KASP molecular marker related to soybean fresh pod length and primer and application of KASP molecular marker

Abstract

The invention discloses a KASP molecular marker related to the length of fresh edible pods of soybeans as well as primers and application of the KASP molecular marker, and belongs to the field of molecular genetic breeding. The nucleotide sequence of the pod length KASP molecular marker is as shown in SEQ ID NO. 1. The KASP marker disclosed by the invention can be used for quickly and efficiently identifying the pod length of the soybean to be detected, and the breeding efficiency of the fresh soybean can be greatly improved.

Description

Technical Field

[0001] The invention relates to the technical field of molecular genetic breeding, and relates to a KASP molecular marker related to soybean fresh pod length, a primer and an application thereof. Background Art

[0002] Fresh soybeans (Glycine max (L.) Merill), commonly known as edamame, are delicate and nutritious. They are rich in protein, unsaturated fatty acids, vitamins, plant fiber, plant hormones, calcium, iron, phosphorus and other minerals. They are easily absorbed and utilized by the human body, and play an important role in regulating people's dietary structure and improving nutritional status. Fresh soybean varieties have high requirements on the appearance and quality of pods and seeds, and usually require larger pods and seeds. The length of fresh soybean pods is closely related to the yield of fresh soybeans. Therefore, screening fresh soybean varieties with longer pods is of great significance to increasing the yield of fresh soybeans and improving economic benefits.

[0003] At present, most of the soybeans grown for fresh consumption are those with pods that are 80%-90% full during the growth period from R6 (full grain filling period) to R7 (early maturity period). They can also be harvested as dry grain soybeans after maturity. There are relatively few varieties of soybeans specifically grown for fresh consumption. The length and width of the pods are important components of the pod storage capacity, which is a limiting factor for the size of the grains. Breeding varieties of fresh soybeans with longer pods has a promising future. KASP (kompetitive allelespecific PCR) markers are low-cost, high-throughput molecular markers developed based on SNP and Indel sites, which can be used for rapid detection of a small number of sites and a large number of samples. Using GWAS (Genome-wide association study) to mine QTL sites significantly associated with the pod length of fresh soybeans, and developing KASP markers based on significant sites, the target sites can be identified in the early stages of variety breeding, which can shorten the breeding cycle and save time and effort. Summary of the invention

[0004] In view of this, the object of the present invention is to provide a KASP molecular marker related to fresh soybean pod length and application thereof.

[0005] Another object of the present invention is to provide a primer combination of the molecular marker and its application.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] A KASP molecular marker associated with fresh soybean pod length, wherein the nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.1, and there is a T / A base mutation at position 151 of the sequence shown in SEQ ID NO.1, wherein the long pod genotype is A, and the short pod genotype is T.

[0008] A primer combination for amplifying the KASP molecular marker according to claim 1, the primer combination comprising the following primers: KASP42138365F1-FAM: SEQ ID NO.2,

[0009] KASP42138365F2-HEX: SEQ ID NO.3,

[0010] Reverse primer R: SEQ ID NO.4.

[0011] The KASP molecular marker or the reagent for detecting the KASP molecular marker is used in any of the following applications: A. Application in identifying the length of fresh soybean pods;

[0012] Application of B in improving fresh soybean germplasm resources;

[0013] Application of C in cultivating high-yield fresh edible soybeans.

[0014] As a preferred embodiment of the present invention, the reagent for detecting the KASP molecular marker is the primer combination of the present invention.

[0015] A method for identifying the pod length of fresh soybeans, detecting the 151st base genotype of the KASP molecular marker in the genomic DNA of the fresh soybean sample to be tested, wherein the genotype is A, and the plant is determined to have a long pod length; the genotype is T, and the plant is determined to have a short pod length.

[0016] As a preferred embodiment of the present invention, the method comprises the following steps: using the genomic DNA of the fresh soybean sample to be tested as a template, performing fluorescent quantitative PCR amplification using the primer combination, and performing genotyping according to the fluorescence detection result of the obtained amplification product; if the sample PCR product only detects the fluorescent signal corresponding to KASP42138365F1-FAM, the genotype of the detection site is T, and it is determined to be a short pod length plant; if the sample PCR product only detects the fluorescent signal corresponding to KASP42138365F2-HEX, the genotype of the detection site is A, and it is determined to be a long pod length plant.

[0017] As a further preference of the present invention, the PCR reaction system is as follows:

[0018]

[0019] The primer mixture is a mixed solution of the primer combination described in claim 2.

[0020] As a further preference of the present invention, the PCR amplification procedure is:

[0021] First cycle

[0022]

[0023] Second cycle

[0024]

[0026] The beneficial effects of the present invention are as follows: the present invention develops a KASP molecular marker significantly correlated with the length of fresh soybean pods, which can be used to determine the length of fresh soybean pods, and has the characteristics of simple operation and low cost. It is beneficial to cultivate high-yield and high-quality fresh soybean varieties, assist soybean molecular breeding, improve breeding efficiency, shorten breeding cycle, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The Manhattan plot of the genome-wide association analysis of soybean pod length in the present invention;

[0028] Figure 2 This is a typing diagram of different fresh-edible soybean germplasms using the marker KASP42138365 in Example 3 of the present invention; the small circle in the upper left corner represents the short-pod fresh-edible soybean germplasm with a genotype of (T / T), the small circle in the lower right corner represents the long-pod fresh-edible soybean germplasm with a genotype of (A / A), the small circle in the middle represents the soybean germplasm with a genotype of (T / A), and the small circle in the lower left corner represents the no-template control NTC. DETAILED DESCRIPTION

[0029] In order to make the purpose and technical solution of the present invention more clearly understood, the present invention is further described below in conjunction with the accompanying drawings and embodiments.

[0030] Example 1 Screening for SNP sites associated with soybean pod length

[0031] 1. Test materials

[0032] The embodiment of the present invention uses 300 collected and preserved soybean germplasm resources as materials, and is planted in the experimental base of Jiangsu Academy of Agricultural Sciences in Lishui District, Nanjing City in the spring of 2022. In the R6 period, the soybean pod length is measured, and the measurement results are shown in Table 1.

[0033] Table 1 Statistics of soybean germplasm resources names and pod lengths

[0034]

[0035]

[0036]

[0037]

[0038]

[0039] 2. Genome-wide association analysis of soybean pod length

[0040] DNA was extracted from the leaves of the test materials in Table 1 using a soybean genomic DNA extraction kit (purchased from Tiangen Company).

[0041] In the present invention, the SNP marker information of the natural population used for GWAS analysis comes from the previous resequencing work of the research group, which contains a total of 2777,022 SNPs. The whole genome association analysis was performed using a mixed linear model and the GAPIT package of R software. At the same time, P ≤ 1 / 2777,022 = 3.60E-7, -log 10 P ≥ 6.4 was the significant threshold. 10 When P≥6.4, (Table 2, Figure 1 ).

[0042] Table 2 Information on SNP loci associated with soybean pod length

[0043]

[0044] Example 2 Development of pod length-related KASP markers

[0045] Sequences of 150 bp in length were selected in the upstream and downstream directions of 42138365 bp on chromosome S06 of the soybean genome to obtain a 301 bp sequence, and the 301 bp nucleotide sequence is shown in SEQ ID NO: 1. The molecular marker is located at 42138365 bp on chromosome S06 of the soybean genome, which corresponds to position 151 of SEQ ID NO: 1, and the nucleotide at this position is T or A.

[0046] Using the Primerblast function of NCBI, primers were designed based on the soybean pod length significantly associated SNP site S06_42138365 (T / A), and two forward primers KASP42138365F1, KASP42138365F2 and a universal reverse primer KASP42138365R were designed. The nucleotide sequences are as follows:

[0047] KASP42138365F1:GTTAGGTAAGTATTTCTCTTT

[0048] KASP42138365F2:GTTAGGTAAGTATTTCTCTTA

[0049] KASP42138365R:TTGACATAAGTGATAAT

[0050] The KASP primers are designed based on the genotype variation of the long-pod and short-pod plants at position 42370445 of chromosome S06, wherein the long-pod genotype is A and the short-pod genotype is T.

[0051] The 5' short FAM fluorescent linker sequence of the KASP42138365F1 primer and the 5' short HEX fluorescent linker sequence of the KASP42370445F2 primer are as follows:

[0052] KASP42138365F1-FAM: GAAGGTGACCAAGTTCATGCT GTTAGGTAAGTATTTCTCTTT

[0053] (SEQ ID NO.2, the underlined part is the FAM fluorescent tag sequence)

[0054] KASP42138365F2-HEX: GAAGGTCGGAGTCAACGGATT GTTAGGTAAGTATTTCTCTT A (SEQ ID NO. 3, where the underlined part is the HEX fluorescent tag sequence)

[0055] Reverse primer R: TTGACATAAGTGATAAT (SEQ ID NO. 4).

[0056] Example 3 Pod length KASP marker genotyping and pod length identification

[0057] Dissolve the synthesized KASP42138365F1-FAM, KASP42138365F2-HEX and reverse primer R in ddH2O to a concentration of 10 μM, and then prepare a 50 μL primer mixture according to KASP42138365F1-FAM (6 μL), KASP42138365F2-HEX (6 μL), reverse primer R (15 μL), and ddH2O (23 μL). Use the genomic DNA of various soybean germplasm resources obtained in step 2 as a template and perform PCR reactions according to the following reaction system and procedures. For the negative control, ddH2O was used instead of genomic DNA for reaction.

[0058] PCR reaction system:

[0059]

[0060] PCR amplification procedure:

[0061] First cycle

[0062]

[0063] Second cycle

[0064]

[0065] The amplified products were subjected to fluorescence detection. If only the fluorescence signal corresponding to KASP42138365F1-FAM was detected in the sample PCR product, the genotype of the detection site was T, and it was determined to be a short pod length plant; if only the fluorescence signal corresponding to KASP42138365F2-HEX was detected in the sample PCR product, the genotype of the detection site was A, and it was determined to be a long pod length plant.

[0066] The developed KASP markers were used to amplify and genotype 27 soybean germplasms. The results are shown in Table 3. Figure 2 As shown, molecular markers can clearly distinguish the two genotypes.

[0067] Table 3 Pod length and genotyping results of 27 soybean germplasms

[0068] serial number Pod length (mm) genotype serial number Pod length (mm) genotype M3A00102511 52.93 A / A M3A00101266 56.23 A / A M3A00102549 46.63 T / T M3A00101305 54.40 A / A M3A00101391 56.64 A / A M3A00102398 54.29 A / A M3A00101344 40.53 T / T M3A00101394 44.36 T / A M3A00102585 38.13 T / T M3A00102394 52.67 A / A M3A00102603 40.59 T / T M3A00102516 35.09 T / T M3A00101446 55.24 A / A M3A00101323 54.26 A / A 6-77 56.72 A / A M3A00101394 50.26 A / A C14 60.27 A / A M3A00102602 52.54 A / A M3A00102609 55.28 A / A ZDD19784 64.58 A / A M3A00102620 54.05 A / A M3A00102572 44.38 T / T M3A00102351 46.74 T / A M3A00102574 57.17 A / A M3A00102413 60.25 A / A M3A00102499 47.87 TA / M3A00102577 57.90 A / A

[0069] The above description is only a preferred embodiment of the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A KASP molecular marker associated with fresh soybean pod length, characterized in that: The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.

1. There is a T / A base mutation at position 151 of the sequence shown in SEQ ID NO.1, wherein the long pod genotype is A and the short pod genotype is T.

2. A primer combination for amplifying the KASP molecular marker described in claim 1.

3. The primer combination according to claim 2, characterized in that: The primer combination consists of the following primers: KASP42138365F1-FAM: SEQ ID NO.2, KASP42138365F2-HEX: SEQ ID NO.3, Reverse primer R: SEQ ID NO.

4.

4. Use of the KASP molecular marker according to claim 1 or a reagent for detecting the KASP molecular marker according to claim 1 in any of the following: Application of A in identifying the length of fresh soybean pods; Application of B in improving fresh soybean germplasm resources; Application of C in cultivating high-yield fresh edible soybeans.

5. The use according to claim 3, characterized in that: The reagent for detecting the KASP molecular marker described in claim 1 is the primer combination described in claim 2 or 3.

6. A method for identifying the length of fresh soybean pods, characterized in that: The 151st base genotype of the KASP molecular marker of claim 1 in the genomic DNA of the fresh soybean sample to be tested is detected, wherein the genotype is A, which is determined to be a long-pod-length plant; the genotype is T, which is determined to be a short-pod-length plant.

7. The method according to claim 6, characterized in that The method comprises the following steps: using the genomic DNA of the fresh soybean sample to be tested as a template, performing fluorescence quantitative PCR amplification using the primer combination described in claim 2 or 3, and performing genotyping according to the fluorescence detection result of the obtained amplified product; if the sample PCR product only detects the fluorescence signal corresponding to KASP42138365F1-FAM, the genotype of the detection site is T, and it is determined to be a short pod length individual plant; if the sample PCR product only detects the fluorescence signal corresponding to KASP42138365F2-HEX, the genotype of the detection site is A, and it is determined to be a long pod length individual plant.

8. The method according to claim 7, characterized in that The PCR reaction system is as follows: The primer mixture is a mixed solution of the primer combination according to claim 2.

9. The method according to claim 7, characterized in that: The PCR amplification program is: First cycle Second cycle

Images