One-pot high-dimensional multi-target detection method based on three-dimensional fluorescence spectrum

Abstract

The invention discloses a one-pot high-dimensional multi-target detection method based on a three-dimensional fluorescence spectrum, and belongs to the field of single-sample high-throughput detection without spatial dependence. The method comprises the following steps: treating a to-be-detected sample in a hydrosulfite conversion mode; a primer pair designed according to a target gene and a fluorescent group modified probe are incubated with a sample to be detected, the primer pair and the fluorescent group modified probe specifically recognize the target gene and amplify the target gene, and the fluorescent probe is broken to generate a fluorescent signal; an amplification product is subjected to three-dimensional fluorescence spectrum imaging, all excitation emission spectrum information is output, and a sample characteristic fingerprint spectrum is formed and output. The method can be used for single-reaction multi-target analysis such as DNA methylation multiple detection and intestinal cancer accurate identification. The detection information density of a solution system is enriched, the problems of low detection flux and the like of existing multi-target analysis are solved, and the method has important value in single-sample high-flux detection analysis.

Description

Technical Field

[0001] The present invention relates to the field of space-independent single-sample high-throughput detection, and in particular to a one-pot high-dimensional multi-target detection method based on three-dimensional fluorescence spectroscopy. Background Art

[0002] Biomarkers are of great value in clinical diagnosis, biomedical research and drug development. There are many different methods for biomarker detection, but they are usually spatially dependent. For example, imaging detection technologies such as fluorescence imaging, mass spectrometry imaging, and electrochemical imaging rely on the natural location information of disease markers in cells or tissue sections. Detection technologies such as chip arrays, electrophoresis, and sequencing rely on fixing disease markers to specific locations for analysis. Flow cytometry relies on spatial differences in disease markers mediated by cells or solid phase carriers for target analysis. All of the above methods analyze disease markers through the natural spatial distribution characteristics of disease markers or artificially created spatial distribution characteristics. How to achieve multiple detection of disease markers when they are in a free state, avoid introducing interface systems, and reduce operational complexity remains a vexing problem.

[0003] The detection scheme represented by Raman spectroscopy realizes the detection of disease markers that are not spatially dependent. It provides characteristic fingerprint information based on the Raman scattering signal of the sample itself, and is used to detect biomarkers such as proteins, nucleic acids, lipids and small molecule metabolites. However, the Raman spectrum of biological samples is very complex and unclear, and it is often necessary to extract characteristic peaks with unknown meanings to achieve detection. We can call it non-targeted biomarker analysis. In addition, the fluorescence detection of disease markers after amplification, represented by polymerase chain reaction (PCR), is another type of disease marker detection scheme that is not spatially dependent but has targeted characteristics. However, due to the problem of spectral overlap, the existing fluorescence detection scheme can usually only detect 5-6 targets at the same time. Breaking through the limitation of spectral overlap, improving the information density of solution system detection, and realizing the rapid and accurate detection and identification of multiple disease markers that are not spatially dependent will help the clinical diagnosis of diseases accurately and reduce the data deviation caused by multi-tube analysis.

[0004] Three-dimensional fluorescence spectroscopy is a targeted detection method that can provide more dimensional excitation and emission information without considering spatial distribution. It can fully reflect the fluorescence changes of samples under different excitation wavelengths and different emission wavelength combinations, and reflect the position, intensity and shape of the fluorescence peak. This multidimensional information helps to distinguish the characteristics of different fluorescent molecules. This feature of three-dimensional fluorescence spectroscopy allows for fine differentiation of fluorescence signals. Applying it to molecular biology detection is expected to play a vital role in improving the information density of non-spatial-dependent disease marker detection.

[0005] DNA methylation is ubiquitous in eukaryotic cells and is an important epigenetic form of regulating gene expression. It essentially changes chromatin structure and DNA stability by modifying DNA sequences. It can also affect the way DNA interacts with proteins, achieve gene expression regulation, and play an important role in cell growth and development, cell differentiation, and gene imprinting. Abnormal DNA methylation levels are one of the important causes of tumorigenesis. Methylation in the gene promoter region can inhibit gene transcription. It often occurs in the early stages of cancer and runs through the entire cancer process. Therefore, the detection of DNA methylation, especially cancer-specific methylation markers, is of great significance for early screening of cancer.

[0006] At present, the detection methods of DNA methylation can be divided into bisulfite conversion-based, immune / affinity reaction-based and restriction endonuclease-based detection methods according to the detection principle. The latter two methods can compare the processed sample detection with the InputDNA to determine the change in the methylation level of the site. Methylation-specific polymerase chain reaction (MSP) is the most commonly used technology at present, and MethyLight detects and quantifies DNA through fluorescence signals. However, due to the limitations of fluorescence detection channels, the above methods are difficult to meet the multiple detection needs of DNA methylation and cannot obtain high-dimensional detection data. More and more studies have pointed out that it is usually necessary to jointly detect gene panels for disease diagnosis, and its detection sensitivity and specificity are better than single gene detection. Therefore, seeking new DNA methylation multiple detection strategies has important biological value. In recent years, SERS (surface enhanced Raman spectroscopy) has begun to be used for methylation analysis, but it is still limited in multiple analysis, and detection is often achieved with characteristic peaks of unknown significance. In comparison, three-dimensional fluorescence spectroscopy may be a more suitable potential detection method. By outputting the entire excitation and emission spectral information of each sample, a clear and unique fluorescence spectral fingerprint feature can be obtained. It can distinguish fluorophores with spectral overlaps and has broad application prospects in the biomedical field. It is often used to detect tissue or cell samples. Considering that fluorescent dyes have unique spectral characteristics, they have application potential in multiple detections in the field of molecular biology. Summary of the invention

[0007] The purpose of the present invention is to provide a one-pot high-dimensional multi-target detection method based on three-dimensional fluorescence spectroscopy to solve the problems existing in the above-mentioned prior art. The present invention combines PCR amplification and three-dimensional fluorescence spectral imaging technology, incubates the sample with a primer pair F / R and a fluorescently modified probe P and specifically identifies the target gene, and the fluorescent probe P breaks to generate a fluorescent signal for signal amplification. The amplified product is subjected to three-dimensional fluorescence spectral imaging to output all excitation and emission spectral information to obtain the characteristic fingerprint of the sample, thereby constructing a one-pot high-dimensional multi-target detection method based on three-dimensional fluorescence spectroscopy.

[0008] To achieve the above object, the present invention provides the following solutions:

[0009] The present invention provides a one-pot high-dimensional multi-target detection method based on three-dimensional fluorescence spectroscopy, comprising the following steps:

[0010] Designing primer pairs and probes according to the target gene, and incubating the primer pairs and probes with the sample to be tested to specifically identify the target gene and amplify it; wherein the probe is modified with a fluorescent group;

[0011] The amplified product outputs all excitation and emission spectrum information through a three-dimensional fluorescence spectrum image to obtain the characteristic fingerprint of the sample to be tested.

[0012] Optionally, the amplification is PCR amplification, LAMP loop-mediated isothermal amplification, ERA enzymatic recombination isothermal amplification and recombinase polymerase amplification; and / or the fluorescent group includes but is not limited to AMCA, ATTO425, FAM, TET, JOE, VIC, ROX, Texas Red, ATTO590, CY5 or CY5.5; and / or the sample to be tested includes a step of treating it by bisulfite conversion before incubation.

[0013] Optionally, the target gene is selected from the DNA of a tumor, a virus or a bacterium.

[0014] Preferably, the target gene includes a DNA methylated gene.

[0015] More preferably, the DNA methylated genes include methylated genes associated with tumors.

[0016] More preferably, the tumor comprises colon cancer.

[0017] The present invention also provides a one-pot high-dimensional multi-target detection kit based on three-dimensional fluorescence spectroscopy, wherein the kit comprises reagents for achieving the purpose of one-pot high-dimensional multi-target detection using the described method.

[0018] The present invention also provides the use of the kit in single-plex detection or multiple-plex detection of DNA methylation.

[0019] The present invention also provides a DNA methylation single-plex detection method, comprising the steps of treating a sample DNA to be tested by bisulfite conversion, and then detecting a single methylated gene in the sample DNA to be tested by using the method described.

[0020] In one embodiment, the above-mentioned single-plex DNA methylation detection method comprises the following steps:

[0021] Step a1: treating the sample DNA to be tested by bisulfite conversion so that the 5-methylcytosine residues remain unchanged and the unmethylated cytosine residues are converted to uracil;

[0022] Step b1: incubating the converted DNA sequence with the primer pair and probe (with fluorescent group) designed according to the target gene and identifying the target gene for signal amplification, and amplifying the signal with the fluorescent probe;

[0023] Step c1: Use three-dimensional fluorescence spectrum imaging to output all excitation and emission spectrum information of the amplified product to form a characteristic fingerprint of the sample.

[0024] In the above embodiment, the sample DNA to be tested may be tumor-related DNA, more specifically, tumor-related methylation genes, such as intestinal cancer-related methylation genes, more specifically, colorectal cancer-related methylation genes.

[0025] The present invention also provides a DNA methylation multiplex detection method, comprising the steps of treating a sample DNA to be tested by bisulfite conversion, and then detecting at least two methylated genes in the sample DNA to be tested by using the method described.

[0026] In one embodiment, the above-mentioned DNA methylation multiple detection method comprises the following steps:

[0027] Step a2: treating the sample DNA with bisulfite conversion to keep the 5-methylcytosine residues unchanged and convert the unmethylated cytosine residues into uracil;

[0028] Step b2: designing several sets of primer pairs and probe specific sequences for different methylated DNA targets, and modifying different fluorescent groups with different emission spectra / excitation spectra on different probes, including fluorescent groups with overlapping fluorescence spectra;

[0029] Step c2: incubating the several primer pairs and fluorescent labeled probes in step b2 with the transformed sample in step a2, and different primer pairs and fluorescent probes recognize different DNA methylation targets for PCR amplification to achieve signal amplification;

[0030] Step d2: The amplified product is subjected to three-dimensional fluorescence spectral imaging to obtain all excitation and emission spectral information and form a characteristic fingerprint of various methylated DNAs in the same sample.

[0031] The above-mentioned different DNA methylation targets include but are not limited to nucleic acids (DNA), viruses and bacteria. The above-mentioned nucleic acids include nucleic acid samples from body fluids such as cultured cells, paraffin tissue sections and frozen tissue sections, saliva samples and vaginal secretions. It also includes tumor-related methylation genes, which are screened and determined by detecting targets, and primer pairs and probes for different targets are designed, which are then incubated and amplified with the DNA of the tumor sample to be tested that has been converted by bisulfite, and three-dimensional fluorescence spectral imaging is used to obtain characteristic fingerprints of various methylated DNAs, characterize the expression pattern of tumor methylation markers and perform accurate identification. The above-mentioned tumors include intestinal cancer-related methylation genes, and more specifically, colorectal cancer-related methylation genes can be selected.

[0032] The present invention discloses the following technical effects:

[0033] The present invention combines PCR with three-dimensional fluorescence spectrum imaging, amplifies the DNA sequence with primer pair F / R, and amplifies the signal with fluorescent probe P, obtains all excitation emission spectrum information through three-dimensional fluorescence spectrum imaging, forms a characteristic fingerprint map with practical significance, and realizes one-pot high-dimensional multi-target detection of genes in a 350nm×300nm matrix. Through this fingerprint imaging method, different fluorescent modifications can be distinguished in a single sample single flux, and single sample high-throughput gene detection, especially DNA methylation detection, can be further realized, and effective distinction can be achieved before and after the methylation level is changed, breaking through the problems of low flux of existing methylation detection, and providing a diversified solution for solution system multiple marker expression pattern analysis. In addition, the present invention can be further extended to other nucleic acid type detection, changing the targeting sequence of primer pair F / R and fluorescently modified probe P, can realize molecular recognition of nucleic acids, viruses and bacteria, etc., and at the same time, the fluorescent modification type can be further expanded or other fluorescent elements can be used in a 350nm×300nm matrix, which will have important application value in the field of molecular biology single sample high-throughput detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Schematic diagram of a one-pot high-dimensional multi-target detection method based on three-dimensional fluorescence spectroscopy;

[0035] Figure 2 The results of spectral fingerprints of different fluorescent modification groups are shown;

[0036] Figure 3 The fingerprint results and PCR results of single molecule detection; a: fingerprint, b: linear results of fingerprint feature points, c: consistency between fingerprint results and PCR results;

[0037] Figure 4The fingerprint spectrum and PCR results of the single methylation gene detection with ACTB as the internal reference gene; a: PCR result, b: fingerprint spectrum;

[0038] Figure 5 The fingerprint spectrum results and PCR results of single-molecule detection of different methylation levels of ACTB as the internal reference gene in HCT116 and SW480; a: PCR results, b: fingerprint spectrum;

[0039] Figure 6 The fingerprint results of six DNA methylation genes in colorectal cancer cells with ACTB as the internal reference gene are represented; a: fingerprint, b: fingerprint feature point representation;

[0040] Figure 7 Characterization of fingerprint results of 6 DNA methylation genes with ACTB as internal reference gene at different methylation levels in HCT116 and SW480; a: 5-Aza-Dc drug treatment, b: DNMT1 knockdown;

[0041] Figure 8 The fingerprint results of 8 colorectal cancer-related DNA methylation genes with ACTB as the internal reference gene; a: detection flow chart, b: fingerprint of normal tissue (left) and cancer tissue (right), c: emission wavelength of methylation sites extracted under the optimal excitation wavelength of each fluorescence; d: difference in fluorescence characteristic values ​​of methylation sites in fingerprints of cancer and adjacent tissues, e: difference in fluorescence characteristic values ​​of methylation sites after data normalization with ACTB as the reference, f: ROC curve of fluorescence characteristic values ​​of methylation sites for colorectal cancer diagnosis, g: PCA analysis of fluorescence characteristic values ​​of methylation sites for colorectal cancer;

[0042] Fig. 9 This is the spectral fingerprint result of the nucleic acid complementary sequence (the fluorescence number increases one by one). DETAILED DESCRIPTION

[0043] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0044] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0045] The present invention combines PCR amplification and three-dimensional fluorescence spectral imaging technology, incubates the sample with primer pair F / R and fluorescently modified probe P and specifically identifies the target gene, breaks the fluorescent probe P to generate a fluorescent signal for signal amplification, and outputs all excitation and emission spectral information of the amplified product through three-dimensional fluorescence spectral imaging to obtain the characteristic fingerprint of the sample, thereby constructing a one-pot high-dimensional multi-target detection method based on three-dimensional fluorescence spectroscopy (schematic diagram as shown in FIG. Figure 1 The above scheme is further described below by way of embodiments.

[0046] Example 1

[0047] This embodiment uses a plasmid template to simulate a one-pot high-dimensional multi-target detection method based on three-dimensional fluorescence spectroscopy. The specific implementation steps are as follows:

[0048] Dilute the template plasmid to 10% with TE buffer. 10 Copies / μL, then dilute 10 times to prepare 10 9 -10 1 Copies / μL plasmid template. The plasmid template is used for subsequent experiments or stored at -20℃ for future use.

[0049] The primer pair F / R and probe of SDC2 were mixed and incubated with the template plasmid. The primer pair F / R and the fluorescently modified probe P specifically recognized the target gene and performed PCR amplification. The fluorescent probe P was broken to generate a fluorescent signal for signal amplification. The amplification system was 2 μL template, 0.4 μL primer F (10 μM), 0.4 μL primer R (10 μM), 0.8 μL probe P (10 μM) and 10 μL PrimeSTAR Max Premix (2X), and ddH 2 O to make up the volume to 20 μL. The PCR reaction conditions were 95°C for 30 s, 36 cycles of 95°C for 10 s, 56°C for 30 s, 72°C for 10 s, then 50°C for 30 s, and 4°C ∞. The amplified product was diluted to a volume of 500 μL with PBS, and three-dimensional fluorescence spectroscopy (3D spectroscopy) imaging was used to output all excitation emission spectral information to obtain the sample characteristic fingerprint. 3D spectroscopy parameter settings: excitation light scanning range of 350-700 nm, step interval of 5.0 nm, excitation bandwidth of 3.0 nm or 5 nm; emission light scanning range of 400-900 nm, step interval of 2.0 nm, emission bandwidth of 3.0 nm or 5 nm; scanning speed of 6000 nm / min, sensitivity of High.

[0050] The above amplified target sequence is: attctcaaggcagaaaagctacatacgtctctcgtttcttcactaattgttctctagaaaagggaaagtgaagaagggaaa gagaaaagacaacggggaagaaaagagcatagaggagagaggaaaagtggggagagaaaggaagaaaaggactgagaaaacgcagg;

[0051] Primer F: ATTCTCAAGGCAGAAAAGCTAC, Primer R: CCTGCGTTTTCTCAGTCC, Probe P: CTATGCTCTTTTCTTCCCCGTTGT. The fluorescent modifications of the above probes include but are not limited to AMCA, ATTO425, FAM, TET, JOE, VIC, ROX, Texas Red, ATTO590, CY5, and CY5.5.

[0052] The results are as follows Figure 2 and Figure 3 As shown. Figure 2 It can be seen that the use of plasmid templates can successfully obtain all the excitation and emission spectrum information of the modified fluorescent species, and the three-dimensional fingerprints of different fluorescent modification groups have different fingerprint characteristics. Figure 3 The results showed that the fluorescence intensity of the fingerprint was significantly dependent on the template concentration, and the maximum fluorescence value was highly consistent with the PCR result. The detection capabilities of the two were equivalent, indicating the feasibility of three-dimensional fluorescence spectroscopy in the field of molecular detection, which is conducive to further verification and technical expansion.

[0053] Example 2

[0054] Application of a one-pot high-dimensional multi-target detection method based on three-dimensional fluorescence spectroscopy for single-molecule detection of ITGA4 methylation in colorectal cancer cells.

[0055] DNA of 8 colon cancer cell lines (HIEC, SW480, HCT116, SW1116, SW620, HT-29, RK, LOVO) was extracted and the samples were stained with ZYMO RESEARCH's EZ DNA Methylation TMKit for bisulfite conversion, so that 5-methylcytosine residues remain unchanged and unmethylated cytosine residues are converted to uracil to distinguish methylated genes from unmethylated genes. 0.4 μL of primers F / R (Table 1, F3 / R3) and 0.8 μL of probe P (Table 1, P3), 0.4 μL of internal reference primer F (10 μM), 0.4 μL of internal reference primer R (10 μM), 0.8 μL of internal reference probe P (10 μM), and 10 μL of PrimeSTARMax Premix (2X) were mixed, incubated with 2 μL of converted sample, and washed with ddH 2 O was added to make the volume 20 μL, and the PCR reaction conditions were 95℃30s, 40 cycles of 95℃10s, 56℃30s, 72℃10s, then 50℃30s, 4℃∞, with β-actin as the internal reference gene. The amplified product was diluted to a volume of 500 μL with PBS, and 3D spectral imaging was used to output all excitation emission spectral information to form a characteristic fingerprint of the sample. Parameters of 3D spectrum: excitation light scanning range of 350-700nm, step interval of 5.0nm, excitation bandwidth of 3.0nm or 5nm; emission light scanning range of 400-900nm, step interval of 2.0nm, emission bandwidth of 3.0nm or 5nm; scanning speed of 6000nm / min, sensitivity of High.

[0056] Table 17 Primer pair F / R and probe P sequences

[0057] name Sequence number Sequence (5'-3') F1 SEQ ID NO.1 ATTCTCAAGGCAGAAAAGCTAC R1 SEQ ID NO.2 CCTGCGTTTTCTCAGTCC P1 SEQ ID NO.3 CTATGCTCTTTTCTTCCCCGTTGT F2 SEQ ID NO.4 TTACGGTGATTTTTGGGTTCG R2 SEQ ID NO.5 GCCACAAAACCCGCAACA P2 SEQ ID NO.6 ACGCGCGCGTGGGTATTTACGTGA F3 SEQ ID NO.7 AGTGCGCGGTATTTTAGGTC R3 SEQ ID NO.8 ACACGAATACGACGATTAACCAAC P3 SEQ ID NO.9 AAAACGCAACGTATCCGACGCCAACGA F4 SEQ ID NO.10 TTTCGTTCGGATTCGGGAT R4 SEQ ID NO.11 CCAACTCCCCGCGCTA P4 SEQ ID NO.12 TCCGAAAATCGCCGCACTTCC F5 SEQ ID NO.13 AGATTAGTTTGGTTAATATGGTGA R5 SEQ ID NO.14 CCTCCCGAATTCAAACGA P5 SEQ ID NO.15 ACTAAAATTACAACCGCGTACCAC F6 SEQ ID NO.16 AGACGGAGTTTTATTTTGTCGTTT R6 SEQ ID NO.17 ATAATCCCAACCCCTCGAA P6 SEQ ID NO.18 AACCCAAATAACGCCACTACACT F-Actin SEQ ID NO.19 TGGAATTTTGTAGGTTTTATTTGTT R-Actin SEQ ID NO.20 AAAACCACTTTACACCAACCTCA P-Actin SEQ ID NO.21 AGGTGTTTAAGATAGTGTTGTGGGTGTAGG

[0058] The three-dimensional fluorescence imaging technology was compared with the Methylight technology. The CT value and fluorescence change of the target gene and the internal reference gene were obtained according to the Methylight operation steps. The analysis results were compared with the fingerprint results. Figure 4 shown.

[0059] After that, the DNA methylation level in cells was downregulated by knocking down DNMT1 or using 5-Aza-dC drug treatment. After extracting the cell DNA, Methylight and three-dimensional fluorescence spectral imaging of ITGA4 in SW480 cells and HCT116 cells were performed according to the above steps. The results are as follows Figure 5 shown.

[0060] Depend on Figure 4It can be seen that the three-dimensional fluorescence spectrum detection technology can perform fingerprint analysis on a single methylated gene of a cell, and different expressions can be distinguished by the three-dimensional fingerprint characteristics. The analysis of the results with Methylight showed that the spectral fingerprint characteristics were consistent with the methylation level detection results of Methylight, that is, the accuracy of the three-dimensional fluorescence spectrum detection results was high. Subsequently, the two colorectal cancer cell lines SW480 and HCT116 were knocked down DNMT1 or treated with 5-Aza-dC drugs. The results are as follows Figure 5 As shown, when the intracellular DNA methylation level is downregulated, the ITGA4 methylation level is significantly reduced and the three-dimensional fingerprint characteristics are significantly changed, proving that three-dimensional fluorescence spectroscopy detection can accurately characterize cellular DNA methylation and its level changes, and three-dimensional fluorescence spectroscopy imaging has important application potential in the field of molecular biological detection.

[0061] Example 3

[0062] Application of one-pot high-dimensional multi-target detection method based on three-dimensional fluorescence spectroscopy in multiplex detection of DNA methylation.

[0063] DNA of eight colon cancer cell lines (HIEC, SW480, HCT116, SW1116, SW620, HT-29, RK, LOVO) was extracted and the samples were converted by bisulfite using EZ DNA MethylationTM Kit of ZYMO RESEARCH. 0.4 μL of primer F (10 μM), 0.4 μL of primer R (10 μM), 0.8 μL of probe P (10 μM) and 10 μL PrimeSTAR Max Premix (2X) of SDC2 (F1 / R1 / P1), SPG20 (F2 / R2 / P2), ITGA4 (F3 / R3 / P3), SEPTIN9 (F4 / R4 / P4), SFRP1 (F5 / R5 / P5), TFPI2 (F6 / R6 / P6) and internal reference genes (Table 1) were mixed, incubated with 2 μL of converted samples, and washed with ddH 2 O to make up the volume to 20 μL, the PCR reaction conditions are 95℃30s, 40 cycles of 95℃10s, 56℃30s, 72℃10s, then 50℃30s, 4℃∞, the amplified product is diluted with PBS to a volume of 500μL, 3D spectrum is used, the excitation light scanning range is 350-700nm, the step interval is 5.0nm, the excitation bandwidth is 3.0nm or 5nm; the emission light scanning range is 400~900nm, the step interval is 2.0nm, the emission bandwidth is 3.0nm or 5nm; the scanning speed is 6000nm / min, and the sensitivity is High. After that, β-actin is used as the internal reference gene and the above operation is used for a one-pot reaction, and the three-dimensional fingerprint information is obtained by three-dimensional fluorescence spectrum imaging. Figure 6 shown.

[0064] Subsequently, the intracellular DNA methylation level was downregulated by knocking down DNMT1 or using 5-Aza-dC drug treatment. After extracting the cell DNA, three-dimensional fluorescence spectral imaging of seven genes in SW480 cells and HCT116 cells was performed according to the above steps. The results are as follows Figure 7 shown.

[0065] Depend on Figure 6 It can be seen that the three-dimensional fluorescence spectroscopy detection technology shows good applicability in the detection of DNA methylation of different genes. Different primer pairs and probes specifically bind to the target gene to form different three-dimensional fingerprint map characteristics, which is conducive to the subsequent one-pot multi-target detection. At the same time, a total of 7 genes with β-actin as the internal reference were imaged simultaneously. The results showed that the three-dimensional fluorescence spectrum can simultaneously characterize multiple DNA methylations. The corresponding positions of the genes are consistent with the types of fluorescent groups modified by their probes, and different colorectal cancer cell lines show different three-dimensional fingerprint map characteristics. Different cell lines can be distinguished by three-dimensional fingerprint characteristics. Subsequently, the two colorectal cancer cell lines SW480 and HCT116 were knocked down DNMT1 or treated with 5-Aza-dC drugs. The results are as follows. Figure 7 As shown, when the intracellular DNA methylation level is downregulated, the three-dimensional fingerprint map characteristics change significantly, proving that multiple DNA methylation detections can be analyzed simultaneously by analyzing the three-dimensional fingerprint characteristics, and their level changes can be distinguished.

[0066] Example 4

[0067] Application of one-pot high-dimensional multi-target detection method based on three-dimensional fluorescence spectroscopy in multiplex detection of colorectal cancer-related methylation genes

[0068] Fourteen methylated cg sites associated with colorectal cancer were obtained through bioinformatics analysis, and 8 cg sites (cg13056495-NM_001628, cg25468863-NM_015087, cg15322783-NM_001037232, cg23609571-NM_183002, cg27253670-NM_007084, cg07175149-NM_018413, cg07399369-NM_004267, cg27573591-NM_014390) were further determined for subsequent detection, and corresponding primers and probes were designed for multiplex detection for colorectal cancer diagnosis (Table 2). DNA samples of colorectal cancer and adjacent tissues were extracted and converted with bisulfite using the EZ DNA MethylationTM Kit from ZYMO RESEARCH. 0.4 μL of primer F (10 μM), 0.4 μL of primer R (10 μM), 0.8 μL of probe P (10 μM) and 10 μL PrimeSTAR Max Premix (2X) of the 9 primer pairs and probes (Table 2) including β-actin were mixed and incubated with 2 μL of the converted sample and then incubated with ddH 2 O was added to make the volume to 20 μL. The PCR reaction conditions were 95°C for 30 s, 40 cycles of 95°C for 10 s, 56°C for 30 s, and 72°C for 10 s, followed by 50°C for 30 s and 4°C ∞. The amplified product was diluted with PBS to a volume of 500 μL. A 3D spectrum was used, with an excitation light scanning range of 350-700 nm, a step interval of 5.0 nm, and an excitation bandwidth of 3.0 nm or 5 nm; an emission light scanning range of 400 to 900 nm, a step interval of 2.0 nm, and an emission bandwidth of 3.0 nm or 5 nm; a scanning speed of 6000 nm / min, and a sensitivity of High. After a one-pot reaction using the above operation with β-actin as the internal reference gene, three-dimensional fingerprint information was obtained by three-dimensional fluorescence spectral imaging. The results are shown in Figure 8 shown.

[0069] Table 28 Primer pair F / R and probe P sequences

[0070] name Sequence number Sequence (5'-3') F1 SEQ ID NO.22 GAGCGGCGTTAATATATAAGAG R1 SEQ ID NO.23 GCGATATTACAAACGACAACCA P1 SEQ ID NO.24 CTCATCCTTTTATCCTTCAATCAAAACGT F2 SEQ ID NO.25 TTACGGTGATTTTTGGGTTCG R2 SEQ ID NO.26 GCCACAAAACCCGCAACA P2 SEQ ID NO.27 ACGCGCGCGTGGGTATTTACGTGA F3 SEQ ID NO.28 GTCGGATGGTGTTGGTTATTT R3 SEQ ID NO.29 ACGAACTAAAACGCGAAAAAA P3 SEQ ID NO.30 CCACGCTAACGCGCCCCCTAC F4 SEQ ID NO.31 TTCGGTTAGAGGTTTAGTAAAGC R4 SEQ ID NO.32 GTTCTCTAACTTCCGACACC P4 SEQ ID NO.33 AATCTATAACTACGCCCTCTCGAA F5 SEQ ID NO.34 TAGTAGGTTTCGCGGTTTTAT R5 SEQ ID NO.35 GAAACGACTACTCCCTCAACT P5 SEQ ID NO.36 CCCGAAAAACCCGACCCAAAC F6 SEQ ID NO.37 ATTTGTAGTTCGGTTGT R6 SEQ ID NO.38 GCACTACGCCTTATTAACAA P6 SEQ ID NO.39 CGAAACGATTAAAACCAACTATTTAC F7 SEQ ID NO.40 ATTTTTTCGTTGTTGGTCGAG R7 SEQ ID NO.41 CAAACGAAACGTCACCCTA P7 SEQ ID NO.42 ACAACGCCGCACTAACTAACA F8 SEQ ID NO.43 ATTATTTAGTCGATTGGGGGT R8 SEQ ID NO.44 GAAAACGCAAAACGCAACAAT P8 SEQ ID NO.45 CTTAACTCCGAACAAAATACGCCGAT F-Actin SEQ ID NO.46 TGGAATTTTGTAGGTTTTATTTGTT R-Actin SEQ ID NO.47 AAAACCACTTTACACCAACCTCA P-Actin SEQ ID NO.48 AGGTGTTTAAGATAGTGTTGTGGGTGTAGG

[0071] Depend on Figure 8 It can be seen that three-dimensional fluorescence spectroscopy can successfully perform one-pot multi-target detection, and shows good detection efficiency in multiple detections of colorectal cancer-related methylation genes. Colorectal cancer tissue and adjacent cancer tissue have significantly different fingerprint characteristics, and cancer and adjacent cancer tissues can be distinguished by obtaining key wavelengths, indicating that this technology has important application value in characterizing the expression pattern of colorectal cancer methylation markers and the accurate identification of colorectal cancer.

[0072] Example 5

[0073] Analysis on the feasibility of expanding the application of three-dimensional fluorescence spectroscopy technology for simulating molecular recognition of nucleic acid complementary sequences

[0074] Design ten pairs of nucleic acid sequences for complementary recognition (F1: CCTGTTTTGATTTCGCCTC, R1: ATATCCTTAAAGTCTCCACGAT, P1: CTCTGACACCACCCTCCAGT; F2: ATTCTCAAGGCAGAAAAGCTAC, R2: CCTGCGTTTTCTCAGTCC, P2: CTATGCTCTTTTCTTCCCCGTTGT; F3: CCATCCCGATC TTGCTCT,R3:ATTCGTGCCCGTACAGAC,P3:CTTCCAGCCTCCATGTCACCT;F4:CCGTGATGCCTTCGAGTATT,R4:GGAAGGGTTTCGTCGTTGTA,P4:TCCTGTGTGACTGGTGAGACTCTTGTA;F5:AGTCCTGCCTTACTCTTGGTG,R5:GTGTCTGTGTGCTAA AACCAT,P5:TCCTGTGGTCCTAGTCAAGTGCCT;F6:GACTCGCGAGGTTCTCTGTC,R6:CCTTCGGACC CAAGAGTCAC,P6:CTGCCGCCCTCGCTCCTTTTC;F7:GAGAGGGGCGTTATGATGGG,R7:ACGTGAAC ACCATTCTCGCT,P7:AGGGGGCCCGCAGTGTCCGTCA; F8:TCATGGATTTGGGAGCATAGG,R8:GAGTG AGCAGAGGAGAAGAAAG,P8:ATAGGCCAGAGAGGGAAGCAGA;F9:GAAGTTTTTTGCTGCGTAGAC,R9:GAAATGCCATAGGTCCTGT,P9:CCCCAAGGTCAATTGCACGA;F10:CACCAGCCTTTCAAATACCTG A, R10: GCTAGACGGAAATGACCTGC, P10: TCCGGCTTCTTTACAGCGCAA), and the probes were modified with different fluorescence (fluorescence modifications include but are not limited to AMCA, ATTO425, FAM, TET, JOE, VIC, ROX, Texas Red, ATTO590, CY5, CY5.5), and the following operations were performed: 0.4 μL primer F (10 μM), 0.4 μL primer R (10 μM) and the corresponding 0.8 μL probe P (10 μM) were mixed with 10 μL PrimeSTAR Max Premix (2X), and incubated with 2 μL mock sample, and then washed with ddH 2O to make up the volume to 20 μL, and perform PCR. The reaction conditions are 95℃30s, 36 cycles of 95℃10s, 56℃30s, 72℃10s, then 50℃30s, 4℃∞. The amplified product was diluted with PBS to a volume of 500 μL. A 3D spectrum was used, with an excitation light scanning range of 350-700nm, a step interval of 5.0nm, and an excitation bandwidth of 3.0nm or 5nm; an emission light scanning range of 400-900nm, a step interval of 2.0nm, and an emission bandwidth of 3.0nm or 5nm; a scanning speed of 6000nm / min, and a sensitivity of High. Each scan adds a fluorescent modification, and the results are as follows: Figure 9 shown.

[0075] from Figure 9 It can be seen that in molecular biology detection, arbitrary imaging of three-dimensional fluorescence spectra can be achieved through nucleic acid complementary sequences and fluorescent modifications. As the number of detected fluorescence types increases, the final three-dimensional fingerprint map presents different fingerprint characteristics. This shows that one-pot high-dimensional multi-target detection based on three-dimensional fluorescence spectroscopy can detect and analyze a variety of nucleic acid molecules, and can obtain higher-throughput information imaging by adjusting the type of fluorescent modification. It can be further expanded to the detection of other nucleic acid molecules. It has a wide range of related application fields and scenarios in molecular biology detection.

[0076] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A one-pot high-dimensional multi-target detection method based on three-dimensional fluorescence spectroscopy, characterized in that: The following steps are involved: Designing primer pairs and probes according to the target gene, and incubating the primer pairs and probes with the sample to be tested to specifically identify the target gene and amplify it; wherein the probe is modified with a fluorescent group; The amplified product outputs all excitation and emission spectrum information through a three-dimensional fluorescence spectrum image to obtain the characteristic fingerprint of the sample to be tested.

2. The method according to claim 1, characterized in that The amplification includes PCR amplification, LAMP loop-mediated isothermal amplification, ERA enzymatic recombination isothermal amplification and recombinase polymerase amplification; and / or the fluorescent group includes AMCA, ATTO425, FAM, TET, JOE, VIC, ROX, Texas Red, ATTO590, CY5 or CY5.5; and / or the sample to be tested includes a step of being treated by bisulfite conversion before incubation.

3. The method according to claim 1, characterized in that The target gene is selected from the DNA of tumors, viruses or bacteria.

4. The method according to claim 1, characterized in that The target genes include genes with DNA methylation.

5. The method according to claim 4, characterized in that The DNA methylated genes include methylated genes associated with tumors.

6. The method according to claim 5, characterized in that The tumors include colon cancer.

7. A one-pot high-dimensional multi-target detection kit based on three-dimensional fluorescence spectroscopy, characterized in that: The kit includes reagents for achieving one-pot high-dimensional multi-target detection using the method described in any one of claims 1-6.

8. Use of the kit as claimed in claim 7 in preparing a single- or multiple-detection product for DNA methylation.

9. A single-plex DNA methylation detection method, characterized in that: The method comprises the steps of treating the DNA sample to be tested by bisulfite conversion, and then detecting a single methylated gene in the DNA sample to be tested by the method according to any one of claims 1 to 6.

10. A multiplex detection method for DNA methylation, characterized in that: The method comprises the steps of treating the sample DNA to be tested by bisulfite conversion, and then detecting at least two methylated genes in the sample DNA to be tested by the method according to any one of claims 1 to 6.

Images