Self-powered biosensor for detecting patulin and preparation method thereof
By constructing an electrochemical/colorimetric dual-mode sensor based on gold nanoparticles/modified Prussian blue complex, combined with DNA Walker and catalytic hairpin self-assembly technology, the high cost and low sensitivity of detection penicillin in the prior art is solved. , achieving high sensitivity, specificity and accurate detection effects.
Patent Information
- Application Number
- CN202411072200.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-06
- Publication Date
- 2025-02-18
AI Technical Summary
The prior art is used to detect penicillin with high operating costs, expensive instruments, high processing costs, and low sensitivity, making it difficult to achieve high sensitivity, specificity and accurate detection.
Electrochemical/colorimetric dual-mode sensor constructed based on gold nanoparticles/modified Prussian blue complex AuNPs/PB, carbon cloth, DNA strand and biological enzymes, through DNA Walker, catalytic hairpin self-assembly and rolling amplification reaction Perform signal amplification to realize the preparation of self-energized biosensors.
It realizes high sensitivity, specificity and accurate detection of penicillin, reduces detection costs, simplifies the operation process, and improves the rapidity and sensitivity of detection.
Smart Images
Figure CN119470575A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of biosensors, and in particular to a self-powered biosensor for detecting patulin and a preparation method thereof. Background Art
[0002] Patulin is a potentially toxic fungal metabolite that is widely present in a variety of fruits and foods, seriously affecting the direct consumption of fruits and the use of processed products in my country. For areas where bananas are the main product, the presence of patulin in bananas is quite deadly. Patulin is caused by fungi, especially Penicillium expansum, which is a common post-harvest pathogen of bulk and specialty fruits. It produces a large amount of patulin while causing fruit rot. Patulin has an irritating effect on the stomach, causing nausea and vomiting. Toxicological tests have shown that patulin has toxicological effects such as affecting fertility, carcinogenicity and immunity, and is also a neurotoxin. Patulin is also teratogenic and has great harm to the human body. It can cause damage to the respiratory and urinary systems, causing nerve paralysis, pulmonary edema, and renal failure. Patulin is widely present in various moldy fruits and silage, causing great interference and harm, so its accurate detection is very important for human health. Currently, for the detection methods of patulin, solid phase extraction-ultra-high performance liquid chromatography-tandem mass spectrometry and liquid chromatography-mass spectrometry have high operating costs, expensive instruments, and high processing costs; thin-layer chromatography is easily interfered with, difficult to operate, and has low sensitivity.
[0003] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention and should not be regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the invention
[0004] The object of the present invention is to provide a self-powered biosensor for detecting patulin and a preparation method thereof, so as to achieve high-sensitivity, specificity and accurate detection of patulin.
[0005] To achieve the above objectives, the present invention provides a method for preparing a self-powered biosensor for detecting patulin, wherein the biosensor is based on a gold nanoparticle / modified Prussian blue complex AuNPs / PB, carbon cloth, DNA chain and biological enzyme to construct an electrochemical / colorimetric dual-mode sensor cathode and anode.
[0006] Preferably, in the above technical solution, the self-powered biosensor prepared by the method includes an anode, a cathode and an electrolyte, the anode is an AuNPs / PB bioanode, the cathode is an AuNPs / PB / DNA chain biosensor, and the electrolyte includes glucose, methylene blue, and PBS buffer solution.
[0007] Preferably, in the above technical solution, the preparation of the bioanode includes: taking 30-50 μL AuNPs / PB and dropping it on the surface of the carbon cloth electrode, drying it at 35-40°C for 2-4 hours, dropping it on 20-50 μL 3-5 mg / mL glucose oxidase and incubating it for 12-24 hours to obtain the bioanode.
[0008] Preferably, in the above technical solution, the preparation of AuNPs / PB includes:
[0009] (1) 750-950 mg of Prussian blue and 150-300 mg of 1,3,5-benzenetricarboxylic acid are placed in 20-60 mL of water, stirred for 1-10 h, and then allowed to stand for 8-24 h, centrifuged, washed with water for multiple times, and freeze-dried to obtain modified Prussian blue;
[0010] (2) The modified Prussian blue was dissolved in the gold nanoparticle solution with a mixed mass and volume ratio of mg / mL of 3-8:1, and AuNPs / PB was obtained by ultrasonic dispersion.
[0011] Preferably, in the above technical solution, the preparation of the cathode includes:
[0012] (1) 30-50 μL of AuNPs / PB was drop-coated on the surface of the carbon cloth electrode, dried at 35-40°C for 2-4 h, immersed in 5-10 mg / mL EDC / NHS solution (1-(3-dimethylpropyl)-3-ethylcarbodiimide hydrochloride / N-hydroxysuccinimide solution) for 0.5-1 h, rinsed with water, and then 10-30 μL of capture probe was drop-coated. After incubation at 3-6°C for 10-15 h, 20-50 μL of 0.5-2 mM hexamercaptoethanol was added for reaction for 0.5-1 h, and the excess hexamercaptoethanol (MCH) was removed by washing;
[0013] (2) 20-50 μL of the rolling amplification and catalytic hairpin self-assembly complex product is dropped onto the electrode surface, incubated at 35-40° C. for 1-2 h, and then washed with ultrapure water to obtain the cathode of the biosensor.
[0014] Preferably, in the above technical solution, the preparation of the rolling amplification and catalytic hairpin self-assembly composite product comprises:
[0015] 1) Preparation of catalytic hairpin self-assembly products: 10-20 μL of different concentrations of patulin and 10-20 μL of 10 mM Mg 2+ and 100-120 μL of DNA walker, incubate at 35-40°C for 1-2 hours, adsorb and aspirate the supernatant with a magnet; add 40-70 μL of H1 and H2 to the supernatant, incubate for 1-2 hours, and catalyze the hairpin self-assembly product;
[0016] 2) Preparation of rolling circle amplification and catalytic hairpin self-assembly complex products: Add 40-60 μL of DNA-Cyc chain, 2-10 μL of T4 DNA Ligase, and 15-30 μL of 10X ligase buffer to the electrolyte of step 1), incubate at 35-40°C for 3-5 hours, then add 10-20 μL of phi29 DNA Polymersae, 20-30 μL of 10X reaction buffer, and 20-30 μL of dNTPs, and incubate at 35-40°C for 1-2 hours to obtain rolling circle amplification and catalytic hairpin self-assembly complex products.
[0017] Preferably, in the above technical scheme, the preparation of the DNA Walker includes: mixing 10-20 μL of 1 μM Walker chain and 1 μM DNA-Lock chain, incubating at 35-40°C for 1-2 hours, adding 50-70 μL of 1 μM DNA-Str chain and 20-30 μL of 5 mg / mL nanogold magnetic bead complex, incubating at 3-6°C for 10-12 hours, and washing with PBS solution to obtain DNA Walker.
[0018] Preferably, in the above technical solution, the preparation of the nanomagnetic bead complex comprises: 3 O 4 Magnetic beads and 4-6 mL 1% HAuCl 4 The mixture was mixed and shaken for 0.5-1 h, and then 4-6 mL of 2% sodium citrate was added and shaken slowly for 4-10 h to obtain a gold nanoparticle magnetic bead complex.
[0019] An application of the self-powered biosensor as described above, wherein the self-powered biosensor is used to detect patulin.
[0020] A method for detecting patulin using the self-powered biosensor for detecting patulin as described above, the method comprising the following steps:
[0021] (1) Measure the instantaneous current of the sensor when the target penicillin is not introduced;
[0022] (2) After adding patulin, the instantaneous current of the sensor containing different concentrations of patulin was measured;
[0023] (3) In the colorimetric mode, when patulin is not introduced, the dual-electrode system is placed in the electrolyte and the color RGB Blue value of the electrolyte is recorded; after patulin is introduced, the dual-electrode system is placed in the electrolyte and the color RGB Blue value of the electrolyte is recorded;
[0024] The supporting electrolyte of the biosensor constructed above is a 0.01M PBS buffer solution containing 5mM glucose, 500μM methylene blue, and pH 7.4.
[0025] Compared with the prior art, the present invention has the following beneficial effects:
[0026] (1) The self-powered biosensor prepared by the method of the present invention has a detection process different from the previous electrochemical method for detecting patulin. The biosensor introduces nucleic acid amplification, uses patulin as a promoter, and triggers nucleic acid cascade amplification through patulin. This realizes a simple, convenient, rapid, sensitive, and highly selective dual-mode detection of patulin in banana.
[0027] (2) The self-powered biosensor prepared by the method of the present invention has a detection process that is different from other three-electrode systems for electrochemical detection. The self-powered biosensor only needs two electrodes, namely the positive and negative electrodes of the sensor, to achieve detection without applying an additional power supply. It can effectively prevent the electroactive substances that are prone to redox from reacting on the electrode surface, thereby improving the anti-interference ability of the sensor.
[0028] (3) The biosensor of the present invention uses DNA Walker, catalytic hairpin self-assembly, and rolling amplification reaction to amplify signals, thereby increasing the loading capacity of the electrode electron acceptor methylene blue, effectively amplifying the detection signal, and significantly reducing the detection limit of patulin.
[0029] (4) The self-powered biosensor of the present invention uses a multimeter to measure instantaneous current and software to read electrolyte color changes (RGB Blue values) to perform dual-mode detection of patulin, which has the advantages of high sensitivity, high selectivity, low cost, and simple operation.
[0030] (5) In the biosensor of the present invention, the gold nanoparticle magnetic bead complex has a higher DNA binding efficiency than ordinary magnetic beads, thereby improving the utilization rate of DNA, and has a higher biological activity than ordinary magnetic beads, which is more conducive to nucleic acid amplification.
[0031] (6) In the biosensor of the present invention, AuNPs / PB has the advantages of high electrocatalytic activity, large specific surface area, and good biocompatibility. As a substrate material, it can bind more amplification products to achieve sensitive detection of the target penicillin, greatly improving the detection sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] Figure 1 is a schematic diagram of the cathode and anode assembly process of the self-powered biosensor according to the present invention;
[0033] Figure 2 Schematic diagram of a device for sensitively detecting patulin by a self-powered biosensor according to the present invention;
[0034] Figure 3Schematic diagram of the principle of cathode recognition and detection of patulin by the self-powered biosensor according to the present invention;
[0035] Figure 4 is a DPV diagram of the self-powered biosensor with or without a target object according to the present invention;
[0036] Figure 5 is a standard curve diagram of the cathode DPV response value of the target object and the concentration of patulin according to the self-powered biosensor of the present invention;
[0037] Figure 6 is a standard curve diagram of the cathode DPV response value of the self-powered biosensor without a target and the concentration of patulin according to the present invention;
[0038] Figure 7 is a diagram of an example of self-powered biosensor assembly measurement according to the present invention;
[0039] Figure 8 is an example of reading RGB Blue values according to the colorimetric test of the present invention. DETAILED DESCRIPTION
[0040] The specific implementation modes of the present invention are described in detail below in conjunction with the accompanying drawings, but it should be understood that the protection scope of the present invention is not limited by the specific implementation modes.
[0041] Unless explicitly stated otherwise, throughout the specification and claims, the term “comprise” or variations such as “include” or “comprising”, etc., will be understood to include the stated elements or components but not to exclude other elements or components.
[0042] 1. A self-powered biosensor for detecting patulin
[0043] like Figure 1-3 As shown, a self-powered biosensor for detecting patulin is provided. The biosensor is based on a gold nanoparticle / modified Prussian blue complex AuNPs / PB, carbon cloth, DNA chain and biological enzyme to construct an electrochemical / colorimetric dual-mode sensor cathode and anode. The self-powered biosensor includes an anode, a cathode and an electrolyte. The anode is an AuNPs / PB bioanode, the cathode is an AuNPs / PB / DNA chain biosensor, and the electrolyte includes glucose, methylene blue and PBS buffer solution.
[0044] 2. Preparation of self-powered biosensor for detection of patulin
[0045] A method for preparing a self-powered biosensor for detecting patulin comprises the following steps:
[0046] 1. Preparation of AuNPs / PB
[0047] (1) Preparation of modified Prussian blue: 859 mg of Prussian blue and 210 mg of 1,3,5-benzenetricarboxylic acid were placed in 40 mL of water, stirred for 6 h, allowed to stand for 12 h, centrifuged, washed three times with ultrapure water, and freeze-dried to obtain modified Prussian blue.
[0048] (2) Preparation of AuNPs / PB: 5 mg of modified Prussian blue was dissolved in 1 mL of gold nanoparticle solution and dispersed by ultrasonication to obtain AuNPs / PB.
[0049] 2. Preparation of AuNPs / PB biosensor anode
[0050] 40 μL (AuNPs / PB) was drop-coated on the surface of the carbon cloth electrode, dried at 37 °C for 3 h, and then drop-coated with 30 μL 5 mg / mL glucose oxidase (GOD) and incubated for 12 h. After washing with ultrapure water, it was stored at 4 °C.
[0051] 3. Preparation of AuNPs / PB / DNA chain biosensor cathode
[0052] (1) Modification of the biosensor cathode: 40 μL of AuNPs / PB was dropped onto the carbon cloth, dried at 37 °C for 3 h, immersed in 10 mg / mL EDC / NHS solution for 1 h, rinsed with ultrapure water, and then 30 μL of capture probe was dropped onto the carbon cloth. The mixture was incubated at 4 °C for 15 h, and 30 μL of 1 mM MCH was added for reaction for 0.5 h. The excess MCH was removed by washing.
[0053] (2) Preparation of gold nanoparticle magnetic bead complex: 4 mL of Fe 3 O 4 Magnetic beads and 4 mL 1% HAuCl 4 The mixture was mixed and shaken for 1 h, and then 4 mL of 2% sodium citrate was added and slowly shaken for 4 h to obtain a gold nanoparticle magnetic bead complex.
[0054] (3) Preparation of DNA Walker product: 12.5 μL DNA-Walker chain and 12.5 μL DNA-Lock chain were mixed at 37°C and incubated for 2 h to obtain WL complex. 50 μL DNA-Str chain was annealed at 95°C for 5 min. The WL complex was mixed with the annealed DNA-Str chain and 25 μL 5 mg / mL gold nanoparticle magnetic bead complex was added, incubated at 4°C for 12 h, adsorbed by magnet and dispersed in 100 μL PBS to obtain DNA Walker. 10 μL of different concentrations of patulin were mixed with 20 μL 10 mM Mg 2+ Add to DNA Walker, react at 37°C for 2 hours, and take the supernatant to obtain the DNA Walker product.
[0055] (4) Preparation of CHA (catalyzed hairpin self-assembly) product: 50 mL each of H1 and H2 were added to the supernatant obtained in step (4) and incubated at 37°C for 2 h.
[0056] (5) Preparation of rolling circle amplification and catalytic hairpin self-assembly complex products: 50 μL of DNA-Cyc chain, 2 μL of T4 DNA Ligase, and 15.2 μL of 10X ligase buffer were added to the electrolyte of step (4), incubated at 37°C for 4 h, and then added to a mixture containing 10 μL of phi29 DNA Polymersae, 30 μL of 10X reaction buffer, and 20 μL of dNTPs, and incubated at 37°C for 2 h to obtain rolling circle amplification and catalytic hairpin self-assembly complex products.
[0057] (6) Preparation of biosensor cathode: 20 μL of the rolling amplification and catalytic hairpin self-assembly complex product was drop-coated on the surface of the modified biocathode electrode, incubated at 37°C for 2 h, washed with ultrapure water to obtain the biosensor, and stored at 4°C for future use.
[0058] 3. Use of the self-powered biosensor of the present invention for the detection of patulin
[0059] 1. Construction and measurement of patulin biosensor: When the target patulin is not introduced, the instantaneous current of the sensor is measured; after adding patulin, the instantaneous current of the sensor containing different concentrations of patulin is measured. In the colorimetric mode, when patulin is not introduced, the two-electrode system is placed in the electrolyte for 20 minutes, and the color of the electrolyte (RGB Blue value) is recorded; after patulin is introduced, the two-electrode system is placed in the electrolyte for 20 minutes, and the color of the electrolyte (RGB Blue value) is recorded.
[0060] 2. Draw a standard curve of instantaneous current and patulin concentration and establish a patulin detection method.
[0061] 3. Electrochemical characterization of biosensors
[0062] To verify the sensor's reactivity, the sensor is subjected to a DPV test. Figure 4 As shown, when the sensor is not introduced with the target for amplification, the DPV peak current of the sensor is small; when the sensor is combined with the target for amplification, the DPV peak current of the sensor is much larger than the peak current without the target, indicating the successful assembly of the sensor.
[0063] 4. Characterization of the performance of biosensor cathode
[0064] like Figure 4, DPV tests were performed on different concentrations of patulin. When the target was not present, there was only a capture probe on the sensor cathode, DNA Walker could not be started, and catalytic hairpin self-assembly and rolling amplification could not be generated. The sensor cathode received fewer electrons, and the DPV of the sensor cathode was small at this time; as the concentration of the target increased, the DNA chains loaded on the electrode increased, and the DPV of the sensor cathode gradually increased.
[0065] like Figure 5 The DPV value showed a good linear relationship with the concentration of patulin in the range of 1ng / mL-0.05ag / mL, and the DPV linear equation was I=0.0000178565lg C+0.000939031(R 2 =0.993), and the detection limit was 0.0447 ag / mL (S / N=3).
[0066] 5. Performance characterization of biosensors
[0067] like Figure 6 , assemble the biosensor and use a multimeter to read the instantaneous current of different concentrations of penicillin. When the target does not exist, there is only a capture probe on the sensor cathode, DNA Walker cannot be started, and catalytic hairpin self-assembly and rolling amplification cannot be generated. The sensor cathode receives fewer electrons, and the instantaneous current of the sensor is small at this time; as the concentration of the target increases, the DNA chain loaded on the electrode increases, and the instantaneous current of the sensor gradually increases. The linear equation of the instantaneous current is I S =2.35367lg C+42.89071(R 2 =0.995), and the detection limit was 0.044 ag / mL (S / N=3).
[0068] like Figure 7-8 As shown, a color change test was performed on different concentrations of patulin. When the target does not exist, there is only a capture probe on the cathode electrode, amplification cannot be performed, and the biocathode adsorbs less methylene blue. At this time, fewer electrons are conducted in the biosensor system, so less methylene blue is reduced, the color of the electrolyte is darker, and the corresponding RGB Blue value is smaller; as the concentration of the target increases, the biocathode adsorbs more methylene blue, more methylene blue is reduced, the color of the electrolyte gradually becomes lighter, and the corresponding RGB Blue value gradually increases. The linear equation for the RGB Blue value is Y=6.17977lg C+278.0254(R 2 =992).
[0069] The supporting electrolyte of the biosensor constructed above is a 0.01 M PBS buffer solution containing 5 mM glucose, 500 μM methylene blue, and pH 7.4.
[0070] Patulin aptamer sequence: 5'-GGCCCGCCAACCCGCATCATCTACACTGATATTTTACCTT-3'
[0071] DNA-Str chain:HS-(T)6GGCTAACCGCATG / rA / TCACTGATAGCCCGCG-3'
[0072] Walker chain: HS-(T) 42 GGTAAAATATCAGTGATCCGAGCCGGTCGAACA TGCGGGTTGGCGGG-3'
[0073] DNA-Lock strand: 5'-GGCCCGCCAACCCGCATCATCTACACTGATATTTT ACCTT-3'
[0074] H1: 5'-TGATAGCCCGCGGCGCGGCTATCT-3'
[0075] H2: 5'-AGATAGCCGCGCCGGCCGCCGGCTATCCACTCCACACCAAA CACACTCA-3'
[0076] DNA-Cyc strand: 5'-CTATCAACTCCACACCAAACACACCTCACGCGGG-3'
[0077] Capture probe: 5'-CGCGGGCTATCAGTGATT-SH
[0078] The foregoing description of specific exemplary embodiments of the present invention is for the purpose of illustration and demonstration. These descriptions are not intended to limit the present invention to the precise form disclosed, and it is clear that many changes and variations can be made based on the above teachings. The purpose of selecting and describing the exemplary embodiments is to explain the specific principles of the present invention and its practical application, so that those skilled in the art can realize and utilize various different exemplary embodiments of the present invention and various different selections and changes. The scope of the present invention is intended to be limited by the claims and their equivalents.
Claims
1. A self-powered biosensor for detecting patulin, characterized in that: The self-powered biosensor comprises an anode, a cathode and an electrolyte, wherein the anode is an AuNPs / PB bioanode, the cathode is an AuNPs / PB / DNA chain biosensor, and the electrolyte comprises glucose, methylene blue and PBS buffer solution.
2. A method for preparing a self-powered biosensor for detecting patulin as claimed in claim 1, characterized in that: The biosensor is based on a gold nanoparticle / modified Prussian blue complex AuNPs / PB, carbon cloth, DNA chain and biological enzyme to construct an electrochemical / colorimetric dual-mode sensor cathode and anode.
3. The method according to claim 2, characterized in that The preparation of the bioanode includes: taking 30-50 μL of AuNPs / PB and dropping it on the surface of the carbon cloth electrode, drying it at 35-40° C. for 2-4 hours, dropping it on 20-50 μL of 3-5 mg / mL glucose oxidase and incubating it for 12-24 hours to obtain the bioanode.
4. The method according to claim 3, characterized in that The preparation of AuNPs / PB includes: (1) 750-950 mg of Prussian blue and 150-300 mg of 1,3,5-benzenetricarboxylic acid are placed in 20-60 mL of water, stirred for 1-10 h, and then allowed to stand for 8-24 h, centrifuged, washed with water for multiple times, and freeze-dried to obtain modified Prussian blue; (2) The modified Prussian blue was dissolved in the gold nanoparticle solution with a mixed mass and volume ratio of mg / mL of 3-8:1, and AuNPs / PB was obtained by ultrasonic dispersion.
5. The method according to claim 2, characterized in that: The preparation of the cathode comprises: (1) 30-50 μL of AuNPs / PB was drop-coated on the surface of the carbon cloth electrode, dried at 35-40°C for 2-4 hours, immersed in 5-10 mg / mL EDC / NHS solution for 0.5-1 hour, rinsed with water, and then drop-coated with 10-30 μL of capture probe. After incubation at 3-6°C for 10-15 hours, 20-50 μL of 0.5-2 mM hexamercaptoethanol was added for reaction for 0.5-1 hour, and the excess hexamercaptoethanol was removed by washing; (2) 20-50 μL of the rolling amplification and catalytic hairpin self-assembly complex product is dropped onto the electrode surface, incubated at 35-40° C. for 1-2 h, and then washed with ultrapure water to obtain the cathode of the biosensor.
6. The method according to claim 5, characterized in that The preparation of the rolling amplification and catalytic hairpin self-assembly composite product comprises: 1) Preparation of catalytic hairpin self-assembly products: 10-20 μL of different concentrations of patulin and 10-20 μL of 10 mM Mg 2+ and 100-120 μL of DNA walker, incubate at 35-40°C for 1-2 hours, adsorb and aspirate the supernatant with a magnet; add 40-70 μL of H1 and H2 to the supernatant, incubate for 1-2 hours, and catalyze the hairpin self-assembly product; 2) Preparation of rolling circle amplification and catalytic hairpin self-assembly complex products: Add 40-60 μL of DNA-Cyc chain, 2-10 μL of T4 DNA Ligase, and 15-30 μL of 10X ligase buffer to the solution in step 1), incubate at 35-40°C for 3-5 hours, then add 10-20 μL of phi29 DNA Polymersae, 20-30 μL of 10X reaction buffer, and 20-30 μL of dNTPs, and incubate at 35-40°C for 1-2 hours to obtain rolling circle amplification and catalytic hairpin self-assembly complex products.
7. The method according to claim 6, characterized in that The preparation of the DNA Walker includes: taking 10-20 μL of 1 μM Walker chain and 1 μM DNA-Lock chain respectively, mixing, incubating at 35-40° C. for 1-2 hours, adding 50-70 μL of 1 μM DNA-Str chain and 20-30 μL of 5 mg / mL nanogold magnetic bead complex, incubating at 3-6° C. for 10-12 hours, washing with PBS solution, and obtaining the DNA Walker.
8. The method according to claim 7, characterized in that The preparation of the nano-magnetic bead complex comprises: mixing 2-4 mL of Fe3O4 magnetic beads with 4-6 mL of 1% HAuCl4 and oscillating for 0.5-1 h, then adding 4-6 mL of 2% sodium citrate, and slowly shaking for 4-10 h to obtain the nano-gold magnetic bead complex.
9. An application of the self-powered biosensor according to any one of claims 1 to 8, characterized in that: The self-powered biosensor is used to detect patulin.
10. A method for detecting patulin using the self-powered biosensor for detecting patulin as claimed in any one of claims 1 to 9, characterized in that: The method comprises the following steps: (1) Measure the instantaneous current of the sensor when the target penicillin is not introduced; (2) After adding patulin, the instantaneous current of the sensor containing different concentrations of patulin was measured; (3) In the colorimetric mode, when patulin is not introduced, the dual-electrode system is placed in the electrolyte and the color RGB Blue value of the electrolyte is recorded; after patulin is introduced, the dual-electrode system is placed in the electrolyte and the color RGB Blue value of the electrolyte is recorded; The supporting electrolyte of the biosensor constructed above is a 0.01M PBS buffer solution containing 5mM glucose, 500μM methylene blue, and pH 7.4.