Eggplant SmGATA17 gene and its application

Abstract

The present invention belongs to the field of plant genetic engineering and molecular biology, and relates to an eggplant SmGATA17 gene and its application, wherein the gene contains a 663bp coding sequence and encodes 220 amino acids. SmGATA17 Gene expression, enhance eggplant photosynthesis efficiency and cold resistance, reduce economic losses under low temperature stress. SmGATA17 The gene cloning primer pair and the fluorescence quantitative primer pair provide new tools for the cold resistance research and molecular breeding of eggplant. The invention has important significance for agricultural production and food safety.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering and molecular biology and relates to an eggplant SmGATA17 Genes and their application in improving cold tolerance of eggplant. Background Art

[0002] eggplant( Solanum melongena L.) is an important vegetable crop and is widely cultivated all over the world, especially in Asia. However, as a thermophilic crop, eggplant does not grow well in low temperature environments. Low temperature stress is one of the key factors affecting the growth, development, yield and quality of eggplant. In winter and spring, eggplants cultivated in facilities often encounter low temperature environments, which leads to stunted growth and reduced chlorophyll content, which in turn affects photosynthesis efficiency, and ultimately leads to a significant decrease in yield and quality. In addition, continuous low temperature stress may also cause chlorosis, yellowing or browning of eggplant leaves, and even cause the plants to wither and die in severe cases. Therefore, improving the adaptability of eggplant to low temperatures and reducing the economic losses caused by low temperatures to eggplant are technical issues that need to be urgently solved in eggplant cultivation.

[0003] Although previous studies have shown that chlorophyll homeostasis is crucial for plant adaptability in low temperature environments, research on key genes in the chlorophyll metabolic pathway and their regulatory mechanisms in eggplant is still insufficient. This limits our in-depth understanding of the low-temperature tolerance mechanism of eggplant and also restricts the development of cold-resistant eggplant breeding and cultivation technology. In particular, the regulatory role of GATA transcription factor family members in the eggplant chlorophyll metabolic pathway is still unclear, which is of great significance for revealing the physiological response and adaptation mechanism of eggplant under low temperature stress.

[0004] In the process of implementing the present invention, the inventors found that the prior art has at least one of the following technical problems:

[0005] a) Eggplant growth and development are hindered in low temperature environment, chlorophyll content is reduced, affecting photosynthesis and growth and development.

[0006] b) The key genes in the chlorophyll metabolism pathway of eggplant under low temperature stress have not been fully explored and studied, which limits the in-depth understanding of the low temperature tolerance mechanism of eggplant.

[0007] c) Due to the lack of understanding of eggplant's unique gene combination and regulatory mechanism, the development of eggplant cold-resistance breeding technology is limited.

[0008] d) Some members of the GATA transcription factor family are highly correlated with plant cold resistance, but the action mechanisms of different members vary significantly in different species. The physiological response mechanisms of related genes in eggplant in response to low temperature stress have not been fully studied. Summary of the invention

[0009] In view of this, the present invention aims to provide an eggplant SmGATA17 The gene and its application are aimed at improving the adaptability of eggplant to low temperature environment and reducing the economic losses caused by low temperature to eggplant.

[0010] The inventor has continuously innovated and reformed to solve the above technical problems through long-term exploration and attempts, as well as many experiments and efforts. The technical solution provided by the present invention is to provide an eggplant SmGATA17 The gene contains a 663bp coding sequence, encodes 220 amino acids, and the nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] eggplant SmGATA17 The cloning and application of genes can significantly improve the adaptability of eggplant to low temperature environments. SmGATA17 The gene, which encodes a protein of 220 amino acids, can enhance the photosynthesis efficiency and cold resistance of eggplant under low temperature conditions by regulating the expression of genes related to chlorophyll metabolism. The discovery and application of this gene not only helps to reduce the loss of eggplant yield and quality caused by low temperature, but also provides a new molecular tool for cold-resistant breeding of eggplant, which has important agricultural application value and market potential. In addition, the present invention provides the precise nucleotide sequence (SEQ ID NO.1) and amino acid sequence (SEQ ID NO.2) of the gene, laying a foundation for subsequent gene function research and commercial application.

[0013] The present invention also provides a method for improving the cold resistance of eggplant, wherein the method SmGATA17 The method can be achieved by increasing the expression level of the gene, and the method includes but is not limited to transgenic technology and / or gene editing technology.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] By using genetic modification or gene editing technology to improve eggplant SmGATA17 The present invention can directly regulate the gene expression pattern inside eggplant, thereby enhancing the adaptability of eggplant to low temperature environment. This method not only improves the growth quality and yield of eggplant under low temperature conditions, but also reduces the economic losses caused by low temperature stress. In addition, the method of the present invention provides an effective molecular biological method for breeding cold-resistant eggplant, which helps to promote the development of cold-resistant eggplant varieties and has important agricultural and commercial application prospects. SmGATA17The present invention provides a new strategy for improving the cold tolerance of eggplant crops, which has far-reaching significance for agricultural production and food safety.

[0016] The present invention also provides an eggplant SmGATA17 Application of genes in improving the cold resistance of eggplant, including but not limited to improving the cold resistance of eggplant by transgenic technology or gene editing technology SmGATA17 The expression level of the gene can enhance the adaptability of eggplant to low temperature environment.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The application of the present invention provides an innovative strategy to improve the cold resistance of eggplant by directly regulating the internal structure of eggplant through transgenic technology or gene editing technology. SmGATA17 Gene expression, thereby enhancing the adaptability of eggplant to low temperature environment. This method can not only reduce the growth inhibition and yield loss of eggplant under low temperature conditions, but also optimize the photosynthesis efficiency of eggplant by improving chlorophyll synthesis and inhibiting chlorophyll degradation, which is of great significance for improving the overall cold resistance and productivity of eggplant crops. In addition, the application of the present invention also provides a new target for the molecular breeding of eggplant, which helps to cultivate a new eggplant variety that is more cold-resistant, which has a positive role in expanding the planting range of eggplant, improving the stability of crops and the economic benefits of farmers.

[0019] The present invention also provides an eggplant SmGATA17 The subcellular localization method of genes is carried out by SmGATA17 The gene was fused with green fluorescent protein and transformed into plant cells to observe and determine SmGATA17 The location of a protein within a cell.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] By SmGATA17 The gene is fused with green fluorescent protein (GFP) and transformed into plant cells. The present invention can visually observe and determine SmGATA17 The precise location of a protein in a cell is crucial for understanding the function and mechanism of action of the gene. SmGATA17 The accuracy of gene function research is improved, and it provides a powerful tool for further gene regulatory network analysis and functional verification. In addition, by clarifying the subcellular localization of proteins, gene expression regulation strategies can be more effectively designed and implemented, thus playing a key role in improving eggplant cold resistance and molecular breeding, which has important practical application significance for improving the cold resistance and yield of eggplant crops.

[0022] The present invention also provides an eggplantSmGATA17 Method for interaction between genes and promoters of genes related to chlorophyll metabolism, verified by yeast one-hybrid assay SmGATA17 Interactions between genes and promoters of genes related to chlorophyll metabolism.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] Eggplant provided by the present invention SmGATA17 The verification method of the interaction between a gene and a promoter of a gene related to chlorophyll metabolism has significant scientific and application value. By using the yeast single hybrid experiment, an efficient and accurate technical means, the present invention can directly verify SmGATA17 The physical connection between the gene and the promoter of the gene related to chlorophyll metabolism was revealed, thereby revealing its molecular mechanism in regulating chlorophyll metabolism and responding to cold stress. This method not only deepens the understanding of the gene regulatory network related to eggplant cold resistance, but also provides key targets and strategies for the molecular design and genetic improvement of cold-resistant eggplant varieties. SmGATA17 The role of genes in regulating chlorophyll metabolism, the present invention helps to develop new genetic engineering methods to improve the cold resistance and yield of eggplant and other crops, and has important practical significance for enhancing the environmental adaptability of crops and ensuring food security.

[0025] The present invention also provides an eggplant SmGATA17 Methods for gene expression patterns, analyzed by RT-qPCR in different tissues and under cold stress treatments SmGATA17 Gene expression pattern.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] By using fluorescent quantitative polymerase chain reaction (q-PCR) technology, the present invention can accurately analyze the SmGATA17 The expression changes of the gene can be analyzed to gain a deeper understanding of the mechanism of action of the gene in eggplant growth and development and cold resistance. This method not only improves the sensitivity and accuracy of gene expression analysis, but also provides important data support for molecular breeding of eggplant cold resistance. SmGATA17 The expression pattern of the gene under different conditions, the present invention helps to identify and utilize the potential of the gene in improving the cold resistance of eggplant, which has important guiding significance for breeding new eggplant varieties with stronger adaptability and more stable yield, and also provides a valuable reference for the cold resistance research of other crops.

[0028] The present invention also provides an eggplant SmGATA17 A primer pair for cloning a gene, wherein the primer pair is:

[0029] SmGATA17-F1:5'-ATGGTGGATCTAAGTGATAAAAGTT-3',

[0030] SmGATA17 -R1:5'- TCAACCACCCACAAAGTACTAC-3'.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] Through precise design SmGATA17 -F1 and SmGATA17 -R1 primer, the present invention can efficiently and specifically clone the target from the eggplant genome SmGATA17 The design of this primer pair takes into account the conservation and specificity of the gene, ensuring the accuracy and efficiency of the cloning process. Compared with the prior art, the primer pair of the present invention provides a more reliable method to obtain SmGATA17 This specific and efficient cloning method helps accelerate the research process of cold tolerance-related genes in eggplant and provides an important tool for molecular breeding and genetic improvement of eggplant, which has important scientific research and commercial application prospects.

[0033] The present invention also provides an eggplant SmGATA17 A fluorescent quantitative primer pair for a gene, wherein the primer pair is:

[0034] SmGATA17 -F2:5'-AGCAGCAACAGTGAAGATAG-3',

[0035] SmGATA17 -R2:5'-TAGAAAGAGCCACAAGAAAG-3';

[0036] actin -F:5'-GTCGGAATGGGACAGAAGGATG-3',

[0037] actin -R:5'-GTGCCTCAGTCAGGAGAACAGGGT-3'.

[0038] Compared with the prior art, the present invention has the following beneficial effects:

[0039] These primer pairs were specifically designed to accurately measure the expression of SmGATA17 The expression level of the gene, SmGATA17 -F2 and SmGATA17 -R2 primer pair specifically targets SmGATA17 Genes, and eggplant actin -F andactin -R primer pair is used for internal reference gene actin This design enables the present invention to accurately evaluate SmGATA17 The relative expression of genes under different conditions improves the sensitivity and reliability of gene expression analysis. actin The present invention can correct the variation between samples and ensure the accuracy and repeatability of the results. This method provides a powerful tool for the study of eggplant cold resistance and helps to deeply understand SmGATA17 The mechanism of action of genes in eggplant cold resistance provides important technical support for eggplant molecular breeding and genetic improvement, and has important scientific research and commercial application potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments will be briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0041] Figure 1 It's eggplant SmGATA Electrophoresis diagram of gene cloning.

[0042] Figure 2 yes SmGATA Bioinformatics analysis results. Figure 2 In the picture, A shows eggplant SmGATA Gene location and protein domain analysis, B shows SmGATA The structural analysis of the gene, C shows SmGATA Analysis of gene promoter elements.

[0043] Figure 3 It is the result of systematic evolutionary analysis of eggplant GATA and Arabidopsis GATA protein families. Figure 3 In the figure, the red five-pointed star represents eggplant GATA.

[0044] Figure 4 In the leaves of Nicotiana benthamiana SmGATA17 Subcellular localization analysis results, 35S: GFP vector was used as a control.

[0045] Figure 5 Eggplant tissue and cold stress treatment SmGATA17 The results of expression pattern analysis.

[0046] Figure 6 yes SmGATA17In yeast one-hybrid assays with promoter elements of genes related to chlorophyll metabolism, AD+pAbAi-gene was used as the negative control group; Figure 6 Figure A is a schematic diagram of the transcription factor and chlorophyll metabolism gene vectors in the yeast one-hybrid experiment, and Figure B is a diagram of the results of the yeast one-hybrid experiment. The yeast strain with empty pGADT7 and co-transformed chlorophyll gene is the negative control.

[0047] Figure 7 In transgenic plants SmGATA17 Identification of gene expression levels; Figure 7 In the figure, CK represents wild-type Arabidopsis; OE represents 35S::SmGATA17 plants.

[0048] Figure 8 is the phenotypic observation and ROS content staining results of wild-type and transgenic lines; Figure 8 In the figure, CK is the untreated group, and T is the cold stress treatment group; Figure B is the DAB staining results of the leaves of the wild type and transgenic lines, and Figure C is the NBT staining results of the leaves of the wild type and transgenic lines.

[0049] Figure 9 These are the physiological indicators of SmGATA17#OE and WT Arabidopsis under normal conditions and cold stress.

[0050] Figure 10 It is the result of measuring the expression levels of chlorophyll synthesis gene HEMA and degradation genes CHLG, PORA, and PAO in transgenic plants. DETAILED DESCRIPTION

[0051] The following describes the invention in conjunction with specific embodiments.

[0052] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention. Therefore, the following detailed description of the embodiments of the present invention is not intended to limit the scope of the invention claimed for protection, but merely represents selected embodiments of the present invention.

[0053] In the present invention, unless otherwise specified, all equipment and raw materials can be purchased from the market or are commonly used in the industry. The methods in the following embodiments, unless otherwise specified, are conventional methods in the art.

[0054] In this example, the test material used was March White Flower Early Eggplant "E7134" preserved and provided by Sichuan Academy of Agricultural Sciences. When the seedlings grew for 55 days under natural conditions and had 5 to 6 leaves, the root, stem, and leaf tissues of the seedlings were quickly placed in liquid nitrogen and stored in a -80 °C ultra-low temperature refrigerator for subsequent RNA extraction. Subsequently, eggplant seedlings with consistent growth were selected and planted in the Xindu Base of the Horticulture Research Institute of Sichuan Academy of Agricultural Sciences. When the plants bloomed and bore fruit, the flower and fruit tissues were quickly placed in liquid nitrogen and stored in a -80 °C ultra-low temperature refrigerator for subsequent RNA extraction.

[0055] Eggplant seedlings of 55 days old with consistent growth were selected and subjected to low temperature stress in an artificial climate chamber for one week (growth conditions: temperature was 10 ℃ during the day and 5 ℃ at night; light-dark cycle was 16 / 8 hours). Eggplant leaves treated with low temperature stress were collected at 0 days, 1 day, 2 days, 4 days, and 7 days as cold stress quantitative materials, quickly placed in liquid nitrogen, and stored in a -80 ℃ ultra-low temperature refrigerator for subsequent RNA extraction.

[0056] The plant materials stored at -80 ℃ were ground with liquid nitrogen, and the total RNA of eggplant leaves was extracted by TRIzol extraction method. The RNA integrity was detected by agarose gel electrophoresis. The reverse transcription kit of Takara was used to reverse transcribe the RNA to be tested into the first-strand cDNA. After reverse transcription, 90 μL of nuclease-free water was added and stored in a -20 ℃ refrigerator for later use.

[0057] Arabidopsis thaliana ( Arabidopsis thaliana (Col)) seeds (kept in this laboratory).

[0058] In this embodiment, eggplant SmGATA The gene contains a 663 bp coding sequence and encodes 220 amino acids. The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.2.

[0059] SmGATA The cloning primer sequences were designed using primer 5 v5.5.0 and then sent to Beijing Qingke Biotechnology Co., Ltd. for synthesis.

[0060] eggplant SmGATA Primer pairs for gene cloning:

[0061] SmGATA -F1 is shown in SEQ ID NO.3, SmGATA -R1 is shown in SEQ ID NO.4.

[0062] eggplant SmGATA Gene fluorescence quantitative primer pair:

[0063] SmGATA-F2 is shown in SEQ ID NO.5,

[0064] SmGATA -R2 is shown in SEQ ID NO.6;

[0065] Actin -F is shown in SEQ ID NO.7,

[0066] Actin -R is shown in SEQ ID NO.8.

[0067] 1. Eggplant SmGATA Gene amplification and sequence analysis

[0068] The first-strand cDNA dilution product was used as a DNA template for PCR amplification. SmGATA -F1 and SmGATA -R1 primer was used for sequence PCR amplification, and the amplification system is shown in Table 1.

[0069] Table 1 PCR system

[0070] Component Dosage 2TSINGKE Master Mix 45.00 µL -F1 2.00 µL -R1 2.00 µL cDNA 1.00 µL Total 50.00 µL

[0071] The mixture was mixed and centrifuged, and PCR amplification was performed under the following reaction conditions: 98 ℃ 2 min, 98 ℃ 10s, Tm 64 ℃ 40 cycles, 72 ℃ 50 s, 72 ℃ 5 min, 4 ℃ 5 min. The PCR reaction results were separated by 1% agarose gel electrophoresis. DNA bands with the same size as the target sequence were cut under long-wave ultraviolet light. PCR amplification product gel recovery was performed according to the instructions of the Bomed agarose gel purification recovery kit, and the purified product was connected to the pMD-19T vector and incubated at 4 ℃ overnight. Single colonies were selected for PCR molecular detection, and the E. coli positive clones were commissioned to Beijing Qingke Biotechnology Co., Ltd. for determination.

[0072] Cloning using eggplant leaf cDNA as template SmGATA The cloned electrophoresis diagram of the gene is shown in Figure 1 As shown, after sequencing the target fragment, a 663 bp coding sequence was obtained, encoding 220 amino acids, located on chromosome 5 (4763514-4766238).

[0073] 2. SmGATA Gene structure and conserved motif analysis, promoter element analysis

[0074] The domain structure of SmGATA protein sequence was analyzed using SMART online software (http: / / smart.embl.de / ). The amino acid sequence of SmGATA protein (SEQ ID NO.2) was analyzed using online tool MEME (http: / / meme-suite.org / tools / meme) to predict the number and distribution of its motifs. The online website PlantCARE (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / ) was used to analyze the amino acid sequence of SmGATA protein (SEQ ID NO.2) to predict the number and distribution of its motifs. SmGATA The promoter sequence was analyzed for promoter elements.

[0075] SMART results ( Figure 2 A) shows that the cloned sequence has a complete ZnF GATA domain. The relative molecular mass of SmGATA protein is 23914.42 Da, and the isoelectric point is 9.64. Gene structure analysis shows that the gene contains 4 exons and 3 introns ( Figure 2 Middle B). Extracted from the eggplant genome SmGATA Analysis of the 2000 bp sequence upstream of the gene revealed SmGATA The promoter sequence contains 24 elements ( Figure 2 Middle C), mainly growth and development, hormone response elements (such as MethylJasmonate / methyl jasmonate, Salicylic acid / salicylic acid, gibberellin-responsive element / gibberellin response element), light response elements, stress response elements (such as drought, stress defense). SmGATA It may play an important role in eggplant growth and development, adverse stress and photoperiod regulation.

[0076] 3. GATA phylogenetic tree analysis

[0077] The GATA family protein sequences of Arabidopsis thaliana were obtained from the Arabidopsis thaliana Information Resource (TAIR) (https: / / www.arabidopsis.org / ). The ClustalW alignment method in MEGA (V10.2.2) software was used to align the eggplant SmGATAThe sequences of the GATA family proteins of Arabidopsis were aligned, and then the Neighbor-Joining (NJ) method was used (parameters were set as: Bootstrap method 1000, Partialdeletion, p-distance, Gamma distributed with Invariant sites (G+I)), to construct an evolutionary tree.

[0078] Phylogenetic analysis showed that SmGATA Arabidopsis thaliana AtGATA17 In the same branch, belonging to subfamily II members ( Figure 3 ). Therefore, it was named SmGATA17.

[0079] 4. SmGATA17 Subcellular localization experiments

[0080] The diluted product of the first-strand cDNA was used as a DNA template for PCR amplification. SmGATA -F1 / SmGATA -R1 primer was added with restriction sites ScaI and BamHI at both ends for sequence amplification. The amplification system is shown in Table 1. The amplified product was inserted into the plant transient expression vector 35S: GFP to obtain 35S: SmGATA17 -GFP positive recombinant plasmid.

[0081] 35S: SmGATA17 -GFP positive recombinant plasmid and control group 35S:GFP were transferred into Agrobacterium GV3101 respectively, cultured until OD600 reached 0.6~0.8, centrifuged, collected the bacteria, resuspended and diluted with sterile water, added acetosyringone and let it stand for 3~4 hours, took an appropriate amount of Agrobacterium liquid with a clean syringe, injected it into the lower epidermis of tobacco leaves with good growth, marked it, cultured in the dark for 2 days, and observed with a laser confocal microscope.

[0082] Subcellular results showed SmGATA17 Localized in the cell nucleus ( Figure 4 ).

[0083] 5. Analysis of gene expression patterns

[0084] The eggplant roots, stems, leaves, flowers, and fruit tissues and materials at different time points of cold stress treatment were ground with liquid nitrogen, and the total RNA of eggplant leaves was extracted by TRIzol extraction method, and the RNA integrity was detected by agarose gel electrophoresis. The RNA to be tested was reverse transcribed into cDNA using Takara's reverse transcription kit. After reverse transcription, 90 μL of nuclease-free water was added and stored in a -20°C refrigerator for later use.

[0085] right SmGATA17 Fluorescence quantitative PCR was performed to detect the genes of the materials at five time points under cold stress. The qPCR primers used were fluorescent quantitative primer pairs, and the qPCR system was shown in Table 2. The qPCR reaction program was set as shown in Table 3. actin The gene was used as an internal reference for detection, and three biological replicates and technical replicates were set up. -ΔΔCT The expression level was calculated by

[0086] Table 2 qPCR system

[0087] Component Dosage Hieff qPCR SYBR 10ul Forward primer 0.4ul Reverse primer 0.4ul cDNA 0.5ul <![CDATA[ddH2O]]> Up to 20ul

[0088] Table 3 qPCR reaction procedure

[0089]

[0090] SmGATA17 Analysis of expression patterns in different tissues revealed SmGATA17 It has a distinct tissue expression pattern, with high expression in leaves, followed by flowers, fruits, roots, and finally low expression in stems ( Figure 5 Middle A).

[0091] Analyzed SmGATA17 The expression patterns of eggplant at five time points of cold stress, the specific results are as follows Figure 5 As shown, SmGATA17 The expression of the gene was significantly upregulated. Compared with the control group, the expression of the gene was significantly upregulated by about 1.8 times after 2 days of cold treatment. The expression reached a peak on the 4th and 7th days and tended to be stable, which was 2.1 times that of the control group (0 days). Figure 5 These results suggest that SmGATA17 The gene may play a key role in the adaptive response of eggplant to cold stress.

[0092] 6. SmGATA17 Interaction with promoters of chlorophyll metabolism genes

[0093] The eggplant genome was extracted using the CTAB method, and the DNA quality was tested by agarose gel electrophoresis. PCR amplification was performed using eggplant genomic DNA as a template, and the promoter sequence of the amplified chlorophyll synthesis gene was inserted into a yeast vector (pAbAi) and then transformed into the yeast strain Y1H. SmGATA17 The CDS sequence of the constructed vector pGADT7 was inserted into the pGADT7 vector. SmGATA17Transformed into the positive Y1H yeast strain containing pAbAi-chlorophyll synthesis gene-pro, and the empty vector pGADT7 was used as a control. The Y1H yeast strain containing pAbAi-chlorophyll synthesis gene-pro containing the pGADT7 plasmid was grown on SD-Leu medium, and then a single colony was extracted and diluted and spread on the medium containing 100 ng / ml of aureobasidin A (AbA) inhibitor, and static culture was carried out at 28 ℃ for verification and observation of colony growth.

[0094] Figure 6 Shows SmGATA17 The results of yeast one-hybrid experiment with promoter elements of chlorophyll metabolism-related genes, AD+pAbAi-chlorophyll metabolism-related genes was the negative control group, see Figure 6 Figure A in the middle.

[0095] See also Figure 6 In Figure B, SmGATA17 The results of the experiment combining with HEMA, CHLG, PORA, and PAO promoter elements showed that yeast colonies in the control group and experimental group grew normally on SD-deficient plates. However, on SD-deficient plates containing ABA 100ng / ml inhibitor, yeast colonies in the negative control group did not grow, while the colonies in the positive experimental group grew normally in size and morphology. The results showed that SmGATA17 It interacts with the HEMA, CHLG, PORA, and PAO promoters.

[0096] 7. Construction of gene overexpression vector

[0097] The eggplant DNA sequence was extracted and determined correctly using a high-purity plasmid DNA extraction kit SmGATA17 The bacterial liquid plasmid was double-digested with restriction endonucleases ScaI and BamHI to obtain pCAMBIA3301 (stored in this laboratory). The restriction endonuclease system settings are detailed in Table 4. The reaction conditions are 37 °C, 30 min. After the reaction, 1% agarose gel electrophoresis was used for separation and detection. The enzyme gel was recovered using the instructions of the Bomed agarose gel purification and recovery kit. The pCAMBIA3301- SmGATA17 The recombinant was introduced into Agrobacterium GV3101 for subsequent infection.

[0098] Table 4 Enzyme digestion system preparation

[0099] Reagent Usage amount ScaI 2.50 µL BamHI 2.50 µL SmGATA17 / Vector 25.00 µL FD Green Buffer 5.00 µL <![CDATA[ddH2O]]> 15.00 µL Total volume 50μL

[0100] Table 5 Ligation reaction system

[0101] Reagent Usage amount Vector digestion product 3.00 μL DNA target fragment 5.50 μL T4-DNA ligase 0.5 μL Solution Ⅰ 1.00 μL Total volume 10.00 μL

[0102] 8. Cultivation and infection of wild-type Arabidopsis

[0103] Select a certain amount of high-quality, plump Arabidopsis seeds and place them in a 1.5 mL EP tube. Then, under sterile conditions, add sterile distilled water to the tube and mix it with a sodium hypochlorite solution with a volume ratio of 1:50. Shake it up and down for 10 to 15 minutes to complete the seed disinfection process. Subsequently, use sterile distilled water to wash the seeds 4 to 5 times. Spread the sterilized seeds evenly on the surface of 1 / 2 MS solid culture medium, put them in a refrigerator at 4 °C, and treat them with low temperature induction for 3 days. Then transfer these seeds to a light incubator and continue to culture for about a week. When the seedlings grow to the appropriate stage, they are transplanted intact into the culture soil (the culture soil is a mixture of sterilized substrate soil and vermiculite) and placed in a light incubator to continue growing. The environmental conditions of the incubator are set to a long daylight cycle (16 hours of light and 8 hours of darkness), the temperature is constant at 22 °C, and the relative humidity is maintained at 70%.

[0104] The Arabidopsis genetic transformation was carried out by the floral dipping method. When Arabidopsis thaliana grew to the bolting stage and had 3 to 4 stem leaves, all plants were uniformly top-cut. When a large number of unopened flower buds were formed on the plants, the flower buds were briefly (about 15 seconds) immersed in the infection solution containing Agrobacterium. After the infection, the plants were placed in a dark place for about 3 days to improve the transformation efficiency.

[0105] Leaf samples were collected from wild-type and 35S::SmGATA17 transgenic Arabidopsis, and cDNA was extracted and used as a template for quantitative fluorescence quantitative analysis using primer pairs. SmGATA17 The results are shown in Table 1. Figure 7 As shown, compared with the wild-type plants, in overexpression lines 1 and 4, SmGATA17 The expression of exogenous genes was significantly upregulated. SmGATA17 It has been successfully introduced and expressed in Arabidopsis thaliana.

[0106] 9. Screening and identification of transgenic Arabidopsis

[0107] After the T0 generation seeds were treated with the above disinfection method, they were evenly placed on the surface of 1 / 2 MS solid culture medium containing 30 mg / L hygromycin. Plants that can develop normally on this culture medium are considered potential successful transgenic plants. Then, DNA is extracted from these plants showing resistance and used as a template for PCR amplification for molecular level confirmation. The amplified products are detected by gel electrophoresis technology to observe whether the expected specific bands appear, thereby verifying the success of the transgenic. Finally, the verified T2 generation transgenic strains are selected for subsequent phenotypic characteristic observations and functional characteristic analysis.

[0108] 10. Phenotypic observation of transgenic Arabidopsis

[0109] After cold stress treatment, the morphological changes of wild-type and transgenic Arabidopsis leaves were observed and recorded. The ROS content of wild-type and transgenic Arabidopsis was detected, and the leaves after untreatment and cold treatment were stained with DAB and NBT. DAB staining: After 7 days of cold stress treatment, the leaves of each strain were taken for DAB staining, and at least 10 leaves of each strain were taken; the leaves were placed in a 2ml EP tube, and 3 leaves were placed in each EP tube to avoid the leaves from pressing each other. 2ml DAB staining solution was added to the EP tube, and the EP tube was placed in a foam box to avoid light. The staining was performed at room temperature for 6 hours; the stained leaves were transferred to another EP tube, and 2ml DAB staining decolorizing solution was added to the tube. The tube was decolorized at room temperature for 30 seconds in the dark, and the decolorizing solution was removed by aspiration; the above step was repeated twice, and the decolorizing solution was left for the last time, and the leaves were decolorized overnight in the dark at room temperature; the decolorized leaves were carefully clipped out with tweezers, and photographed and recorded. NBT staining: 16 hours after the injection of the bacterial solution, take the leaves of each strain for NBT staining, at least 10 leaves for each strain; put the leaves into a 2ml EP tube, put 3 leaves in each EP tube to avoid the leaves from pressing each other, add 2ml NBT staining solution into the EP tube, put the EP tube into a foam box to avoid light, and stain for 16 hours at room temperature in the dark; carefully clip out the leaves, transfer them to another EP tube, add 2ml 95% ethanol solution to decolorize in the dark, change the decolorizing solution every 30 minutes until the leaves are fully decolorized; carefully clip out the leaves for observation, and take pictures for record.

[0110] By comparing wild-type Arabidopsis and 35S::SmGATA17 plants, we found that ( Figure 8 Middle A), SmGATA17 Overexpression affects the cold resistance of Arabidopsis. 35S::SmGATA17 plants showed different degrees of cold damage, and the cold damage of two lines was significantly different from that of wild-type plants. The leaves of wild-type plants became darker and wrinkled, and the leaves were narrow and curled downward. In order to detect the accumulation of reactive oxygen species in SmGATA17#OE and wild-type Arabidopsis under normal or cold treatment conditions, Arabidopsis leaves were stained with NBT and DAB, respectively ( Figure 8 C and B) There was no significant difference in NBT and DAB staining under normal conditions; however, under cold conditions, the leaf color depth of the two SmGATA17#OE lines was lower than that of the wild type, indicating that SmGATA17 Overexpression of 2− and H2O2 accumulation, alleviating the oxidative damage caused by cold stress.

[0111] The harmful substance malondialdehyde (MDA) content, the osmotic protective substance proline content, the superoxide dismutase (SOD) activity, the peroxidase (POD) activity and the catalase (CAT) activity were detected using commercial kits (Nanjing Jiancheng Bioengineering Institute); the total chlorophyll content: the absorbance at wavelengths of 665, 649 and 470 nm was measured using the ethanol extraction method and experimental instruments such as a microspectrophotometer.

[0112] See also Fig. 9 , Fig. 9 In the figure, A shows the MDA content, B shows the proline content, C shows the SOD enzyme activity, D shows the POD enzyme activity, E shows the CAT enzyme activity, and F shows the total chlorophyll content. The difference between the two groups of samples was analyzed using the t-test, and the error bars represent ± standard deviation. p Values ​​<0.01 (**), <0.001 (***), and <0.0001 (****).

[0113] The results showed that compared with the control, the SOD and POD enzyme activity levels of 35S::SmGATA17 plants increased significantly, and the overexpression was significantly higher than that of the wild type. At the same time, the proline and malondialdehyde contents increased significantly, indicating that SmGATA17 Overexpression of significantly affected the accumulation of proline and malondialdehyde in eggplant leaves. Compared with wild-type plants, the chlorophyll content of overexpressed plants was significantly higher than that of wild-type plants, indicating that the chlorophyll degradation of overexpressed plants was slower.

[0114] Using fluorescent quantitative primer pairs, refer to the operation flow of step "5 Gene expression pattern analysis" to measure the expression levels of chlorophyll synthesis gene HEMA and degradation genes CHLG, PORA, and PAO in transgenic plants.

[0115] The fluorescent quantitative primer pairs for chlorophyll metabolism related genes are as follows:

[0116] AtHMEA -F:5'-AGGTCCAAGCAACTCTATTA -3',

[0117] AtHMEA -R:5'-TCATCAGTTCTACAGGCAAT-3';

[0118] AtCHLG -F:5'-CTCTTCCGTCGGTTCTATGA-3',

[0119] AtCHLG -R: 5'-GTTTCTTGAGATGCTCCTTT-3';

[0120] AtPORA-F:5'-ACGCCAGATGTTGTTGTTCT-3',

[0121] AtPORA -R: 5'-ATAAGGTTTCCCAGATGCTA-3';

[0122] AtPAO -F:5'-CACCGAAGACGCCAATAGAA-3',

[0123] AtPAO -R:5'-CACCGATACTCGCAGACACG-3'.

[0124] Determination results (see Fig.10 ) also showed heterologous overexpression in Arabidopsis SmGATA17 It promoted the transcriptional activity of the chlorophyll synthesis gene HEMA, inhibited the expression levels of the chlorophyll degradation genes CHLG, PORA, and PAO, improved photosynthetic efficiency, and significantly reduced O2 − and H2O2 accumulation, alleviating the oxidative damage caused by cold stress.

[0125] In the description of the present invention, it should be understood that "-" and "~" represent the range between two values, and the range includes the endpoints. For example: "AB" represents a range greater than or equal to A and less than or equal to B. "A~B" represents a range greater than or equal to A and less than or equal to B.

[0126] In the description of the present invention, the term "and / or" herein is merely a description of the association relationship of associated objects, indicating that three relationships may exist. For example, A and / or B may represent three situations: A exists alone, A and B exist at the same time, and B exists alone.

[0127] In the description of the invention, the numerical values ​​of time, temperature, ratio, mass, etc. involved may be based on actual measurements, standard parameters of equipment, simplified rounding results, or within an acceptable error range, ensuring the practicability and repeatability of the invention.

[0128] In the description of the present invention, the term "about" or "approximately" is used to express the approximate value of a numerical value or range, allowing a certain error to ensure the flexibility and practicality of the description while remaining within an acceptable error range, with the maximum error range not exceeding 10% of the corresponding numerical value or numerical range.

[0129] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. An eggplant SmGATA17 A gene characterized by The gene contains a coding sequence of 663 bp, encoding 220 amino acids, and the nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.

2.

2. An eggplant according to claim 1 SmGATA17 A method for subcellular localization of a gene, characterized in that: By applying the SmGATA17 The gene was fused with green fluorescent protein and transformed into plant cells to observe and determine SmGATA17 The location of a protein within a cell.

3. An eggplant according to claim 1 SmGATA17 A method for interacting a gene with a promoter of a gene related to chlorophyll metabolism, characterized in that: Validated by yeast one-hybrid assay SmGATA17 Interactions between genes and promoters of genes related to chlorophyll metabolism.

4. A method for analyzing the eggplant described in claim 1 SmGATA17 A method for gene expression profiling, characterized in that: qRT-PCR analysis of different tissues and cold stress treatments SmGATA17 Gene expression pattern.

5. An eggplant according to claim 1 SmGATA17 A gene cloning primer pair, characterized in that: The primer pairs are: SmGATA17 -F1:5'-ATGGTGGATCTAAGTGATAAAAGTT-3', SmGATA17 -R1:5’- TCAACCAACCCACAAAGTACTAC-3’。 6. An eggplant according to claim 1 SmGATA17 A fluorescent quantitative primer pair for a gene, characterized in that: The primer pairs are: SmGATA17 -F2: 5'-AGCAGCAACAGTGAAGATAG-3', SmGATA17 -R2: 5'- TAGAAGAGCCCAAGAAAG-3'; actin -F:5'- GTCGGAATGGGACAGAAGGATG -3', actin -R:5'- GTGCCTCAGTCAGGAGAACAGGGT -3'。

Images