Molecular markers tightly linked to QTL for nitrogen production efficiency of above-ground dry matter in barley and their applications
By positioning and applying the molecular marker KASP-anutedm-sau1 in barley, the problem of inefficient nitrogen production efficiency in barley breeding is solved, efficient breeding and environmentally friendly nitrogen fertilizer utilization are achieved, and the efficiency of dry matter nitrogen production in the upper ground of barley is improved.
Patent Information
- Application Number
- CN202411225324.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-03
- Publication Date
- 2025-08-05
- Estimated Expiration
- 2044-09-03
AI Technical Summary
The lack of closely linked molecular markers in the prior art is used for the nitrogen production efficiency QTL of the upper ground of barley, resulting in low breeding efficiency and low nitrogen fertilizer utilization efficiency, causing environmental pollution and other problems.
The molecular marker KASP-anutedm-sau1, which is closely linked to the nitrogen production efficiency of barley superficial dry matter QTL Qanutedm.sau-3H, is located on the long arm of the 3H chromosome of the barley genome. It is detected by a fluorescence quantitative PCR platform, and is efficiently screened and breeded using the KASP primer set.
The dry matter nitrogen production efficiency in the upper ground of barley has been significantly improved, breeding efficiency and nitrogen fertilizer utilization rate have been improved, environmental pollution has been reduced, and the early identification of high-efficiency barley varieties and germplasm resources have been achieved.
Smart Images

Figure CN119464534B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of barley molecular genetic breeding, in particular to a molecular marker tightly linked to a QTL of nitrogen production efficiency of aboveground dry matter in barley and an application thereof. Background Art
[0002] Nitrogen is one of the most important nutrients for crop growth and development. Soil nitrogen availability is crucial for plant growth, development, and production. Unlike other elements, nitrogen cannot be directly released from rocks into the soil. Its synthesis and production require significant energy, projected to consume approximately 2% of the global energy supply by mid-century. Maintaining high crop yields still relies heavily on long-term, high-volume nitrogen fertilization. Unfortunately, not all applied nitrogen fertilizer is absorbed and utilized by plants. Much of the unabsorbed nitrogen fertilizer is deposited in field soils and lost through leaching. Irrational nitrogen fertilizer application, especially excessive application, can lead to numerous environmental problems, including water and soil pollution and greenhouse gas emissions. With increasing global food demand and decreasing cultivated area, the goal is to produce more food at a lower environmental cost. Improving crop nitrogen efficiency is a key research area.
[0003] Barley (Hordeum vulgare L.) is the fourth most important cereal grain worldwide and a vital source of carbohydrates and protein for human consumption. Improving barley yield relies on nitrogen utilization efficiency and nitrogen transfer from vegetative organs to grains. Modern agricultural breeding has reduced the stress tolerance of cultivated barley due to the loss of a large number of dominant alleles. However, wild barley possesses rich genetic diversity and exhibits greater resistance to biotic and abiotic stresses. Identifying genetic resources that enhance aboveground dry matter nitrogen production efficiency in wild barley is crucial for breeding high-yield barley and reducing nitrogen fertilizer application.
[0004] Single nucleotide polymorphism (SNP) markers refer to DNA sequence polymorphisms caused by variations in a single nucleotide at the genomic level. They are numerous, widely distributed, unevenly distributed within individual genes and across the entire genome, and easily estimated in terms of SNP allele frequency. They are currently the most numerous and promising molecular markers used in genetic marker research. Chips such as the 55K SNP array, the 90K SNP array, and the 660K SNP array have been widely used in barley.
[0005] Kompetitive Allele Specific PCR (KASP) is a new genotyping technology developed by LGC (Laboratory of the Government Chemist) with the characteristics of low cost and high throughput. It can accurately perform dual-allele genotyping of SNPs and InDel loci through specific matching of the terminal bases of primers, and has been widely used in molecular marker-assisted selection of crops such as rice, wheat, barley, and soybean.
[0006] In recent years, there have been relevant reports on the QTL mapping of barley nitrogen-related traits. Currently, there are few tightly linked molecular markers related to the above-ground dry matter nitrogen production efficiency trait that can be used in actual molecular breeding. Therefore, further identification of more practical above-ground dry matter nitrogen production efficiency QTL or genes, using molecular biology techniques to select suitable barley lines with above-ground dry matter nitrogen production efficiency and using molecular biology techniques for barley breeding have important guiding significance. Summary of the Invention
[0007] The object of the present invention is to provide molecular markers tightly linked to the QTL of above-ground dry matter nitrogen production efficiency in barley and their applications to solve the problems existing in the above-mentioned prior art. The QTL of above-ground dry matter nitrogen production efficiency in barley of the present invention is Qanutedm.sau-3H, which is located on chromosome 3H and has the effect of significantly improving the above-ground dry matter nitrogen production efficiency in barley. This molecular marker is tightly linked to this QTL and can be used for molecular marker-assisted detection of QTL and molecular breeding to improve the detection efficiency and breeding efficiency.
[0008] To achieve the above object, the present invention provides the following solutions:
[0009] The present invention provides a molecular marker tightly linked to the QTL Qanutedm.sau-3H of above-ground dry matter nitrogen production efficiency in barley, and the molecular marker and the QTL Qanutedm.sau-3H of above-ground dry matter nitrogen production efficiency in barley are co-localized on the long arm of chromosome 3H of the barley genome;
[0010] The molecular marker is located at the 121st base of the nucleotide sequence shown in SEQ ID NO.1, and there is an A / G mutation.
[0011] Preferably, the QTL Qanutedm.sau-3H of above-ground dry matter nitrogen production efficiency in barley is located in the 624.10 - 637.56 Mbp region on chromosome 3H.
[0012] The present invention also provides an application of the above molecular marker in any one of the following:
[0013] A1. Detection of QTL Qanutedm.sau-3H for nitrogen production efficiency of above-ground dry matter in barley;
[0014] A2. Early identification or screening of barley varieties with high nitrogen production efficiency of above-ground dry matter;
[0015] A3. Molecular genetic breeding of barley;
[0016] A4. Improvement of barley germplasm resources;
[0017] A5. Genetic analysis and fine mapping of genes related to nitrogen production efficiency of above-ground dry matter in barley;
[0018] The QTL Qanutedm.sau-3H for nitrogen production efficiency of above-ground dry matter in barley is located in the region of 624.10 - 637.56 Mbp on chromosome 3H.
[0019] The present invention also provides a KASP primer set for the above-mentioned molecular marker, and the KASP primer set includes primers shown in SEQ ID NO. 2 - 4.
[0020] The present invention also provides an application of the above KASP primer set in any one of the following:
[0021] B1. Detection of QTL Qanutedm.sau-3H for nitrogen production efficiency of above-ground dry matter in barley;
[0022] B2. Early identification or screening of barley varieties with high nitrogen production efficiency of above-ground dry matter;
[0023] B3. Molecular genetic breeding of barley;
[0024] B4. Improvement of barley germplasm resources;
[0025] B5. Genetic analysis and fine mapping of genes related to nitrogen production efficiency of above-ground dry matter in barley;
[0026] B6. Preparation of reagents, kits or chips for detecting QTL Qanutedm.sau-3H for nitrogen production efficiency of above-ground dry matter in barley;
[0027] The QTL Qanutedm.sau-3H for nitrogen production efficiency of above-ground dry matter in barley is located in the region of 624.10 - 637.56 Mbp on chromosome 3H.
[0028] The present invention also provides a kit for detecting the QTL Qanutedm.sau-3H of the nitrogen production efficiency of the above-ground dry matter of barley, and the kit contains the above KASP primer set; the QTL Qanutedm.sau-3H of the nitrogen production efficiency of the above-ground dry matter of barley is located in the region of 624.10 - 637.56 Mbp on chromosome 3H.
[0029] The present invention also provides a method for detecting the QTL Qanutedm.sau-3H of the nitrogen production efficiency of the above-ground dry matter of barley, comprising the following steps:
[0030] Using the genomic DNA of the plant to be tested as a template, performing fluorescence quantitative PCR amplification with the above KASP primer set, and making a determination according to the fluorescence reading result;
[0031] Identifying the plant that reads the fluorescent group labeled by SEQ ID NO.2 as a plant containing the QTL Qanutedm.sau-3H of the nitrogen production efficiency of the above-ground dry matter of barley; identifying the plant that reads the fluorescent group labeled by SEQ ID NO.3 as a plant not containing the QTL Qanutedm.sau-3H of the nitrogen production efficiency of the above-ground dry matter of barley;
[0032] The QTL Qanutedm.sau-3H of the nitrogen production efficiency of the above-ground dry matter of barley is located in the region of 624.10 - 637.56 Mbp on chromosome 3H.
[0033] Preferably, the reaction system of the fluorescence quantitative PCR is: 5 μL Master Mix, 5 ng template DNA, 1.4 μL mixed primers, and ddH2O is added to a total volume of 10 μL;
[0034] The mixed primers are obtained by mixing the primer shown in SEQ ID NO.2 at 10 ng / μL, the primer shown in SEQ ID NO.3 at 10 ng / μL, the primer shown in SEQ ID NO.4 at 10 ng / μL and ddH2O in a volume ratio of 6:6:15:23.
[0035] Preferably, the fluorescence quantitative PCR reaction program is: pre-denaturation at 94 °C for 15 min; denaturation at 94 °C for 20 s, annealing / extension at 61 °C for 60 s, for a total of 10 cycles; denaturation at 94 °C for 20 s, annealing / extension at 55 °C for 60 s, for a total of 26 cycles.
[0036] The present invention discloses the following technical effects:
[0037] (1) The present invention first discloses the QTL Qanutedm.sau-3H for the nitrogen production efficiency of above-ground dry matter from wild barley 'CN4027', which is located on the long arm of chromosome 3H of barley and can significantly increase the nitrogen production efficiency of above-ground dry matter in barley. This QTL has high utilization value in the breeding of nitrogen production efficiency of above-ground dry matter in barley.
[0038] (2) The present invention discloses the molecular marker KASP-anutedm-sau1 for accurately detecting the QTL Qanutedm.sau-3H of the nitrogen production efficiency of above-ground dry matter in barley 'CN4027' based on the fluorescence quantitative PCR platform, and it is a co-dominant marker with accurate, efficient detection, convenient and stable amplification.
[0039] (3) The molecular marker KASP-anutedm-sau1 disclosed in the present invention is significantly correlated with the QTL Qanutedm.sau-3H for the nitrogen production efficiency of above-ground dry matter, showing the characteristics of a tightly linked marker. It can be used to detect the QTL for the nitrogen production efficiency of above-ground dry matter on chromosome 3H of barley, quickly screen plants with this locus, with high accuracy, and can significantly improve the selection and identification efficiency of barley varieties with higher nitrogen production efficiency of above-ground dry matter adapted to different environments, and the success rate is high.
[0040] (4) The molecular marker KASP-anutedm-sau1 provided by the present invention can also be used to locate the trait of the nitrogen production efficiency of above-ground dry matter in barley, so as to eliminate plants with lower nitrogen production efficiency of above-ground dry matter in the breeding process, improve the breeding work efficiency, and provide a basis for the research of genes for the nitrogen production efficiency of above-ground dry matter in barley. BRIEF DESCRIPTION OF THE DRAWINGS
[0041] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.
[0042] Figure 1 It is the co-localization map of the QTL Qanutedm.sau-3H for the nitrogen production efficiency of above-ground dry matter in barley and the molecular marker KASP-anutedm-sau1 on chromosome 3H in Example 1;
[0043] Figure 2Fluorescence reading results of the F9 generation RIL population plants of barley 'Baudin'×'CN4027' in Example 1 detected by the molecular marker KASP - anutedm - sau1; among them, FAM (circular) fluorescence represents the lines with genotypes consistent with 'Baudin', HEX (square) fluorescence represents the lines with genotypes consistent with 'CN4027', triangular fluorescence represents the lines with heterozygous genotypes, and black diamond fluorescence represents the blank control;
[0044] Figure 3 Fluorescence reading results of the recombinant inbred line plants of barley 'CN4027'×'Fleet' in Example 2 detected by the molecular marker KASP - anutedm - sau1; among them, FAM (circular) fluorescence represents the lines with genotypes consistent with 'CN4027', HEX (square) fluorescence represents the lines with genotypes consistent with 'Fleet', and black diamond fluorescence represents the blank control;
[0045] Figure 4 Phenotypic detection results of the above - ground dry matter nitrogen production efficiency of the recombinant inbred line plants of barley 'CN4027'×'Fleet' in Example 2; among them, 'CN4027' represents the population lines with genotypes consistent with 'CN4027', and 'Fleet' represents the population lines with genotypes consistent with 'Fleet'. Detailed implementation manners
[0046] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be regarded as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.
[0047] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.
[0048] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0049] Without departing from the scope or spirit of the present invention, various improvements and variations can be made to the specific embodiments of the specification of the present invention, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.
[0050] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.
[0051] The barley lines 'Baudin', 'CN4027', and 'Fleet' used in the following examples were all provided by the College of Resources, Sichuan Agricultural University.
[0052] Example 1
[0053] Obtaining of the QTL Qanutedm.sau-3H for the nitrogen production efficiency of aboveground dry matter in barley and its molecular marker KASP-anutedm-sau1
[0054] (1) Using the barley line 'Baudin' as the female parent and the barley line 'CN4027' as the male parent for hybridization to obtain the hybrid F1. The single plants of the F1 generation were self-crossed to obtain F2, and the single-seed descent method was used to obtain the F9 generation RIL population containing 128 lines to form a genetic mapping population.
[0055] (2) Phenotypic identification of the nitrogen production efficiency of aboveground dry matter in the recombinant inbred line population: Field experiments were carried out. A total of 2 ecological sites (Shifang in 2017 and 2018) were planted. The field experiment adopted a split-plot design, with the main plot being the nitrogen treatment and the sub-plot being the genotype. The two main plots were separated by a 60-cm deep ditch. Two nitrogen treatments were set: normal application of nitrogen, phosphorus, and potassium fertilizers, and normal application of phosphorus and potassium fertilizers (without applying nitrogen fertilizer). The normal application of pure nitrogen was 150 kg·hm -2 , and the nitrogen source was urea; both treatments applied pure phosphorus P2O5 75 kg·hm -2 , the phosphorus source was superphosphate, and pure potassium K2O 75 kg·hm -2 , and the potassium source was potassium chloride. Single-row plots, 80 cm in row length, 10 cm in row spacing, and 15 barley seeds were dibbled in each row. There was a row interval between the row plots. Each single-row plot was 1 replication, and each treatment had 3 replications. Field management followed the local conventional management methods. At the mature stage, 3 single plants were randomly harvested from each row, placed in an oven at 105 °C for 30 min for blanching, and then dried to a constant weight at 80 °C. After weighing the dry weight, it was ground and sieved, 0.20 g of the sample was taken and digested with H2SO4-H2O2, and then the nitrogen content was measured with a Kjeldahl nitrogen analyzer.
[0056] (3) DArT chip analysis
[0057] a) Extract the DNA of each strain in the genetic mapping population using the CTAB method. Using the DArT chip technology, with the DNA of the parents Baudin and CN4027 as templates, perform genotyping to obtain the genotype data of the RIL population. The banding pattern of the parent Baudin is denoted as A, and the banding pattern of the parent CN4027 is denoted as B. The banding pattern of the population strain derived from Baudin is denoted as A, the one derived from CN4027 is denoted as B, and the heterozygous type is H.
[0058] b) Use the JoinMap4.0 mapping software to construct a barley molecular linkage map from the obtained genotype data of the RIL population, find the optimal number of markers and marker order, and determine the linkage groups to be used subsequently. Using the multiple QTL mapping model (Multiple QTL Model) of the software MapQTL 5.0, and combining the phenotypic data of the above-ground dry matter nitrogen production efficiency of the population under normal nitrogen application level and no nitrogen fertilizer application conditions for QTL mapping analysis, Qanutedm.sau-3H was identified under both conditions. As Figure 1 shown, it is located within an 11.4 cM segment on chromosome 3H.
[0059] c) Comparison of the above-ground dry matter nitrogen production efficiency loci and obtaining molecular markers: There are few QTLs or genes related to barley nitrogen content reported by previous studies. Pasam et al. reported that QTL9_CPC (55.59 Mbp), QTL10_CPC (539.94 Mbp), and QTL11_CPC (528.27 Mbp) controlling the crude protein content of grains are located on chromosome 3H of barley (Pasam R et al. 2012, BMC Plant Biology, 12:16). In this example, a QTL Qanutedm.sau-3H controlling the above-ground dry matter nitrogen production efficiency was identified on chromosome 3H of barley, located at 624.10 - 637.56 Mbp on chromosome 3H. After comparison with the previous research results, it was found that Qanutedm.sau-3H is a new and stable QTL.
[0060] To further densify the map and obtain molecular markers tightly linked to Qanutedm.sau-3H, use the SNP chip data mapping results to physically map the flanking markers and screen the genes located within the interval. Further sequence the genes to mine polymorphic sites, thereby developing and obtaining efficient KASP molecular markers. Finally, after multiple clone sequencing, primer design, and amplification, a total of 6 pairs of KASP primers were designed (see Table 1).
[0061] Table 1 KASP primer sequences of molecular markers
[0062]
[0063]
[0064] d) Using the primers in Table 1, fluorescence quantitative PCR was performed on 10 randomly selected plants from the F9 generation RIL population of barley 'Baudin' × 'CN4027'. As a result, 1 molecular marker, namely KASP-anutedm-sau1, was screened from 6 pairs of KASP primers. It is located at the 121st base of the sequence shown in SEQ ID NO.1 ("R", representing A or G), with an A / G mutation. It is tightly linked to the QTL for aboveground dry matter nitrogen production efficiency, and the mapping diagram is as Figure 1 shown, and the fluorescence quantitative PCR detection result of KASP-anutedm-sau1 is as Figure 2 shown.
[0065] SEQ ID NO.1: AGAAAAGAATGGGGGATATTCCAGGCAAGGCTGGCCGATGCCGAG AAGAAGTATTACTTGGATCAAGGCATCACGCCGCCGAATTCGACTTCAGTCTAGAAGTAATTACACGGCGCGCAGRAACCATGTTAGGTTTCTGTTCAGGAAACCTGGCCCTTRCRTGCTCAGCATTGTTGATGAATAGCAGCTGCCTACTAGTATAGCTGAAGCTCCCGGGCCAGATCTGTACATGGGTTACCAC.
[0066] Example 2
[0067] Application of the molecular marker KASP-anutedm-sau1 in identifying the QTL Qanutedm.sau-3H controlling the aboveground dry matter nitrogen production efficiency of barley:
[0068] (1) Using barley line 'CN4027' as the male parent and barley line 'Fleet' as the female parent to construct a recombinant inbred line, and randomly selecting 100 lines from the offspring lines.
[0069] (2) Detecting the KASP-anutedm-sau1 marker for the 100 obtained lines. The specific method is as follows: Extract the DNA of the 100 lines; use it as a template and perform fluorescence quantitative PCR with the specific primer pair (SEQ ID NO.2 - 4) of the molecular marker KASP-anutedm-sau1 as primers.
[0070] The reaction system of the above fluorescence quantitative PCR is as follows: 5 μL of Master Mix, 5 ng of template DNA, 1.4 μL of mixed primers (prepared by mixing primer SEQ ID NO.2 - 4 at a concentration of 10 ng / μL, using 120 μL, 120 μL, and 300 μL respectively, and adding 460 μL of ddH2O), adding ddH2O to a total volume of 10 μL, and at least 3 independent blanks substituting DNA template with ddH2O need to be added; the reaction program of fluorescence quantitative PCR is: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing / extension at 61°C for 60 s, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for a total of 26 cycles; after completion, fluorescence reading is performed.
[0071] The results of fluorescence reading are as Figure 3 shown. The plant genotypes with FAM (circular) fluorescence are consistent with 'CN4027', and the plant genotypes with HEX (square) fluorescence are consistent with 'Fleet'. Further, the phenotypes of the above-ground dry matter nitrogen production efficiency of these lines were investigated. The calculation method of the above-ground dry matter nitrogen production efficiency refers to the reference (Song Shiyun. QTL Mapping and Candidate Gene Prediction of Barley under Low Nitrogen Stress [J]), and an independent samples t-test was performed. The results are as Figure 4 shown. It can be seen that the above-ground dry matter nitrogen production efficiency of the lines with the genotype of 'CN4027' is significantly higher than that of the lines with the genotype of 'Fleet'. This indicates that Qanutedm.sau-3H indeed has the effect of significantly improving the above-ground dry matter nitrogen production efficiency of barley.
[0072] The embodiments described above are only descriptions of the preferred modes of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. Use of a molecular marker tightly linked to the QTL Qanutedm.sau-3H for nitrogen production efficiency of aboveground dry matter in barley in the following A1 or A2: A1. Detection of QTL Qanutedm.sau-3H for dry matter nitrogen production efficiency in barley shoots; A2. Early identification or selection of barley varieties with high aboveground dry matter nitrogen production efficiency; The molecular marker and the QTL Qanutedm.sau-3H for nitrogen production efficiency of dry matter in the aboveground part of barley are co-localized on the long arm of chromosome 3H of the barley genome; The molecular marker is located at the 121st base of the nucleotide sequence shown in SEQ ID NO.1, and there is an A / G mutation; The barley aerial part dry matter nitrogen production efficiency QTL Qanutedm.sau-3H is located in the 624.10-637.56 Mbp region on chromosome 3H.
2. A KASP primer set targeting a molecular marker tightly linked to the QTL Qanutedm.sau-3H for nitrogen production efficiency of aboveground dry matter in barley, characterized in that: The KASP primer set includes primers as shown in SEQ ID NO. 2-4; The molecular marker and the QTL Qanutedm.sau-3H for nitrogen production efficiency of dry matter in the aboveground part of barley are co-localized on the long arm of chromosome 3H of the barley genome; The molecular marker is located at the 121st base of the nucleotide sequence shown in SEQ ID NO.1, and there is an A / G mutation; The barley aerial part dry matter nitrogen production efficiency QTL Qanutedm.sau-3H is located in the 624.10-637.56 Mbp region on chromosome 3H.
3. Use of the KASP primer set according to claim 2 in any of the following: B1. Detection of QTL Qanutedm.sau-3H for dry matter nitrogen production efficiency in barley shoots; B2. Early identification or screening of barley varieties with high aboveground dry matter nitrogen production efficiency; B3. Preparation of reagents, kits or chips for detecting the QTL Qanutedm.sau-3H for dry matter nitrogen production efficiency in barley shoots; The barley aerial part dry matter nitrogen production efficiency QTL Qanutedm.sau-3H is located in the 624.10-637.56 Mbp region on chromosome 3H.
4. A kit for detecting the QTL Qanutedm.sau-3H for nitrogen production efficiency of dry matter in barley shoots, characterized in that: The kit comprises the KASP primer set according to claim 2; the barley aerial dry matter nitrogen production efficiency QTL Qanutedm.sau-3H is located in the 624.10-637.56 Mbp region on chromosome 3H.
5. A method for detecting QTL Qanutedm.sau-3H for dry matter nitrogen production efficiency in barley shoots, characterized in that: The steps include: Using the genomic DNA of the plant to be tested as a template, performing fluorescence quantitative PCR amplification using the KASP primer set described in claim 2, and making a determination based on the fluorescence reading result; The plants in which the fluorescent group labeled by SEQ ID NO. 2 was read were identified as plants containing the QTL Qanutedm.sau-3H for the nitrogen production efficiency of dry matter in the aboveground parts of barley; the plants in which the fluorescent group labeled by SEQ ID NO. 3 was read were identified as plants not containing the QTL Qanutedm.sau-3H for the nitrogen production efficiency of dry matter in the aboveground parts of barley; The barley aerial part dry matter nitrogen production efficiency QTL Qanutedm.sau-3H is located in the 624.10-637.56 Mbp region on chromosome 3H.
6. The method according to claim 5, characterized in that The reaction system of the fluorescent quantitative PCR is: 5 μL Master Mix, 5 ng template DNA, 1.4 μL mixed primers, and ddH2O added to a total volume of 10 μL; The mixed primer is obtained by mixing 10 ng / μL of the primer shown in SEQ ID NO.2, 10 ng / μL of the primer shown in SEQ ID NO.3, 10 ng / μL of the primer shown in SEQ ID NO.4 and ddH2O in a volume ratio of 6:6:15:
23.
7. The method according to claim 5, characterized in that The fluorescent quantitative PCR reaction procedure was as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing / extension at 61°C for 60 s, for a total of 10 cycles; denaturation at 94°C for 20 s, annealing / extension at 55°C for 60 s, for a total of 26 cycles.
Citation Information
Patent Citations
InDel molecular marker closely linked with barley P3G and C3G synthetic major QTL (quantitative trait loci), and application thereof
CN109517921A
Single nucleotide polymorphism (SNP) molecular marker linked with maximum root length QTL QMrl.sau-3D of wheat and application of SNP molecular marker
CN114807429A