Paper-based microfluidic chip and application thereof
By combining paper-based microfluidic chips with Mie scattering technology, the problems of high cost and complex operation of existing microfluidic chips for detecting the novel coronavirus have been solved, achieving low-cost, high-sensitivity, and rapid detection of the novel coronavirus S1 protein.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SOUTH CHINA HOSPITAL OF SHENZHEN UNIVERSITY
- Filing Date
- 2024-10-30
- Publication Date
- 2026-04-21
AI Technical Summary
Existing microfluidic chip methods for detecting the novel coronavirus are costly and complex to operate, making it difficult to achieve rapid, convenient, and large-scale screening and diagnosis, and the nucleic acid detection efficiency is low.
This invention employs a paper-based microfluidic chip combined with Mie scattering technology, using hydrophilic cellulose paper as a substrate. By covalently coupling carboxylated polystyrene magnetic beads and specific nucleic acid aptamers, it achieves rapid detection of the novel coronavirus S1 protein, utilizing changes in Mie scattering light signals for detection.
It enables low-cost, rapid, and highly sensitive detection of the novel coronavirus S1 protein, simplifies the operation process, allows non-professionals to quickly get started, and reduces detection costs and complexity.
Smart Images

Figure CN119470892B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to a paper-based microfluidic chip and its applications. Background Technology
[0002] The spike protein (S protein) is a glycoprotein extending from the cell membrane and is the most important surface protein of COVID-19, related to its infectivity. Composed of 1255 amino acid residues, it likely plays a crucial role in viral binding to host cell surface receptors and mediating membrane fusion and cell entry. Based on its structure and function, it can be divided into two functional units: the S1 and S2 protein subunits. S1 facilitates viral binding to host cell receptors and contains an important C-terminal receptor-binding domain (RBD), which is responsible for receptor binding.
[0003] Previous computer model analyses showed low homology between the spike proteins of the novel coronavirus and SARS, with only 76.47% amino acid sequence similarity. However, some gene regions of the RBD domains of both viruses exhibited high homology with SARS. Of the five key sites of SARS infection, one was retained by the novel coronavirus, while the remaining four underwent amino acid substitutions and changes. Four of the five key amino acids in the COVID-19 spike protein that bind to the ACE2 protein were altered, but the original structural conformation of the SARS virus spike protein interacting with ACE2 was maintained. This indicates that the novel coronavirus still infects and spreads through the same receptor and mechanism as SARS.
[0004] In large-scale community screening, screening technologies that directly detect the COVID-19 surface S protein are particularly important, providing reliable and strong evidence for quickly determining whether an individual is infected. Currently, the complete genome sequence of COVID-19 is available. Early diagnosis of suspected COVID-19 infection can be achieved by collecting samples from the upper respiratory tract (oropharynx and nasopharynx) and lower respiratory tract (tracheal suction, expectoration, or bronchoalveolar lavage) of suspected COVID-19 patients and performing RT-PCR. Conventional genetic diagnostic methods, based on reverse transcription PCR and Agrose gel electrophoresis, have low detection sensitivity, while quantitative PCR is expensive and not suitable for large-scale early screening, detection, and diagnosis.
[0005] Microfluidic chips are an emerging microfluidic analysis technology platform with advantages such as low cost, simple processing, and convenient use and portability. They have great application prospects in clinical diagnosis, food quality control, and environmental monitoring.
[0006] While microfluidic technology has the potential to reduce detection costs, the design and manufacture of some microfluidic chips can be expensive. Fully automated detection systems may require complex designs and additional hardware support, potentially increasing system complexity and cost. Furthermore, microfluidic chips based on nucleic acid detection may require optimizing sample lysis and nucleic acid extraction efficiency, limiting the application of this technology. In recent years, research on paper-based microfluidic chip technology has progressed rapidly. Using paper as a substrate to replace materials such as silicon, glass, and polymers, it will be deeply integrated with smartphones, open-source hardware, and 3D printing technology in the future, expanding its functionality and advancing into the POCT field. This is mainly due to its simple fabrication and low cost. More importantly, the use of hydrophilic cellulose paper to lay microchannels allows the surface capillary action of cellulose to drive the liquid to transfer water samples between the channels and each reaction unit, cleverly eliminating the need for a microfluidic sample introduction driving force device, greatly improving the practicality of microfluidic chip technology. Existing microfluidic systems may require professional operators and complex operating procedures, hindering rapid deployment and use. This invention simplifies the operating process and automates the design, enabling even non-professionals to quickly learn and use it. Furthermore, the production cost of commercially available microfluidic chips can be relatively high, especially when precision machining and special materials are required. This invention can reduce costs by using more cost-effective materials and manufacturing processes. Summary of the Invention
[0007] The purpose of this invention is to provide a paper-based microfluidic chip for detecting the novel coronavirus S1 protein based on Mie scattering light and a rapid detection method.
[0008] The technical solution adopted in this invention is:
[0009] In a first aspect, the present invention provides a microfluidic chip, comprising an inlet, a microreaction unit, a microfluidic chip channel, and a waste outlet, wherein the microreaction unit is connected through the microfluidic chip channel; the microreaction unit comprises magnetic beads and nucleic acid aptamers.
[0010] Preferably, the base plate of the microreaction unit is hydrophilic cellulose chromatography paper, used for coupling magnetic beads.
[0011] Preferably, a photoresist layer is provided on the side of the base plate of the microreaction unit.
[0012] Preferably, the photoresist layer is a negative photoresist layer.
[0013] Preferably, the negative photoresist layer is selected from SU-8 negative photoresist layer.
[0014] Preferably, the nucleic acid aptamer is a nucleic acid aptamer that specifically recognizes the novel coronavirus.
[0015] Preferably, the nucleic acid aptamer is a nucleic acid aptamer that specifically recognizes the S1 protein of the novel coronavirus.
[0016] Preferably, the nucleic acid aptamer comprises a sequence as shown in SEQ ID NO.1:GTCTTGCGGGGCGGCGGG TTGAGAGGA.
[0017] Preferably, the magnetic beads are carboxylated functional magnetic beads.
[0018] Preferably, the carboxylated functional magnetic beads include carboxylated polystyrene magnetic beads.
[0019] Preferably, the particle size of the carboxylated polystyrene magnetic beads is 3–8 μm.
[0020] A second aspect of the present invention provides a method for fabricating the microfluidic chip described in the first aspect of the present invention, comprising the following steps:
[0021] S1: Inject the magnetic beads through the injection port to fill the microchannels of the microfluidic chip, incubate at 20-30°C for 0.5-1.5 h, and elute the uncoupled magnetic beads with elution buffer;
[0022] S2: Inject the nucleic acid aptamer of the novel coronavirus S1 protein through the injection port to fill the microchannel of the microfluidic chip, incubate at 32-40°C for 1-3 hours, and elute the uncoupled nucleic acid aptamer with elution buffer.
[0023] Preferably, the elution solution includes, but is not limited to, PBS.
[0024] A third aspect of the present invention provides the application of the microfluidic chip described in the first aspect of the present invention in the detection of the novel coronavirus for non-diagnostic purposes or in the preparation of products for detecting the novel coronavirus.
[0025] A fourth aspect of the present invention provides a method for detecting the novel coronavirus for non-diagnostic purposes, comprising the step of detecting a sample to be tested using the microfluidic chip described in the first aspect of the present invention.
[0026] Preferably, the method specifically includes the following steps: injecting the sample to be tested through the injection port to fill the microchannel of the microfluidic chip, incubating at 32-40°C for 1-3 hours, measuring the change in scattered light intensity before and after incubation using a Mie scattering detection device, and calculating the novel coronavirus content in the sample to be tested.
[0027] Preferably, the specific steps of the Mie scattering detection are as follows: a light source λ < 10*D (D, the linear dimension of the microbead antibody) that meets the conditions for the formation of Mie scattering light is irradiated onto the surface of the microreaction layer. The change in the intensity of Mie scattering light before and after incubation is detected at a position with a certain angle θ of the incident light source. The content of the novel coronavirus in the sample to be tested can be determined, thus achieving the purpose of directly detecting the content of the novel coronavirus in the sample.
[0028] A fifth aspect of the present invention provides a product comprising the microfluidic chip described in the first aspect of the present invention.
[0029] Preferably, the product further includes a Mie scattering detection device.
[0030] The beneficial effects of this invention are:
[0031] This invention establishes a rapid detection method for the novel coronavirus S1 protein based on Mie scattering light using a paper-based microfluidic chip, employing Mie scattering combined with paper-based microfluidic chip technology. By pre-loading hydrophilic cellulose paper-based microfluidic chips as immunoreaction containers into the micro-reaction wells of multiple microfluidic chips, and using polystyrene microbeads covalently coupled to the nucleic acid aptamers of the novel coronavirus S1 protein within the microfluidic reaction wells as chip sensing and signal amplification elements, multiple reactions for the analysis and detection of the novel coronavirus S1 protein are integrated onto a single microfluidic chip. The change in the intensity of the Mie scattering light signal caused by the immunoagglutination reaction between the target analyte and the nucleic acid aptamer microbeads of the novel coronavirus S1 protein allows for rapid and highly sensitive detection of the novel coronavirus in samples within 1.5–3 hours without a culture and amplification process.
[0032] The combination of paper-based microfluidic chips and Mie scattering technology allows for the detection of novel coronavirus S1 protein bound to its nucleic acid aptamers on the paper-based microfluidic chip. After aggregation by latex microbeads, the morphological parameters such as surface particle size change significantly, making it easy to detect. Furthermore, irradiating the latex-sensitized aggregated novel coronavirus S1 protein nucleic acid aptamer particles with a fixed wavelength incident light source of 470-1000nm ensures that the wavelength of the scattered light is not easily affected by the incident wavelength. The Mie scattering theory can be used to process the intensity signal of the scattered light to obtain accurate values, which can be easily processed using current mature computer technology. Therefore, the establishment of novel coronavirus analysis technology by combining Mie scattering with paper-based microfluidic chip technology will undoubtedly have significant potential advantages and application development space. Attached Figure Description
[0033] Figure 1 This is a structural diagram of a paper-based microfluidic chip used for integrated detection.
[0034] Figure 2 This is a diagram showing the complete workflow of the immunoagglutination reaction unit on a paper-based microfluidic chip.
[0035] Figure 3 This is a cross-sectional side view of the immune substance agglutination and dispersion reaction before and after irradiation with incident light of a fixed wavelength.
[0036] Figure 4 This is a standard curve for COVID-19 testing.
[0037] Figure labels: 11. Syringe; 12. Sample inlet hose; 13. Sample inlet; 21. Incident light; 22. Scattered light; 31. Hydrophilic cellulose chromatography paper; 32. SU-8 negative photoresist layer; 41. Polystyrene microbeads binding to SARS-CoV-2 S1 protein; 42. Microreaction unit (5 mm in diameter, with branch channels communicating with the main microchannel); 5. Main channel of microfluidic chip; 6. Branch channel of microfluidic chip; 71. Waste liquid cup; 72. Drainage hose; 73. Waste liquid outlet. Detailed Implementation
[0038] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.
[0039] Example 1
[0040] This embodiment provides a paper-based microfluidic chip for integrated detection of the novel coronavirus, the chip structure of which is as follows. Figure 1 As shown, it includes: 11. Syringe; 12. Sample inlet hose; 13. Sample inlet; 21. Incident light; 22. Scattered light; 31. Hydrophilic cellulose chromatography paper; 32. SU-8 negative photoresist layer; 41. Polystyrene microbeads binding to the SARS-CoV-2 S1 protein; 42. Microreaction unit (5 mm in diameter, with branch channels communicating with the main microchannel); 5. Main channel of the microfluidic chip; 6. Branch channel of the microfluidic chip; 71. Waste liquid cup; 72. Drainage hose; 73. Waste liquid outlet.
[0041] This embodiment also provides a method for detecting the novel coronavirus using the above-mentioned paper-based microfluidic chip, including the following steps:
[0042] 1. Inject 5μm carboxylated polystyrene microbeads into the microchannel of the microfluidic chip through the injection port, filling the entire microreaction pore, and close the waste liquid outlet valve; since the bottom layer of the microfluidic reaction pore is lined with hydrophilic cellulose paper rich in carboxyl groups, the carboxylated polystyrene microbeads are coupled and fixed in the microfluidic reaction pore through the reaction of the coupling agent, and incubate at room temperature of 25℃ for 1h;
[0043] 2. Wash three times with PBS buffer to remove uncoupled and immobilized microbeads, and continuously pass N2 through to dry the water in the channels and micropores;
[0044] 3. Inject 10 μg / mL of the nucleic acid aptamer of the novel coronavirus S1 protein into the injection well, filling the entire microreaction well and channel, and close the waste liquid outlet valve; place the chip in a constant temperature shaking incubator at 37°C for 2 hours;
[0045] 4. Wash three times with PBS buffer to remove uncoupled nucleic acid aptamers, and continuously purge with nitrogen gas to dry the moisture in the channels and microwells;
[0046] 5. Inject the water sample to be tested into the inlet well, filling the entire microchannel and reaction well, and close the waste liquid outlet valve; place the chip in a constant temperature shaking incubator at 37°C for 2 hours; the SARS-CoV-2 S1 protein in the sample reacts fully with the nucleic acid aptamers on the PS microbeads.
[0047] 6. Insert the paper-based microfluidic chip into a handheld Mie scattering detection device and measure the change in scattered light intensity. The scattered light intensity is positively correlated with the amount of novel coronavirus S1 protein. Therefore, by substituting the measured light intensity into the detection equation, the virus content can be calculated. Figure 1 As shown.
[0048] The local, end-to-end working state of the immunoagglutination reaction unit on the paper-based microfluidic chip is as follows: Figure 2 As shown,
[0049] 1. First, carboxylated polystyrene microspheres with a particle size of 5 μm are uniformly distributed and fixedly coupled in the micro-reaction pores;
[0050] 2. Microbeads are covalently coupled to nucleic acid aptamers of the novel coronavirus S1 protein to form detection units;
[0051] 3. When encountering the target novel coronavirus S1 protein in the sample, the nucleic acid aptamers on the microspheres will capture the target novel coronavirus S1 protein; the coupled nucleic acid aptamer microspheres suspended and fixed in the reaction unit of the paper-based microfluidic chip will undergo latex aggregation when they encounter the novel coronavirus, resulting in a significant change in the morphological parameters of the immune substances. Thus, they amplify the presence of the novel coronavirus in the water sample.
[0052] 4. Mie scattering light signal detection: A light source λ < 10*D (D, the particle size of the microbead antibody-coupled complex) that meets the conditions for the formation of Mie scattering light is irradiated onto the surface of the above-mentioned immune reaction material. The change in the intensity of Mie scattering light before and after the occurrence of the immune agglutination reaction is detected at a certain angle θ of the incident light source. The content of the novel coronavirus in the water sample can be determined, thus achieving the purpose of directly detecting the content of the novel coronavirus in the sample.
[0053] 5. Setting the incident light λ value: To meet the conditions for forming Mie scattering light, the incident light λ value can be controlled by setting it. For example, if the incident light λ = 900 nm, then D + d (the theoretical particle size of the novel coronavirus) > 90 nm.
[0054] Example 2
[0055] Different standard concentration gradients of SARS-CoV-2 S1 protein (molecular weight 11.6 Kd) were selected for detection using the method described in Example 1. The added SARS-CoV-2 viral load concentrations were 5, 10, 20, 40, 80, 160, 320, and 640 × 10⁻⁶. 7 The copy number / mL, converted to S1 protein, were 1.73, 3.46, 6.92, 13.84, 27.68, 55.36, 110.72 and 221.44 ng / mL, respectively.
[0056] The relative light intensity value of Mie scattering measured at each reaction aperture is as follows: This indicates that the relative light intensity values at different concentrations were obtained, and a standard linear equation was fitted: y = 34.25 + 233.19r = 0.9991. The detection range was 2.70-173 ng / mL, and the method detection limit was 1.35 ng / mL (S / N = 5). Figure 4 As shown.
[0057] Example 3
[0058] To explore its practical application, blind samples of environmental water containing the novel coronavirus were analyzed. The test results are shown in Table 1, with relative deviations within 10%.
[0059] Table 1 Blind Sample Testing for COVID-19
[0060]
[0061] The above detailed embodiments have provided a comprehensive description of the present invention. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, unless otherwise specified, the embodiments of the present invention and the features thereof can be combined with each other.
Claims
1. A microfluidic chip, comprising an inlet, a microreaction unit, a microfluidic chip channel, and a waste outlet, wherein the microreaction unit is connected via the microfluidic chip channel; the microreaction unit is loaded with magnetic beads and nucleic acid aptamers; The base plate of the microreaction unit is hydrophilic cellulose chromatography paper; A photoresist layer is provided on the side of the base plate of the micro-reaction unit; The photoresist layer is a negative photoresist layer; The negative photoresist layer is selected from SU-8 negative photoresist layer; The nucleic acid aptamer is a nucleic acid aptamer that specifically recognizes the novel coronavirus; The nucleic acid aptamer includes the following sequence: GTCTTGCGGGGCGGCGGGTTGAGAGGA; The magnetic beads are carboxylated functional magnetic beads; The carboxylated functional magnetic beads include carboxylated polystyrene magnetic beads; The particle size of the carboxylated polystyrene magnetic beads is 3–8 μm.
2. The method for fabricating the microfluidic chip according to claim 1, comprising the following steps: S1: Inject the magnetic beads through the injection port to fill the microchannels of the microfluidic chip, incubate at 20-30°C for 0.5-1.5 h, and elute the uncoupled magnetic beads with elution buffer; S2: Inject the nucleic acid aptamer of the novel coronavirus S1 protein through the injection port to fill the microchannel of the microfluidic chip, incubate at 32-40°C for 1-3 hours, and elute the uncoupled nucleic acid aptamer with elution buffer.
3. The application of the microfluidic chip according to claim 1 in the detection of the novel coronavirus for non-diagnostic purposes or in the preparation of products for detecting the novel coronavirus.
4. A method for detecting the novel coronavirus for non-diagnostic purposes, comprising the step of detecting a sample to be tested using the microfluidic chip of claim 1; The method specifically includes the following steps: The sample to be tested is injected through the injection port to fill the microchannel of the microfluidic chip, and incubated at 32-40°C for 1-3 hours. The change in the intensity of scattered light before and after incubation is measured using a Mie scattering detection device, and the content of the novel coronavirus in the sample is calculated.
5. A product comprising the microfluidic chip of claim 1; The product also includes a Mie scattering detection device.
Citation Information
Patent Citations
Micro-fluidic paper chip for simultaneously detecting glucose, uric acid, triglycerides and cholesterols, and its manufacturing method
CN102998439A
Dual-image based bioimaging devices and techniques
CN108431575A
Nucleic acid aptamer combined with novel coronavirus (SARS-CoV-2) spinous process protein S1 subunit and application thereof
CN113061610A
Biochemical analyzing device based on magnetic bead
CN207894807U
Quantitative large area binding sensor for detecting biomarkers
US20210396647A1