 is: 5'GGACTAGGTGTGGAGtgCAC3'; The nucleotide sequence of the reverse external primer B3 is: 5'TGGGAGCTGTACACTTCC3'; The nucleotide sequence of the forward inner primer FIP is: 5'CCGTCCAGTAACAAATGTAAGTGTAGTGCTGCTATTGCCAGTG3'; The nucleotide sequence of the reverse inner primer BIP is: 5'CCTATCTTGCTCGACTTGGCATGTTCAGGGCAGAAAACC3'.

2. A LAMP kit for detecting resistant Alopecurus paniculatus, characterized in that: The LAMP kit comprises the specific primer set as claimed in claim 1.

3. The LAMP kit for detecting resistant Alopecurus alopecurus according to claim 2, characterized in that: The mass ratio of the first specific primer pair to the second specific primer pair is 1:50-5:

4.

4. The LAMP kit for detecting resistant Alopecurus sphaerocephalus according to claim 2, characterized in that: In the LAMP kit, the concentration of the forward outer primer F3 is 3 μmol / L-7 μmol / L, the concentration of the reverse outer primer B3 is 3 μmol / L-7 μmol / L, the concentration of the forward inner primer FIP is 35 μmol / L-45 μmol / L, and the concentration of the reverse inner primer BIP is 35 μmol / L-45 μmol / L.

5. The LAMP kit for detecting resistant Alopecurus sphaerocephalus according to any one of claims 2 to 4, characterized in that: The LAMP kit also includes Isothermal Amplification Buffer, dNTPs, MgSO4, betaine, BstDNA polymerase, genomic DNA and water.

6. A method for detecting resistant large-eared Alopecurus mume, characterized in that: The following steps are involved: Extracting genomic DNA from the sample to be tested as template DNA; The template DNA is configured with the specific primer set as claimed in claim 1 to form a LAMP reaction system, or the template DNA is configured with the LAMP kit as claimed in any one of claims 2 to 5 to form a LAMP reaction system; Allowing the LAMP reaction system to perform an amplification reaction to obtain an amplification product; The amplified product is subjected to gel electrophoresis and the result is analyzed based on the bands, or a fluorescent dye is added to the amplified product to obtain a reaction product and the result is analyzed based on the color of the reaction product.

7. The method for detecting resistant large-eared Alopecurus mume according to claim 6, characterized in that: Based on the volume of 25 μL of the LAMP reaction system, it includes Isothermal Amplification Buffer with a concentration of 1×, 0.8 mmol / L dNTPs, 14 mmol / L-22 mmol / L MgSO4, 0.32 mol / L-0.96 mol / L betaine, 0.1 μmol / L-0.5 μmol / L of a first specific primer set, 0.8 μmol / L-3.2 μmol / L of a second specific primer set, 0.16 U / μL-0.48 U / μL of Bst DNA polymerase, 0.5 μL-1.5 μL of template DNA, and the balance is water.

8. The method for detecting resistant large-eared Alopecurus mume according to claim 6 or 7, characterized in that: In the step of performing amplification reaction in the LAMP reaction system, the temperature is 60°C-65°C and the time is 40min-50min; Alternatively, the amplification reaction step of the LAMP reaction system is divided into two stages, the temperature of the first stage is 60°C-65°C, the time is 40min-50min, and the temperature of the second stage is 80°C, the time is 10min.

9. The method for detecting resistant large-eared Alopecurus mume according to claim 6 or 7, characterized in that: In the step of adding fluorescent dye to the amplification product, 0.01 mL of fluorescent dye is added per mL of amplification product.

10. The method for detecting resistant large-eared Alopecurus mume according to claim 6 or 7, characterized in that: The fluorescent dye is selected from at least one of SYBR Green I, HNB or calcein.

Images