Molecular marker closely linked with barley overground part dry matter nitrogen production efficiency QTL (quantitative trait loci) and application of molecular marker

Abstract

The invention discloses a molecular marker closely linked with a barley overground part dry matter nitrogen production efficiency QTL and application of the molecular marker, and belongs to the technical field of barley molecular genetic breeding. The molecular marker and the barley overground part dry matter nitrogen production efficiency QTL Qalutedm.sau-3H are co-localized on a 3H chromosome long arm of a barley genome; the molecular marker is located at the 121st basic group of a nucleotide sequence as shown in SEQ ID NO.1, and has A / G mutation. The barley overground part dry matter nitrogen production efficiency QTL is Qalutedm.sau-3H, is located on a 3H chromosome and has the effect of remarkably improving the barley overground part dry matter nitrogen production efficiency, and the molecular marker is closely linked with the QTL and can be used for molecular marker assisted detection of the QTL and molecular breeding and improving the detection efficiency and the breeding efficiency.

Description

Technical Field

[0001] The invention relates to the technical field of barley molecular genetic breeding, in particular to a molecular marker closely linked to a QTL for nitrogen production efficiency of aboveground dry matter of barley and an application thereof. Background Art

[0002] Nitrogen is one of the most important nutrients for crop growth and development. The availability of nitrogen in the soil is essential for plant growth, development and production. Unlike other elements, nitrogen cannot be released directly from rocks into the soil. The synthesis and production of nitrogen requires a lot of energy. By the middle of this century, it is expected to consume about 2% of the global energy supply. Maintaining high crop yields still depends largely on long-term and large-scale nitrogen application. Unfortunately, not all nitrogen fertilizers applied can be absorbed and utilized by plants. Most of the unabsorbed nitrogen fertilizers will be deposited in the field soil and lost through leaching. Irrational application of nitrogen fertilizers, especially excessive application, can lead to many environmental problems, such as water pollution, soil pollution, greenhouse gas emissions, etc. With the increase in global food demand and the reduction in cultivated area, humans advocate producing more food at a lower environmental cost, and the improvement and improvement of crop nitrogen efficiency is a key research area.

[0003] Barley (Hordeum vulgare L.) is the fourth most important cereal in the world and an important source of carbohydrates and proteins for human life. The improvement of barley yield depends on the efficiency of nitrogen use and the transfer of nitrogen from vegetative organs to grains. In the process of modern agricultural breeding, the stress resistance of cultivated barley has decreased due to the loss of a large number of dominant alleles. However, wild barley has rich genetic diversity and is more resistant to biotic and abiotic stresses. Identifying genetic resources for the efficiency of nitrogen production of aboveground dry matter from wild barley is crucial for breeding high-yield barley and reducing the application of nitrogen fertilizer.

[0004] Single nucleotide polymorphism (SNP) markers refer to DNA sequence polymorphisms caused by the variation of a single nucleotide at the genome level. They have the advantages of large number, wide distribution, uneven distribution in a single gene and the entire genome, and easy estimation of SNP allele frequency. They are the most numerous and most promising molecular markers in current genetic marker research. Among them, 55K SNP chips, 90K SNP chips and 660K SNP chips have been widely used in barley.

[0005] Competitive allele-specific PCR (KASP) is a new type of genotyping technology with low cost and high throughput developed by LGC (Laboratory of the Government Chemist). It accurately performs double allele typing on SNP and In Del sites through specific matching of primer terminal bases. It has been widely used in molecular marker-assisted selection of crops such as rice, wheat, barley, and soybean.

[0006] In recent years, there have been reports on the positioning of QTLs for nitrogen-related traits in barley. Currently, there are few tightly linked molecular markers related to the aboveground dry matter nitrogen production efficiency trait that can be used for actual molecular breeding. Therefore, further identification of QTLs or genes for aboveground dry matter nitrogen production efficiency with more practical value, selection of barley strains suitable for aboveground dry matter nitrogen production efficiency using molecular biology techniques, and barley breeding using molecular biology techniques are of great guiding significance. Summary of the invention

[0007] The purpose of the present invention is to provide a molecular marker closely linked to a QTL for nitrogen production efficiency of aerial dry matter in barley and its application, so as to solve the problems existing in the above-mentioned prior art. The QTL for nitrogen production efficiency of aerial dry matter in barley of the present invention is Qanutedm.sau-3H, which is located on chromosome 3H and has the effect of significantly improving nitrogen production efficiency of aerial dry matter in barley. The molecular marker is closely linked to the QTL and can be used for molecular marker-assisted detection of QTL and molecular breeding, thereby improving detection efficiency and breeding efficiency.

[0008] To achieve the above object, the present invention provides the following solutions:

[0009] The present invention provides a molecular marker tightly linked to the QTL Qanutedm.sau-3H of nitrogen production efficiency of aboveground dry matter of barley. The molecular marker and the QTL Qanutedm.sau-3H of nitrogen production efficiency of aboveground dry matter of barley are co-localized on the long arm of chromosome 3H of the barley genome.

[0010] The molecular marker is located at the 121st base of the nucleotide sequence shown in SEQ ID NO.1, and there is an A / G mutation.

[0011] Preferably, the barley aerial dry matter nitrogen production efficiency QTL Qanutedm.sau-3H is located in the 624.10-637.56 Mbp region on chromosome 3H.

[0012] The present invention also provides an application of the above molecular marker in any of the following items:

[0013] A1. Detection of QTL Qanutedm.sau-3H for nitrogen production efficiency of aboveground dry matter in barley;

[0014] A2. Early identification or selection of barley varieties with high aboveground dry matter nitrogen production efficiency;

[0015] A3. Molecular genetics and breeding of barley;

[0016] A4. Improvement of barley germplasm resources;

[0017] A5. Genetic analysis and fine mapping of genes related to nitrogen production efficiency of aboveground dry matter in barley;

[0018] The barley aerial dry matter nitrogen production efficiency QTL Qanutedm.sau-3H is located in the 624.10-637.56 Mbp region on chromosome 3H.

[0019] The present invention also provides a KASP primer set targeting the above molecular markers, wherein the KASP primer set comprises primers as shown in SEQ ID NO. 2-4.

[0020] The present invention also provides an application of the KASP primer set in any of the following items:

[0021] B1. Detection of QTL Qanutedm.sau-3H for nitrogen production efficiency of aboveground dry matter in barley;

[0022] B2. Early identification or screening of barley varieties with high aboveground dry matter nitrogen production efficiency;

[0023] B3. Molecular genetics and breeding of barley;

[0024] B4. Improvement of barley germplasm resources;

[0025] B5. Genetic analysis and fine mapping of genes related to nitrogen production efficiency of aboveground dry matter in barley;

[0026] B6. Preparing reagents, kits or chips for detecting QTL Qanutedm.sau-3H of nitrogen production efficiency of aboveground dry matter in barley;

[0027] The barley aerial dry matter nitrogen production efficiency QTL Qanutedm.sau-3H is located in the 624.10-637.56 Mbp region on chromosome 3H.

[0028] The present invention also provides a kit for detecting the QTL Qanutedm.sau-3H of nitrogen production efficiency of aboveground dry matter in barley, wherein the kit comprises the KASP primer set; the QTL Qanutedm.sau-3H of nitrogen production efficiency of aboveground dry matter in barley is located in the 624.10-637.56Mbp region on chromosome 3H.

[0029] The present invention also provides a method for detecting QTL Qanutedm.sau-3H of nitrogen production efficiency of aboveground dry matter in barley, comprising the following steps:

[0030] Using the genomic DNA of the plant to be tested as a template, the KASP primer set is used to perform fluorescence quantitative PCR amplification, and the determination is made based on the fluorescence reading results;

[0031] The plants in which the fluorescent group marked by SEQ ID NO.2 was read were identified as plants containing the QTL Qanutedm.sau-3H for the production efficiency of nitrogen in the aboveground dry matter of barley; the plants in which the fluorescent group marked by SEQ ID NO.3 was read were identified as plants not containing the QTL Qanutedm.sau-3H for the production efficiency of nitrogen in the aboveground dry matter of barley;

[0032] The barley aerial dry matter nitrogen production efficiency QTL Qanutedm.sau-3H is located in the 624.10-637.56 Mbp region on chromosome 3H.

[0033] Preferably, the reaction system of the fluorescent quantitative PCR is: 5 μL Master Mix, 5 ng template DNA, 1.4 μL mixed primers, and ddH2O added to a total volume of 10 μL;

[0034] The mixed primer is obtained by mixing 10 ng / μL of the primer shown in SEQ ID NO.2, 10 ng / μL of the primer shown in SEQ ID NO.3, 10 ng / μL of the primer shown in SEQ ID NO.4 and ddH2O in a volume ratio of 6:6:15:23.

[0035] Preferably, the fluorescent quantitative PCR reaction procedure is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing / extension at 61°C for 60 s, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for a total of 26 cycles.

[0036] The present invention discloses the following technical effects:

[0037] (1) The present invention discloses for the first time a QTL Qanutedm.sau-3H of nitrogen production efficiency of aboveground dry matter from wild barley 'CN4027', which is located on the long arm of chromosome 3H of barley and can significantly increase nitrogen production efficiency of aboveground dry matter in barley. This QTL has a high utilization value in the breeding of nitrogen production efficiency of aboveground dry matter in barley.

[0038] (2) The present invention discloses a molecular marker KASP-anutedm-sau1 for accurately detecting QTL Qanutedm.sau-3H of aboveground dry matter nitrogen production efficiency of barley 'CN4027' based on a fluorescent quantitative PCR platform. The marker is a co-dominant marker with accurate and efficient detection and convenient and stable amplification.

[0039] (3) The molecular marker KASP-anutedm-sau1 disclosed in the present invention is significantly correlated with the QTL Qanutedm.sau-3H for aboveground dry matter nitrogen production efficiency, showing the characteristics of a tightly linked marker, and can be used to detect the QTL for aboveground dry matter nitrogen production efficiency on chromosome 3H of barley, and to quickly screen plants with this locus with high accuracy, which can significantly improve the efficiency of selecting and identifying barley varieties with higher aboveground dry matter nitrogen production efficiency that are adapted to different environments, and has a high success rate.

[0040] (4) The molecular marker KASP-anutedm-sau1 provided by the present invention can also be used to locate the trait of nitrogen production efficiency of aboveground dry matter in barley, thereby eliminating plants with low nitrogen production efficiency of aboveground dry matter in the breeding process, improving breeding efficiency, and providing a basis for the study of genes for nitrogen production efficiency of aboveground dry matter in barley. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0042] Figure 1 The co-localization map of QTL Qanutedm.sau-3H and molecular marker KASP-anutedm-sau1 on chromosome 3H for nitrogen production efficiency of aboveground dry matter in barley in Example 1;

[0043] Figure 2The fluorescence reading results of the F9 generation RIL population of barley 'Baudin'×'CN4027' detected by the molecular marker KASP-anutedm-sau1 in Example 1; wherein, the FAM (circle) fluorescence is the strain with the same genotype as 'Baudin', the HEX (square) fluorescence is the strain with the same genotype as 'CN4027', the triangle fluorescence is the strain with the heterozygous genotype, and the black diamond fluorescence is the blank control;

[0044] Figure 3 The fluorescence reading results of the molecular marker KASP-anutedm-sau1 detection of the recombinant inbred line of barley 'CN4027'×'Fleet' in Example 2; wherein, the FAM (circle) fluorescence is the line with the same genotype as 'CN4027', the HEX (square) fluorescence is the line with the same genotype as 'Fleet', and the black diamond fluorescence is the blank control;

[0045] Figure 4 These are the phenotypic test results of aboveground dry matter nitrogen production efficiency of the recombinant inbred barley lines 'CN4027'×'Fleet' in Example 2; wherein 'CN4027' is a population line with a genotype consistent with 'CN4027', and 'Fleet' is a population line with a genotype consistent with 'Fleet'. DETAILED DESCRIPTION

[0046] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0047] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0048] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0049] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0050] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0051] The barley lines 'Baudin', 'CN4027' and 'Fleet' used in the following examples were all provided by the College of Resources, Sichuan Agricultural University.

[0052] Example 1

[0053] Obtaining QTL Qanutedm.sau-3H and its molecular marker KASP-anutedm-sau1 for nitrogen production efficiency of aboveground dry matter in barley:

[0054] (1) The barley line 'Baudin' was used as the female parent and the barley line 'CN4027' as the male parent to obtain the hybrid F1. The F2 was obtained by self-pollination of the F1 generation plants. The F9 generation RIL population containing 128 lines was obtained by single seed propagation to form the genetic mapping population.

[0055] (2) Phenotypic identification of nitrogen production efficiency of aboveground dry matter in recombinant inbred line populations: A field experiment was conducted with two ecological sites planted (Shifang in 2017 and 2018). The field experiment adopted a split-plot design, with the main plot being the nitrogen treatment and the secondary plot being the genotype. The two main plots were separated by a 60-cm-deep ditch. Two nitrogen treatments were set up: normal application of nitrogen, phosphorus and potassium fertilizers, and normal application of phosphorus and potassium fertilizers (no nitrogen fertilizer). Normal application of pure nitrogen 150 kg·hm -2 , urea as nitrogen source; pure phosphorus P2O575 kg·hm-1 was applied to both treatments -2 , phosphorus source is superphosphate, pure potassium K2O 75kg·hm -2 , potassium source is potassium chloride. Single row area, row length 80cm, row spacing 10cm, 15 barley seeds per row, one row between rows. Each single row area is repeated once, and each treatment is repeated 3 times. Field management follows local routine management methods. At maturity, 3 plants were randomly collected from each row, placed at 105℃ for 30 minutes, and then dried at 80℃ to constant weight. After weighing the dry weight, grind and sieve, weigh 0.20g of sample and add H2SO4-H2O2 to digest, and then measure the nitrogen content with a Kjeldahl nitrogen analyzer.

[0056] (3) DArT chip analysis

[0057] a) DNA of each strain of the genetic mapping population was extracted by CTAB method, and genotyping was performed using DArT chip technology with DNA of the parent Baudin and CN4027 as templates to obtain genotype data of the RIL population. The banding type of the parent Baudin was recorded as A, and the banding type of the parent CN4027 was recorded as B. The banding type of the strains in the population derived from Baudin was recorded as A, derived from CN4027 was recorded as B, and the heterozygous type was recorded as H.

[0058] b) Use JoinMap4.0 mapping software to construct a barley molecular linkage map with the obtained RIL population genotype data, find the optimal number of markers and marker sequence, and determine the linkage group used subsequently. Use the multiple QTL mapping model (Multiple QTL Model) of the software MapQTL 5.0, and combine the phenotypic data of aboveground dry matter nitrogen production efficiency of the population under normal nitrogen application levels and without nitrogen fertilizer application conditions to perform QTL positioning analysis. Qanutedm.sau-3H was identified under both conditions, such as Figure 1 As shown, it is located within an 11.4 cM segment on chromosome 3H.

[0059] c) Comparison of loci for nitrogen production efficiency of aboveground dry matter and acquisition of molecular markers: Previous reports on QTLs or genes related to nitrogen content in barley are relatively few. Pasam et al. reported that QTL9_CPC (55.59Mbp), QTL10_CPC (539.94Mbp) and QTL11_CPC (528.27Mbp) that control grain crude protein content are located on chromosome 3H of barley (Pasam R et al. 2012, BMC Plant Biology, 12:16). In this example, a QTL Qanutedm.sau-3H that controls nitrogen production efficiency of aboveground dry matter was identified on chromosome 3H of barley and is located at 624.10-637.56Mbp on chromosome 3H. After comparison with previous research results, it was found that Qanutedm.sau-3H is a new stable QTL.

[0060] In order to further densify the map and obtain molecular markers closely linked to Qanutedm.sau-3H, the flanking markers were physically located using the SNP chip data positioning results and the genes located in the interval were screened. The genes were further sequenced and polymorphic sites were mined to develop efficient KASP molecular markers. Finally, after multiple cloning sequencing, primer design and amplification, a total of 6 pairs of KASP primers were designed (see Table 1).

[0061] Table 1 Primer sequences of molecular marker KASP

[0062]

[0063]

[0064] d) Using the primers in Table 1, 10 random plants from the F9 generation RIL population of barley 'Baudin'×'CN4027' were subjected to fluorescence quantitative PCR. As a result, one molecular marker, KASP-anutedm-sau1, was screened from 6 pairs of KASP primers. It was located at the 121st base of the sequence shown in SEQ ID NO.1 ("R" indicates A or G), and there was an A / G mutation. It was closely linked to the QTL for aboveground dry matter nitrogen production efficiency. The positioning map is shown in FIG. Figure 1 The results of quantitative PCR detection of KASP-anutedm-sau1 are shown in Figure 2 shown.

[0065] SEQ ID NO.1: AGAAAAGAATGGGGGATATTCCAGGCAAGGCTGGCCGATGCCGAG AAGAAGTATTACTTGGATCAAGGCATCACGCCGCCGAATTCGACTTCAGTCTAGAAGTAATTACACGGCGCGCAGRAACCATGTTAGGTTTCTGTTCAGGAAAACCTGGCCCTTRCRTGCTCAGCATTGTTGATGAATAGCAGCTGCCTACTAGTATAGCTGAAGCTCCCGGGCCAGATCTGTACATGGGTTACCAC.

[0066] Example 2

[0067] Application of molecular marker KASP-anutedm-sau1 in identifying QTL Qanutedm.sau-3H controlling nitrogen production efficiency of aboveground dry matter in barley:

[0068] (1) Recombinant inbred lines were constructed using barley line 'CN4027' as the male parent and barley line 'Fleet' as the female parent, and 100 lines were randomly selected from the progeny lines.

[0069] (2) The 100 strains obtained were subjected to KASP-anutedm-sau1 marker detection. The specific method was as follows: DNA of the 100 strains was extracted; the DNA was used as a template and a specific primer pair (SEQ ID NO. 2-4) of the molecular marker KASP-anutedm-sau1 was used as a primer for fluorescence quantitative PCR.

[0070] The reaction system of the above-mentioned fluorescence quantitative PCR is: 5 μL Master Mix, 5 ng template DNA, 1.4 μL mixed primers (primers SEQ ID NO.2-4 are all at a concentration of 10 ng / μL, using 120 μL, 120 μL and 300 μL respectively, and adding 460 μL ddH2O for mixing), ddH2O is added to a total of 10 μL, and at least 3 independent blanks with ddH2O replacing the DNA template need to be added at the same time; the reaction program of fluorescence quantitative PCR is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing / extension at 61°C for 60 s, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for a total of 26 cycles; fluorescence reading is performed after completion.

[0071] Fluorescence readings are as follows Figure 3 As shown, the genotype of the plant with FAM (circle) fluorescence is consistent with 'CN4027', and the genotype of the plant with HEX (square) fluorescence is consistent with 'Fleet'. The aboveground dry matter nitrogen production efficiency phenotype of these lines was further investigated. The calculation method of aboveground dry matter nitrogen production efficiency was referenced to the literature (Song Shiyun. QTL positioning and candidate gene prediction of barley under low nitrogen stress [J]), and an independent sample t test was performed. The results are shown in Figure 4 As shown, it can be seen that the aboveground dry matter nitrogen production efficiency of the strain with the genotype 'CN4027' is significantly higher than that of the strain with the genotype 'Fleet'. This shows that Qanutedm.sau-3H does have the effect of significantly improving the aboveground dry matter nitrogen production efficiency of barley.

[0072] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A molecular marker tightly linked to QTL Qanutedm.sau-3H for nitrogen production efficiency of aboveground dry matter in barley, characterized in that: The molecular marker and the QTL Qanutedm.sau-3H of nitrogen production efficiency of aboveground dry matter of barley are co-localized on the long arm of chromosome 3H of the barley genome; The molecular marker is located at the 121st base of the nucleotide sequence shown in SEQ ID NO.1, and there is an A / G mutation.

2. The molecular marker according to claim 1, characterized in that The barley aerial dry matter nitrogen production efficiency QTL Qanutedm.sau-3H is located in the 624.10-637.56 Mbp region on chromosome 3H.

3. Use of the molecular marker according to claim 1 or 2 in any of the following: A1. Detection of QTL Qanutedm.sau-3H for nitrogen production efficiency of aboveground dry matter in barley; A2. Early identification or selection of barley varieties with high aboveground dry matter nitrogen production efficiency; A3. Molecular genetics and breeding of barley; A4. Improvement of barley germplasm resources; A5. Genetic analysis and fine mapping of genes related to nitrogen production efficiency of aboveground dry matter in barley; The barley aerial dry matter nitrogen production efficiency QTL Qanutedm.sau-3H is located in the 624.10-637.56 Mbp region on chromosome 3H.

4. A KASP primer set for the molecular marker according to claim 1 or 2, characterized in that: The KASP primer set includes primers shown as SEQ ID NO. 2-4.

5. Use of the KASP primer set according to claim 4 in any of the following: B1. Detection of QTL Qanutedm.sau-3H for nitrogen production efficiency of aboveground dry matter in barley; B2. Early identification or screening of barley varieties with high aboveground dry matter nitrogen production efficiency; B3. Molecular genetics and breeding of barley; B4. Improvement of barley germplasm resources; B5. Genetic analysis and fine mapping of genes related to nitrogen production efficiency of aboveground dry matter in barley; B6. Preparing reagents, kits or chips for detecting QTL Qanutedm.sau-3H of nitrogen production efficiency of aboveground dry matter in barley; The barley aerial dry matter nitrogen production efficiency QTL Qanutedm.sau-3H is located in the 624.10-637.56 Mbp region on chromosome 3H.

6. A kit for detecting the QTL Qanutedm.sau-3H for nitrogen production efficiency of aboveground dry matter in barley, characterized in that: The kit comprises the KASP primer set according to claim 4; the barley aerial dry matter nitrogen production efficiency QTL Qanutedm.sau-3H is located in the 624.10-637.56Mbp region on chromosome 3H.

7. A method for detecting QTL Qanutedm.sau-3H for nitrogen production efficiency of aboveground dry matter in barley, characterized in that: The steps include: Using the genomic DNA of the plant to be tested as a template, using the KASP primer set described in claim 4 to perform fluorescence quantitative PCR amplification, and making a determination based on the fluorescence reading result; The plants in which the fluorescent group marked by SEQ ID NO.2 was read were identified as plants containing the QTL Qanutedm.sau-3H for the production efficiency of nitrogen in the aboveground dry matter of barley; the plants in which the fluorescent group marked by SEQ ID NO.3 was read were identified as plants not containing the QTL Qanutedm.sau-3H for the production efficiency of nitrogen in the aboveground dry matter of barley; The barley aerial dry matter nitrogen production efficiency QTL Qanutedm.sau-3H is located in the 624.10-637.56 Mbp region on chromosome 3H.

8. The method according to claim 7, characterized in that The reaction system of the fluorescent quantitative PCR is: 5 μL Master Mix, 5 ng template DNA, 1.4 μL mixed primers, and ddH2O added to a total volume of 10 μL; The mixed primer is obtained by mixing 10 ng / μL of the primer shown in SEQ ID NO.2, 10 ng / μL of the primer shown in SEQ ID NO.3, 10 ng / μL of the primer shown in SEQ ID NO.4 and ddH2O in a volume ratio of 6:6:15:

23.

9. The method according to claim 7, characterized in that: The fluorescence quantitative PCR reaction procedure is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing / extension at 61°C for 60 s, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for a total of 26 cycles.

Images