SNP molecular marker based on RYR2 gene and related to pig hypoxia resistance and application of SNP molecular marker

Abstract

The invention discloses an RYR2 gene-based SNP molecular marker related to pig hypoxia resistance and application of the RYR2 gene-based SNP molecular marker. The SNP molecular marker is located at the 399th site of a nucleotide sequence of a core promoter region of an RYR2 gene, a basic group is C or T, and T is a dominant allele under a hypoxia condition; and the nucleotide sequence of the core promoter region of the RYR2 gene is-1bp to-715bp of the sequence as shown in SEQ ID NO. 15. Through high and low altitude transcriptome analysis of Tibetan pigs and a pig skeletal muscle satellite cell hypoxia model, it is found that the RYR2 gene plays an important role in pig hypoxia resistance, a dual-fluorescein reporter vector is constructed by using an RYR2 gene promoter region, and the SNP site (g.399Cgt; t). The invention provides the SNP molecular marker to assist the breeding method of the hypoxia-resistant pig breeds, a large amount of group scale sampling and determination are not needed, and the breeding efficiency of the hypoxia-resistant pig breeds is effectively improved.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to a SNP molecular marker related to pig hypoxia tolerance based on RYR2 gene and its application. Background Art

[0002] Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level. It is usually a dimorphic marker and is the most widely distributed genetic polymorphic marker type in the genome. SNP has the advantages of large quantity, high frequency, and low mutation rate. Compared with traditional breeding methods, molecular breeding greatly accelerates the breeding efficiency. It is not affected by the environment. Through genetic background selection, it reduces linkage drag, thereby accelerating the breeding process and accuracy, allowing breeders to efficiently breed livestock and poultry varieties with excellent traits.

[0003] RyR is a calcium ion release channel widely present in muscle cells (including skeletal muscle and cardiac muscle) and brain tissue. Its function is to quickly release calcium ions in the endoplasmic reticulum or sarcoplasmic reticulum into the cytoplasm after receiving upstream signals, thereby triggering further signal transmission, such as muscle contraction. In mammals, there are three subtypes of RyR, of which RyR1 and RyR2 have been shown to play a role in excitation-contraction coupling (ECC) of skeletal muscle and cardiac muscle. Studies have reported that the activity of pulmonary artery smooth muscle RyR receptors is significantly increased in a mouse model of chronic hypoxia. Inhibiting or knocking out the RyR2 gene can prevent calcium signals in mouse smooth muscle cells from being affected by oxygen concentration, indicating that RYR2 may play a key role in hypoxia tolerance. While the functional studies of RYR2 and its family members in mouse models are relatively thorough, it is not clear whether they have stress tolerance in pigs. Pig breed selection is affected by different local climate environments (such as temperature, oxygen, etc.). Breeding pig breeds with strong stress resistance can increase production and reduce breeding costs. The breeding of low-oxygen-resistant pig breeds is expected to improve the adaptability of commercial pigs or local pigs to high-altitude ecological environments and accelerate the progress of genetic improvement. Summary of the invention

[0004] In view of the deficiencies in the prior art, the purpose of the present invention is to provide a SNP molecular marker based on RYR2 and related to pig hypoxia tolerance and its application, wherein the SNP molecular marker is located at the 399th position of the nucleotide sequence of the core promoter region of the RYR2 gene, and the base is C or T; the nucleotide sequence of the core promoter region of the RYR2 gene is -1bp to -715bp of the sequence shown in SEQ ID NO.15, and T is the dominant allele under hypoxic conditions.

[0005] In order to solve the above technical problems, the technical solution provided by the present invention is:

[0006] A SNP molecular marker related to hypoxia tolerance in pigs based on the RYR2 gene.

[0007] The SNP molecular marker is located at the 399th position of the nucleotide sequence of the core promoter region of the RYR2 gene, and the base is C or T; the core promoter region of the RYR2 gene is -1bp to -715bp of the sequence shown in SEQ ID NO.15.

[0008] Preferably,

[0009] Under hypoxic conditions, T is the dominant allele.

[0010] A primer pair for amplifying the SNP molecular marker associated with pig hypoxia tolerance based on the RYR2 gene as described in claim 1,

[0011] The forward sequence of the primer pair is shown in SEQ ID NO.22;

[0012] The reverse sequence of the primer pair is shown as SEQ ID NO.23.

[0013] A reagent or kit containing primers for the above-mentioned SNP molecular markers related to pig hypoxia tolerance based on the RYR2 gene.

[0014] The application of the above-mentioned SNP molecular markers related to pig hypoxia tolerance in the assisted breeding of hypoxia-resistant pig breeds.

[0015] Preferably,

[0016] The core promoter region of the porcine RYR2 gene was detected, and the porcine RYR2 gene promoter truncations P1 and P2 were constructed to further construct recombinant plasmids pGL3-basic-RYR2-P1 and pGL3-basic-RYR2-P2. The relative luciferase activities of the recombinant plasmids pGL3-basic-RYR2-P1 and pGL3-basic-RYR2-P2 were then determined using dual luciferase activity.

[0017] Preferably,

[0018] The forward sequences of the primer pairs for amplifying the pig RYR2 gene promoter truncation P1 and P2 are shown in SEQ ID NO.16 and SEQ ID NO.17, and the reverse sequence is shown in SEQ ID NO.18.

[0019] A method for breeding hypoxia-resistant pig breeds, based on the above-mentioned SNP molecular marker, detects the SNP molecular marker located at the 399th position in the core promoter region of the RYR2 gene, and selects individuals with the allele T at this site for breeding.

[0020] A method for identifying the above-mentioned SNP molecular markers related to pig hypoxia tolerance based on the RYR2 gene comprises the following steps:

[0021] 1) Establish a hypoxia model for the proliferation of porcine skeletal muscle satellite cells;

[0022] 2) Analyzing the expression of RYR2 gene in the hypoxia model of pig skeletal muscle satellite cells by using transcriptome data of different tissues at high and low altitudes in Tibetan pigs;

[0023] 3) qRT-PCR detection of RYR2 gene expression in proliferating satellite cells of hypoxic pig skeletal muscle;

[0024] 4) construct porcine RYR2 gene promoter truncations P1 and P2, and then construct recombinant plasmids pGL3-basic-RYR2-P1 and pGL3-basic-RYR2-P2;

[0025] 5) Detect the activity of the promoter region of the porcine RYR2 gene;

[0026] 6) Transient cell transfection and dual luciferase activity assay to identify the mutation activity of the SNP site (g.-399C>T).

[0027] The beneficial effects of the present invention are:

[0028] The present invention obtains a molecular marker based on RYR2 and related to pig hypoxia tolerance, so that the breeding of hypoxia-resistant pig breeds can improve the adaptability of commercial pigs or local pigs to high-altitude ecological environments, accelerate the progress of genetic improvement, and breed pig breeds with strong stress resistance to increase production and reduce breeding costs. It does not require a large amount of group-scale sampling and measurement, and can effectively improve the efficiency of breeding hypoxia-resistant pig breeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the embodiments of the present invention, they are used to explain the present invention and do not constitute a limitation of the present invention. In the accompanying drawings:

[0030] Figure 1Figure 5 is the experimental result of high expression of RYR2 gene in the hypoxia model of porcine skeletal muscle satellite cells; A is the expression of hypoxia-related factors HIF1A, VEGF, and GLUT1 transcription levels detected by qRT-PCR after satellite cells were treated with different concentrations of cobalt chloride (0, 10, 25, 50, 100, 200 μmol / L) for 24 h (n=3, *P<0.05, **P<0.01); B is the expression of RYR2 transcription level detected by qRT-PCR after satellite cells were treated with 50 μmol / L cobalt chloride (n=3, *P<0.05, **P<0.01).

[0031] Figure 2 These are the electrophoresis diagrams of PCR products of truncated RYR2 gene promoter; A is the electrophoresis diagram of truncated P1 amplification products, with a fragment size of 715 bp; B is the electrophoresis diagram of truncated P2 amplification products, with a fragment size of 1721 bp.

[0032] Figure 3 This is the sequencing result analysis of pGL3-basic-RYR2-P1; A is the sequencing sequence of pGL3-basic-RYR2-P1; B is the sequencing peak graph of pGL3-basic-RYR2-P1.

[0033] Figure 4 This is the sequencing result analysis of pGL3-basic-RYR2-P2; wherein A is the sequencing sequence of pGL3-basic-RYR2-P2; and B is the sequencing peak graph of pGL3-basic-RYR2-P2.

[0034] Figure 5 is the relative luciferase activity of different promoter truncations of the RYR2 gene (n=3, *P<0.05, **P<0.01).

[0035] Figure 6 It is the verification result of the SNP site (g.-399C>T) of RYR2 gene; A is the electrophoresis diagram of the reverse PCR product of the mutant fragment, and the fragment size is 5490bp; B is the sequencing peak diagram of pGL3-basic-RYR2-SNP (g.-399C>T); C is the relative luciferase activity of the promoter expression vector of RYR2 SNP site (g.-399C>T) (n=3, *P<0.05, **P<0.01). DETAILED DESCRIPTION

[0036] The preferred embodiments of the present invention are described below in conjunction with the accompanying drawings. It should be understood that the following embodiments are provided only for the purpose of illustration and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0037] Example 1 Expression of RYR2 gene in the comparison of transcriptomes at high and low altitudes in Tibetan pigs

[0038] The transcriptome data of different tissues of Tibetan pigs at high and low altitudes were downloaded from NCBI "GEO DataSets" (heart: GSE114779; lung: GSE88409; skeletal muscle: GSE90510). Differential gene analysis was performed using DESeq2, and it was found that the pig RYR2 gene was an up-regulated differentially expressed gene, indicating that the RYR2 gene may play an important role in hypoxia tolerance.

[0039] Example 2 Expression of RYR2 gene in porcine satellite cells treated with hypoxia

[0040] (1) Isolation and culture of porcine skeletal muscle satellite cells in vitro

[0041] The longissimus dorsi muscle tissue of wild-type experimental pigs was collected, digested with collagenase II and Dispase II, isolated and purified by differential adhesion to obtain pig skeletal muscle satellite cells (PSCs). PSCs cells were cultured at 37°C and 5% CO2 in F12 medium containing 20% ​​(v / v) fetal bovine serum (FBS) and 0.1% (w / v) gentamicin / ampicillin.

[0042] (2) Construction of a hypoxic model of porcine skeletal muscle satellite cells

[0043] Porcine satellite cells were plated at 10 per well. 4 The cells were inoculated in 24-well plates and treated with different concentrations of cobalt chloride (0, 10, 25, 50, 100, 200 μmol / L) for 24 h. Figure 1 As shown in A, qRT-PCR detection found that the expression levels of hypoxia-related factors HIF1A, VEGF, and GLUT1 were significantly increased during the proliferation of porcine satellite cells treated with 50 μmol / L cobalt chloride and were greater than those at other concentrations. It is speculated that 50 μmol / L cobalt chloride is the optimal concentration for hypoxia treatment and is used as a hypoxia model for porcine skeletal muscle satellite cells in subsequent experiments.

[0044] (3) qRT-PCR detection of RYR2 gene expression in hypoxic pig skeletal muscle satellite cells

[0045] Subsequently, the expression changes of RYR2 gene during the proliferation of satellite cells treated with 50 μmol / L cobalt chloride hypoxia were detected. Figure 1 As shown in B, the qRT-PCR results showed that the expression level of RYR2 gene was significantly increased, indicating that RYR2 may play an important role in the proliferation of pig skeletal muscle as a hypoxia-resistant gene.

[0046] The steps of qRT-PCR are as follows: Use Trizol solution to lyse cells (add 500 μL of Trizol to one 24-well tube), extract total RNA, and reverse transcribe it into cDNA using RT-PCR technology. Design qPCR primers for specific genes, use 18S as an internal reference, amplify on a fluorescent quantitative PCR instrument, and detect mRNA expression levels. The detailed information of the primers used is as follows:

[0047] 18S-F: CCTGCGGCTTAATTTGACTC (SEQ ID NO. 1);

[0048] 18S-R: ATGCCAGAGTCTCGTTCGTT (SEQ ID NO. 2);

[0049] HIF1A-F:CTCCATTGCCTGCCTCTGAA(SEQ ID NO.3);

[0050] HIF1A-R:TGGGACTGTTAGGCTCAGGT (SEQ ID NO.4);

[0051] EPAS1-F:CTCCTGTCCCTCAGTTTGCTCT (SEQ ID NO.5);

[0052] EPAS1-R:TGCTGTGTCCTGTTAGCTCC (SEQ ID NO.6);

[0053] EPO-F:GCGCGCGAATGTCCT(SEQ ID NO.7);

[0054] EPO-R: CCATCGTGGCATTTTCGCC (SEQ ID NO. 8);

[0055] VEGF-F:CAACGACGAAGGTCTGGAGT (SEQ ID NO.9);

[0056] VEGF-R:CAAGGCCCACAGGGATTTTCTT (SEQ ID NO. 10);

[0057] GLUT1-F:ATCCTCATCGCCCAGGTATTT(SEQ ID NO.11);

[0058] GLUT1-R:CGGTTCTCCTCATTGCGGTT (SEQ ID NO. 12);

[0059] RYR2-F:AACCTGCTAACGTCTGGGTG (SEQ ID NO. 13);

[0060] RYR2-R:TGCTGCGTTTGATGCTTTCA (SEQ ID NO. 14);

[0061] Example 3 Construction of pig RYR2 gene promoter truncations

[0062] (1) Prediction of TSS site in the 5' flanking sequence of the porcine RYR2 gene and truncation of the promoter sequence

[0063] The 1721bp sequence at the 5' end of the RYR2 gene was analyzed by bioinformatics using the websites BDGP, ​​Promoter2.0, TSSG, and TSSWW to predict the transcription start site (TSS). Based on the existing VCF samples of Tibetan pigs and Yorkshire pigs, the SNP sites in the promoter region of the RYR2 gene were found through the two population selection analysis methods of Fst and Xpehh, and the promoter sequence of the RYR2 gene was truncated.

[0064] (2) Primer design for different truncated fragments of the promoter

[0065] According to the first 1721bp of the RYR2 gene (ENSSSCG00000010142) in the Ensembl database, the nucleotide sequence of which is shown in SEQ ID NO.15, the promoter truncation-specific primers were designed by SnapGene, the upstream and downstream primers contained KpnⅠ and XhoⅠ restriction sites, respectively, and the downstream primer (RYR2-R) remained unchanged, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. A total of two RYR2 gene promoter truncations were constructed, and the sizes of the promoter fragments were P1 (-715 / -1) and P2 (-1721 / -1).

[0066] The first 1721 bp sequence of the RYR2 gene is as follows (SEQ ID NO.15):

[0067] CGGGGTACCTGCCCTGGACCCTGCTGTTTTCTCTTATTCTTGTTCCTAAA

[0068] ATGTCTTTAATTAGTATGTTAGAATCATTATTTATTAACTGGTATTTAGATAGT

[0069] CTCCAGTATCCAGAAGAGTCTGCCTTACCCAAGAGTGTAGTTAACCTACCA

[0070] GAGTTAGCTCCATAGCGTAAGTGACAGTGATAGTAAAAGGCTGTAGGATT

[0071] TGATCAGACATCGAGCACATCAGTGCAAGTCAGTTTTTTGTTATTACCTACT

[0072] TAGAAAGCACGATTACCTTTGATCTTGCAGATTATACAAGCTACAAAGATGC

[0073] TTCATTATTTTTTATTATAGCCATTCTGAACATGAATTAATATTCAGATGTACT

[0074] CATTATGTGAAAATAATGTTATTTTTTTTTAAGCAGTTGACTTTAAAAATGTAG

[0075] CAATTGAATACTCCCTGGAAATTAATGAGCACCTGGGGGGATAGTTGGAAG

[0076] GTAATTATTAAGAAATTGGACTTGGCTGTGACTGGTGCTATGAACTAGCTAT

[0077] TAGGTATTTATTGCTGCTGTCACTTAGGAAAAAAAGCAAATACATAGTGTGA

[0078] TAAGCATTTTTAAATTAGAGCTGCACTTTTTTGATTGATGTAGTGTATTCTTC

[0079] AGATGAACCCCAAAGGTTTGTTTTGCTTTTGAATATTTATTACATCTCATCAC

[0080] CTCCACCCTACAGTTGAACCATGATGAGGGCCTTCTAGGATATACTTATACA

[0081] CCTCTTCACGCTGATGTTAATCAAGAGGGTCAAAGAGTATATTTGGTTGTTG

[0082] TTTTCTAACTACTCTGTTAAGTGTTCTGTTTCTTTGAGGTTGAAATGTCAAA

[0083] ATATAAATGGTTGGACTTTTTTAGGCATTTGCCACTTAGAACCTGTGAAAGTG

[0084] AGATGCTTTGTTAAAGAAAATAATGATATCTTCCATTATTGTTGATATGGCAC

[0085] CTTTTGTATGTCAGTCACTGTGTGATTTCTTTGGTCTCAGTTCCCTTGTCAGT

[0086] CTGTTGGTGGCAGAGCTGGGGTAGGCACCCAGCTATTGCTAGTTCTGAAGC

[0087] CCTTGCTTCTTGCTGTGCCTTTGCTGTCTGTACTGAGTCAACTCTTGCACCA

[0088] TCTTTCCTTTGTGTAGTTTTCCTGTAATCTTGCTTAATGAATTGATTGGAAAT

[0089] CAAGTGTTGGATTTCAGAGGATGGAACTAACAGATCACCTCTCTCTCCATT

[0090] TTTAAACAATCTAAAATTGTTTTCAAGATGATCAAGTCACCAGTGTGTGGTT

[0091] GAACTACAATGAATTTCTGGGTTGACTTGAACCCATAAGTTCTGTTATTGAC

[0092] CCGATTTTCTGTGTCAGTTTTGGGATGGTGTGATGGTGTGTGTGTTATCTGC

[0093] TAGTAGAATCTATTCTATTCTTGATGATACTTAATGTCCTAGGAATATGTCAG

[0094] AGCATTTCTTGGTAATTTTGATGATTAAAATAATGTATAAAATCTTTTTTTTA

[0095] CCATTTTCCATGCAGTCGCCTCTGGGGATCAGTAATGGTAGTGAAAAAACT

[0096] GGTGATTGCCTTGTGTGGCAGTAACTTTCCCCTATTCCACCTACCCAGTTGT

[0097] CTTTTTTTTCCCCCCCCAAATAAAAGTACCCCAGGAATTGATTCTCTGGCTTTGGAGGGGATCAGTTGTTCTTACATTCTTTTTTCCCTGATTTTTAAAATGCACTAAAATAACAGTCTTCTAGGTCTGATTTAGACTGTCCAGGTCCTCGAGCGG

[0098] The details of the primers used are as follows:

[0099] Forward Primer:

[0100] RYR2-P1-F:5'CGGGGTACCGGCACCCAGCTATTGCTAGTTCT 3'(SEQ ID NO.16)

[0101] RYR2-P2-F: 5'CGGGGTACCTGCCCTGGACCCTGCTG3' (SEQ ID NO.17)

[0102] Reverse Primer:

[0103] RYR2-R:5'CCGCTCGAGGACCTGGACAGTCTAAATCAGACCTAGAA_3'(SEQ ID NO.18)

[0104] (3) Amplification of different truncated fragments of the promoter region and purification and recovery of products

[0105] 50μL PCR reaction system: KOD FOX Buffer 25μL, 2Mm dNTP 10μL, 1.5μL each of 10μM forward and reverse primers, 1μL template DNA, 1μL KOD FOX, and 10μL sterile water.

[0106] The amplification conditions were as follows: pre-denaturation at 94°C for 3 min, denaturation at 98°C for 15 s, annealing at 57°C for 15 s, extension at 68°C for 60 s, 35 cycles, termination extension at 68°C for 5 min, and cooling at 16°C for 2 min.

[0107] In this embodiment, a kit was used to extract pig genomic DNA. The extraction method was referred to the instructions of the blood / cell tissue genomic DNA extraction kit (Tian Gen), and the DNA concentration was determined by NanoDrop1000 micro-volume UV spectrophotometer.

[0108] The PCR products were identified by 1% agarose gel electrophoresis. Figure 2 As shown, Figure 2 A is the electrophoresis of the amplified product of truncated P1, with a fragment size of 715 bp; Figure 2 B is the electrophoresis diagram of the amplified product of truncated P2, with a fragment size of 1721 bp. After verifying that the band was in the correct position, the Magen agarose gel DNA recovery kit was used for gel excision, recovery and purification. All operations were performed in accordance with the kit instructions.

[0109] (4) Enzyme digestion and ligation of different truncated fragments of the promoter region with pGL3-basic plasmid

[0110] The gel-cutting product was double-digested with KpnⅠ and XhoⅠ at 37℃ for 3h. The system was: 1μL each of KpnⅠ and XhoⅠ, 1μg of gel-cutting product, 5μL of 10x Cutsmart Buffer, and made up to 50μL with sterile water.

[0111] The pGL3-basic plasmid was double-digested with KpnⅠ and XhoⅠ at 37℃ overnight. The system was: 1μL each of KpnⅠ and XhoⅠ, 1μg of pGL3-basic plasmid, 5μL of 10x Cutsmart Buffer, and sterile water was added to 50μL. The gel-cutting product after double digestion with KpnⅠ and XhoⅠ and the pGL3-basic plasmid after double digestion with KpnⅠ and XhoⅠ were purified using a PCR product purification kit (Magen).

[0112] The purified gel recovery product and the purified pGL3-basic plasmid were ligated with the NEB T4 ligase kit. The ligation system was: T4 Buffer 2 μL, Vecter (4 kb) 50 ng (0.020 pmol), Insert (1 kb) 37.5 ng (0.060 pmol), T4 ligase 1 μL, and sterile water was added to 20 μL. The ligation was carried out at 16°C overnight to obtain the recombinant plasmids pGL3-basic-RYR2-P1 and pGL3-basic-RYR2-P2.

[0113] (5) Transformation of recombinant plasmids pGL3-basic-RYR2-P1 and pGL3-basic-RYR2-P2

[0114] Add 10 μL of recombinant plasmids pGL3-basic-RYR2-P1 and pGL3-basic-RYR2-P2 to 100 μL of DH5α competent cells, place on ice for 30 min, heat shock at 42°C for 90 s, and then ice bath for 2 min. Add 500 μL of LB liquid medium without antibiotics and shake culture at 37°C for 30 min. Spread 200 μL evenly on LB solid medium plates containing ampicillin (100 mg / ml) and culture overnight at 37°C for 12-16 h.

[0115] (6) Positive clone screening and sequencing identification

[0116] Pick a single colony on the plate and streak it for colony PCR detection. The 20μL system is: 0.4μL of forward and reverse primers, 10μL of 2xTaq Mix, and 9.2μL of sterile water. The amplification conditions are: 94℃ pre-denaturation for 3min, 94℃ denaturation for 15s, 57℃ annealing for 30s, 72℃ extension for 60s / kb, 30 cycles, 72℃ termination extension for 2min, and 16℃ cooling for 5min. After 1% agarose gel electrophoresis, select positive single clones. The detailed information of the primers used is as follows:

[0117] Forward Primer:

[0118] P1-F: 5'CGGGGTACCGGCACCCAGCTATTGCTAGTTCT 3' (SEQ ID NO.19)

[0119] P2-F: 5'CGGGGTACCTGCCCTGGACCCTGCTG 3' (SEQ ID NO.20)

[0120] Reverse Primer:

[0121] LucNrev-R:5'CCTTATGCAGTTGCTCTCC 3'(SEQ ID NO.21)

[0122] Sequencing: The above positive monoclonal bacterial solution was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were spliced ​​and sequenced using SnapGene software. The results are as follows: Figure 3 , Figure 4 As shown, Figure 3 is the sequencing result analysis of pGL3-basic-RYR2-P1; Figure 3 A is the sequencing sequence of pGL3-basic-RYR2-P1; Figure 3 B is the sequencing peak diagram of pGL3-basic-RYR2-P1; Figure 4 is the sequencing result analysis of pGL3-basic-RYR2-P2; Figure 4 A is the sequencing sequence of pGL3-basic-RYR2-P2; Figure 4 B is the sequencing peak diagram of pGL3-basic-RYR2-P2.

[0123] (7) Extraction of recombinant plasmids pGL3-basic-RYR2-P1 and pGL3-basic-RYR2-P2

[0124] The recombinant plasmids pGL3-basic-RYR2-P1 and pGL3-basic-RYR2-P2 with correct sequencing results were extracted using the Omega Endo-free Plasmid Mini Kit II kit, and all operations were performed according to the kit instructions.

[0125] Example 4 Detection of activity of the promoter region of the porcine RYR2 gene

[0126] (1) Transient cell transfection

[0127] PK15 cells were inoculated into 24-well cell culture plates, with 3 replicates per group, and transfection was performed when the cell density reached about 70%. DNA / liposome complexes were prepared, and the liposomes were allowed to stand for 5 minutes. An equal volume of plasmid solution and liposome solution were mixed (as shown in Table 1), and the mixture was gently pipetted and mixed, and the mixture was allowed to stand for 20 minutes to form DNA / liposome complexes.

[0128] Table 1 Connection system of target sequence and pGL3-basic vector

[0129]

[0130] DNA / liposome complex was added dropwise to each well, shaken and cultured in a 37°C cell culture incubator for 6 h, then replaced with complete culture medium and continued to culture. Fluorescence intensity was detected after 48 h.

[0131] (2) Dual luciferase activity assay

[0132] According to the instructions of the Biyuntian Dual Luciferase Reporter Gene Assay Kit II (RG029S), the luciferase activity of the corresponding groups was detected. The relative luciferase activity value of each group was equal to the average value of the ratio of the firefly luciferase to the Renilla luciferase detection value of each independent experiment in each group. The activity of the control pGL3-basic was determined as 1. The relative luciferase activity results of different promoter truncations of the RYR2 gene are shown in Figure 5 As shown, the truncation P1 has the highest activity and is significantly higher than other truncation forms, indicating that -1bp to -715bp is the core promoter region.

[0133] Example 5 Verification of the SNP site of the pig RYR2 gene

[0134] (1) Design of mutation primers

[0135] According to the results of the previous population selection analysis, a SNP site (g.-399C>T) in the core promoter region of the RYR2 gene was selected for verification, and the specific primers were designed as follows:

[0136] RYR2-SNP(g.-399C>T)-F:

[0137] CCGATTTTCTATGTCAGTTTTGGGATGGTGTGA(SEQ ID NO.22)

[0138] RYR2-SNP(g.-399C>T)-R:

[0139] CTGACATAGAAAATCGGGTCAATAACAGAACT(SEQ ID NO.23)

[0140] (2) Amplification of target plasmid pGL3-basic-RYR2-P1 and product purification and recovery

[0141] 50μL PCR reaction system: KOD FOX Buffer 25μL, 2Mm dNTP 10μL, 1.5μL each of 10μM forward and reverse primers, 1ng recombinant plasmid pGL3-basic-RYR2-P1 DNA, 1μL KOD FOX, aseptically fill to 50μL.

[0142] The amplification conditions were as follows: pre-denaturation at 94°C for 3 min, denaturation at 98°C for 15 s, annealing at 57°C for 15 s, extension at 68°C for 60 s, 35 cycles, termination extension at 68°C for 5 min, and cooling at 16°C for 2 min.

[0143] The PCR products were identified by 1% agarose gel electrophoresis, and the RYR2 gene SNP site (g.-399C>T) was verified as follows Figure 6 As shown, Figure 6 A is the electrophoresis diagram of the reverse PCR product of the mutant fragment, and the fragment size is 5490bp; after verifying that the band is in the correct position, the Magen agarose gel DNA recovery kit is used for gel excision recovery and purification, and all operations are performed according to the kit instructions.

[0144] (3) Dpn I digestion of amplified product

[0145] Add 1 μL of Dpn I enzyme to the amplified product, gently pipette to mix, centrifuge briefly, and place at 37°C for 1-2 hours. Then perform 1% agarose gel electrophoresis and gel recovery, remove the plasmid template to obtain the PCR-generated product. For single-base mutations, the optimal amount of Dpn I digestion product = [0.02 × number of fragment base pairs] ng

[0146] (4) Homologous recombination

[0147] Reaction system: 50-400 ng of Dpn I digestion product, 4 μL of 5xCEⅡBuffer, 2 μL of ExnaseⅡ, add sterile water to 20 μL, gently pipette to mix, centrifuge briefly, incubate at 37℃ for 30 min, and then immediately cool on ice.

[0148] The recombinant plasmid pGL3-basic-RYR2-P1 was transformed, sequenced and extracted according to the same steps as in Example 3. The sequencing peak diagram of pGL3-basic-RYR2-SNP (g.-399C>T) is as follows Figure 6 As shown in B.

[0149] According to Example 4, the same steps were used to perform cell transient transfection and dual luciferase activity assay to determine the relative luciferase activity of the RYR2 SNP site (g.-399C>T) promoter expression vector (n=3, *P<0.05, **P<0.01). Figure 6 As shown in C, the activity of the control pGL3-basic was determined to be 1, and the mutation activity of the SNP site (g.-399C>T) was significantly increased and higher than that of the unmutated fragment, indicating that the SNP site (g.-399C>T) has an impact on the expression activity of the RYR2 gene and plays an important role in the pig's tolerance to hypoxia.

[0150] Therefore, the present invention obtains a SNP molecular marker related to pig hypoxia tolerance, g.-399C>T.

[0151] The contents not described in detail in this specification belong to the prior art known to professional and technical personnel in this field.

[0152] Finally, it should be noted that the above description is only a preferred example of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A SNP molecular marker related to pig hypoxia tolerance based on RYR2 gene, characterized in that: The SNP molecular marker is located at the 399th position of the nucleotide sequence of the core promoter region of the RYR2 gene, and the base is C or T; the nucleotide sequence of the core promoter region of the RYR2 gene is -1bp to -715bp of the sequence shown in SEQ ID NO.

15.

2. The SNP molecular marker based on the RYR2 gene and related to pig hypoxia tolerance according to claim 1, characterized in that: Under hypoxic conditions, T is the dominant allele.

3. The primer pair for amplifying the SNP molecular marker related to pig hypoxia tolerance based on the RYR2 gene according to claim 1, characterized in that: The forward sequence of the primer pair is shown in SEQ ID NO.22; The reverse sequence of the primer pair is shown as SEQ ID NO.

23.

4. A reagent or kit containing primers for the SNP molecular marker associated with pig hypoxia tolerance based on the RYR2 gene as described in claim 1.

5. Use of the SNP molecular marker related to pig hypoxia tolerance based on the RYR2 gene as described in any one of claims 1-4 in the assisted breeding of hypoxia-resistant pig breeds.

6. The SNP molecular marker related to pig hypoxia tolerance based on RYR2 gene according to claim 1, characterized in that: The core promoter region of the porcine RYR2 gene was detected, and the porcine RYR2 gene promoter truncations P1 and P2 were constructed to further construct recombinant plasmids pGL3-basic-RYR2-P1 and pGL3-basic-RYR2-P2. The relative luciferase activities of the recombinant plasmids pGL3-basic-RYR2-P1 and pGL3-basic-RYR2-P2 were then determined using dual luciferase activity.

7. The SNP molecular marker based on the RYR2 gene and associated with pig hypoxia tolerance according to claim 6, characterized in that: The forward sequences of the primer pairs for amplifying the pig RYR2 gene promoter truncation P1 and P2 are shown in SEQ ID NO.16 and SEQ ID NO.17, and the reverse sequence is shown in SEQ ID NO.

18.

8. A method for breeding hypoxia-tolerant pig breeds based on the SNP molecular markers of claim 1, characterized in that: The SNP molecular marker at position 399 in the core promoter region of the RYR2 gene is detected, and individuals with allele T at this site are selected for breeding.

9. A method for identifying the SNP molecular markers associated with pig hypoxia tolerance based on the RYR2 gene according to claim 1, characterized in that: The steps include: 1) Establish a hypoxia model for the proliferation of porcine skeletal muscle satellite cells; 2) Analyzing the expression of RYR2 gene in the hypoxia model of pig skeletal muscle satellite cells by using transcriptome data of different tissues at high and low altitudes in Tibetan pigs; 3) qRT-PCR detection of RYR2 gene expression in proliferating satellite cells of hypoxic pig skeletal muscle; 4) construct porcine RYR2 gene promoter truncations P1 and P2, and then construct recombinant plasmids pGL3-basic-RYR2-P1 and pGL3-basic-RYR2-P2; 5) Detect the activity of the promoter region of the porcine RYR2 gene; 6) Transient cell transfection and dual luciferase activity assay to identify the mutation activity of the SNP site (g.-399C>T).

Images