Rice pollen fertility regulation gene OsSNDP4 and application thereof

Abstract

The invention belongs to the field of plant genetic engineering, and particularly relates to a gene OsSNDP4 for regulating and controlling the fertility of rice pollen and application thereof, and the nucleotide sequence of the gene OsSNDP4 for regulating and controlling the fertility of rice pollen and the amino acid sequence coded by the gene OsSNDP4 are respectively shown as SEQ ID NO: 1 and SEQ ID NO: 2. The OsSNDP4 gene is knocked out through gene editing, so that the development of the tapetum of the rice is blocked, pollen abortion is caused, and the obtained new rice male sterile line can be used for producing hybrid rice seeds; the invention also relates to a creation method of the rice male sterility line and a recovery method of the rice male sterility character. The obtained rice male sterility mutant is normal in vegetative growth, male sterility in the reproductive growth stage and normal in female fertility, if the rice male sterility mutant is applied to hybrid rice seed production, the work of female parent castration can be omitted, the production efficiency is greatly improved, and the labor cost is reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of plant genetic engineering and rice breeding, and specifically relates to a gene OsSNDP4 for regulating rice pollen fertility and an application thereof in the creation of male sterile lines. Background Art

[0002] Rice is one of the most important food crops in the world, and about 50% of the world's population relies on rice as their staple food. As an important achievement of my country's modern agriculture, hybrid rice technology has made an important contribution to my country's food security. From the "three-line method" to the "two-line method", my country's hybrid rice technology has always been at the international leading level. The breakthrough in the hybrid rice production model is due to the discovery, research and use of rice male sterility genetic materials by Chinese agricultural scientists.

[0003] Rice male sterility can be divided into nuclear-cytoplasmic interaction sterility type and nuclear sterility type according to genetic characteristics. The "three-line method" takes nuclear-cytoplasmic interaction male sterility as its technical core, and consists of male sterile lines, maintainer lines and restorer lines. The three-line sterile line is usually caused by mitochondrial gene mutations. The maintainer line has the same nuclear genetic components as the sterile line, but the mitochondrial genes are normal. The sterile line seeds can be propagated by pollinating the maintainer line. The restorer line contains a specific restorer gene that can inhibit the function of mitochondrial mutant genes, so that the hybrid seeds produced by hybridization with the sterile line can restore fertility. The "two-line method" takes light-temperature sensitive nuclear sterility as its technical core. The two-line sterile line can restore fertility to reproduce sterile line seeds under specific light and temperature conditions, and can be hybridized with the male parent under sterile conditions to prepare hybrids. The three-line method is restricted by the restoration and protection relationship, and the two-line method is affected by environmental conditions. In practical applications, both are limited by their inherent defects.

[0004] Another type of environmentally insensitive nuclear sterility is widely present in plants. Its sterility is stable, its combination is free, it is not affected by micro-effect genes, and its breeding procedure is simple. It can make up for the defects of the three-line method and the two-line method. However, it has long been unable to be applied in production due to the lack of effective sterile line breeding technology. In recent years, the third-generation hybrid rice technology based on environmentally insensitive nuclear sterility has been successfully established using modern molecular biological methods. That is, pollen fertility restoration genes, pollen inactivation genes and seed fluorescent marker genes are connected in series and introduced into male sterile mutants through genetic transformation to obtain a maintainer line containing a single transgenic insertion. 50% of the pollen produced by the maintainer line contains sterile genes but no transgenic elements, and the other 50% contains both sterile genes and transgenic elements. Under the action of the pollen inactivation gene, the pollen containing transgenic elements cannot develop normally, and only the pollen without transgenic elements can develop and fertilize normally. Therefore, the maintainer line self-pollination produces half sterile line seeds without transgenic elements and half maintainer line seeds carrying transgenic elements. Since the transgenic element contains a fluorescent marker gene, the non-fluorescent sterile seeds and the red fluorescent maintainer seeds can be quickly separated by fluorescence sorting technology. A large number of sterile seeds can be reproduced by pollinating the sterile line with the maintainer line; and the sterile line can be hybridized with any rice material to produce hybrid seeds. The third-generation hybrid rice technology effectively solves the problem of large-scale reproduction of environmentally insensitive nuclear sterile lines, making it possible to utilize a large number of rice recessive nuclear sterile genes. The male sterile line involved in the present invention is an environmentally insensitive nuclear male sterile line.

[0005] Sec14 protein is a type of phosphatidylinositol / phosphatidylcholine transfer protein first discovered in Saccharomyces cerevisiae. It can bind and exchange a phosphatidylinositol or phosphatidylcholine molecule and promote the transfer of these phospholipids between different membrane compartments of eukaryotic cells. Sec14 protein and its homologous genes are widely present in eukaryotic cells. Plant Sec14 proteins can be divided into three categories according to their structural characteristics: one contains only the Sec14 domain; one contains a plant-specific Nodulin domain in addition to the Sec14 domain; and the other contains the Sec14 and GOLD double domains. There are 27 members of the Sec14 protein family in the rice genome, of which 10 are Sec14-nodulin proteins, named OsSNDP1 to OsSNDP10, respectively. The protein involved in the present invention is OsSNDP4. Studies have found that Sec14-nodulin protein can act as a cell polarity regulator and play an important role in plant morphogenesis. The gene encoding the rice OsSNDP1 protein has a high sequence homology with the gene encoding the Arabidopsis AtSFH1. It is mainly highly expressed in root hairs, and both play an important role in the tip growth of root hairs. The rice gene OsSNDP3 is highly expressed specifically in mature anthers. The expressed protein regulates the polar growth of pollen tubes by binding to phosphatidylinositol-4,5-bisphosphate. During the anther development stage, the expression of OsSNDP2 is similar to that of OsSNDP3. There is a protein-protein interaction between the two. OsSNDP2 works synergistically with OsSNDP3 during pollen tube germination. The Arabidopsis genes AtSFH3 and AtSFH12 are mainly expressed in flowers, and are speculated to also play a role in male gamete development and fertilization. Arabidopsis AtSFH5 and AtSFH7 specifically recognize and transport phosphatidic acid, transport it from the endoplasmic reticulum to the chloroplast for glycolipid synthesis, and regulate the formation of the thalli structure in the chloroplast. In addition, the functions of most Sec14-nodulin proteins have not been reported so far. Summary of the invention

[0006] One object of the present invention is to provide a gene OsSNDP4 for regulating rice pollen fertility and its encoded protein.

[0007] Another object of the present invention is to provide a male sterile mutant breeding material for hybrid rice seed production, which is used to cultivate new male sterile lines and serve as female parents for hybrid rice production.

[0008] The present invention provides a male sterile rice mutant named ms16600, the male sterility of which is caused by pollen abortion due to abnormal tapetum development. Genetic analysis shows that the mutation is a recessive mutation controlled by a single gene. The inventors determined the mutant gene through a mutant gene localization method SIMM based on genome sequencing, which is the 27th nucleotide base on the ninth exon of the OsSNDP4 gene (the cDNA sequence of the gene is shown in SEQ ID NO: 6, and the genomic DNA sequence is shown in SEQ ID NO: 1) mutated from T to A, that is, the 1053rd base of the cDNA mutated from wild-type thymine (T) to adenine (A), so that the 351st cysteine ​​(Cys) of the protein mutated to a stop codon (TGA), and the translation of the original full-length 624aa (shown in SEQ ID NO: 2) protein was terminated prematurely at 351aa (shown in SEQ ID NO: 3).

[0009] The present invention provides a method for creating a rice male sterile line, that is, using gene editing technologies such as TALEN and CRISPR to knock out the OsSNDP4 gene, thereby obtaining a new rice male sterile line.

[0010] The present invention provides a method for restoring the male sterility trait of a rice male sterile line, comprising the following steps: using conventional genetic means to transfer the OsSNDP4 gene and its promoter region into the rice male sterile line obtained by the above application, thereby restoring the sterile mutant to a wild-type phenotype.

[0011] The rice male sterility gene OsSNDP4 provided by the present invention has the following advantages:

[0012] 1. The gene provided by the present invention affects the pollen development of plants. By controlling the gene and the protein encoded by it, a rice male reproductive development mutant strain is obtained, thereby controlling the rice seed setting rate;

[0013] 2. The rice male sterile mutant of the present invention has normal vegetative growth, male sterility in the reproductive growth stage, and normal female fertility, and can be cultivated into a male sterile plant line, which has important applications in hybrid rice production;

[0014] 3. The rice male sterile mutant of the present invention has normal vegetative growth, is male sterile in the reproductive growth stage, and has normal female fertility. It can be cultivated into a male sterile strain and has important applications in hybrid rice production. The gene described in the present invention and the protein encoded by it can be applied to plant genetic improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1Schematic diagram of the plant phenotype, anther morphology and pollen potassium iodide staining of the wild-type Huanghuazhan (HHZ), the EMS-induced mutant of the OsSNDP4 gene (ms16600), the gene knockout mutant (Cr-1) and the genome complementation-positive plant (Com-1). The scale bars of the plant phenotype comparison figures A, D, G and J are 20 cm, the scale bars of the anther morphology comparison figures B, E, H and K are 1 mm, and the scale bars of the pollen potassium iodide staining comparison figures C, F, I and L are 200 μm.

[0016] Figure 2 Schematic diagram of SIMM positioning, mutation site and complementary fragment of OsSNDP4 gene.

[0017] Figure 3 Schematic diagram of the semi-thin cross-section of the anther of Huang Huazhan and the ms16600 mutant, where DMsp represents aborted microspores, Dys represents dyads, E represents epidermis, En represents endodermis, M represents middle layer, MP represents mature pollen grains, Msp represents microspores, MMC represents microspore mother cells, T represents tapetum, and Tds represents tetrads. The scale bar is 20 μm. DETAILED DESCRIPTION

[0018] The present invention is further described below in conjunction with specific embodiments for better understanding, but the scope of the present invention is not limited thereby.

[0019] Example 1: Obtaining a Rice Male Sterility Mutant

[0020] A ms16600 mutant was screened from the EMS mutant library of Huang Huazhan (HHZ). Its plant growth, heading and heading were normal, but the ears were necked, and the fruiting rate was greatly reduced or even completely non-fruiting. Further analysis of the flower organ morphology revealed that the mutant spikelets had whitish anthers and pollen aborted ( Figure 1 A–F). When the ms16600 mutant was used as the female parent and pollinated with wild-type HHZ pollen, the fruit set rate was close to 90%, indicating that the female fertility of the mutant was normal and the reason for the decrease in fruit set rate was that the pollen development was blocked.

[0021] Example 2: Cloning and verification of OsSNDP4 gene

[0022] In order to clone the mutant gene, the ms16600 mutant was first backcrossed with the wild-type HHZ as the female parent. The fertility of the resulting BC1F1 generation plants was normal, and the segregation ratio of fertile plants to sterile plants in the BC1F2 segregation population was 3:1, indicating that the phenotype of ms16600 was caused by a recessive mutation of a single nuclear gene.

[0023] Thirty typical sterile plants were selected from the BC1F2 segregation population, and leaf genomic DNA was extracted. After equal amounts were mixed and a library was constructed, resequencing was performed using Illumina Hiseq 2000 with a sequencing depth of 30×. According to the SIMM technical process, the adapter sequences and low-quality or low-coverage sequences were first filtered out, and the high-quality sequences were compared with the Nipponbare reference genome and other Huanghuazhan mutant resequencing data to calculate the SNP index and Euclidean distance (ED 6 ), thus obtaining the relatively specific SNP site of the ms16600 mutant located at the front end of chromosome 2 ( Figure 2 A). The 27th nucleotide base on the ninth exon of the OsSNDP4 gene in the candidate segment (the cDNA sequence of the gene is shown in SEQ ID NO: 6, and the genomic DNA sequence is shown in SEQ ID NO: 1) mutated from T to A, that is, the 1053rd base of the cDNA mutated from the wild-type thymine (T) to adenine (A) (shown in SEQ ID NO: 4), so that the 351st cysteine ​​(Cys) of the encoded protein (shown in SEQ ID NO: 2) mutated to a stop codon (TGA), and the translation of the original full-length 624aa protein was terminated prematurely at 351aa (shown in SEQ ID NO: 3).

[0024] Molecular markers were designed for this mutation, and SNP typing was performed by high-resolution melting curve (HRM) to analyze the linkage relationship between the genotype and phenotype of 1878 individuals in the BC1F2 segregation population. The results showed that the genotype of fertile plants in the segregation population was wild-type T / T or heterozygous T / A, while the sterile plants were all homozygous A / A, indicating that the sterile phenotype of ms16600 was completely linked to the premature termination mutation of the OsSNDP4 gene.

[0025] The molecular marker primer sequences of the mutation sites are as follows:

[0026] ms16600-HRM-F: ATAGTCCTTAGTGGCGAGGCT (SEQ ID NO: 7)

[0027] ms16600-HRM-R:TTATGCCAAGTCCAAGCACCA (shown in SEQ ID NO: 8)

[0028] Example 3: Analysis of anther development defects in ossndp4 mutants

[0029] In order to study the cause of pollen abortion in the ossndp4 mutant, the anthers of the wild-type HHZ and the ms16600 mutant were taken for histological analysis at the middle and late stages of development. The semi-thin section results showed that no obvious abnormalities were found in the anther development of the ms16600 mutant until stage 8b of tetrad formation ( Figure 3 A–D). At stage 9, the tapetum cells of the wild type become significantly thinner, the vacuoles disappear, the cytoplasm is significantly concentrated, and the callose in the anther cavity is degraded, the microspores are freed, and they are loosely arranged in a circle along the tapetum. At this time, the tapetum of the ms16600 mutant also becomes thinner, but the vacuoles still exist, and the cytoplasm is looser than that of the wild type; the microspores are also released from the callose wrapping, but the microspores are scattered in the anther cavity, not close to the inner wall of the anther ( Figure 3 E and F). At stage 10, the tapetum cells of the wild type disintegrated violently, forming a hill-like protrusion inward. The spherical microspores were closely arranged along the tapetum, and their volume was significantly larger than that of stage 9. There was a large vacuole in the center, and the cytoplasm and nucleus moved to the edge of the cell. At the same time, the outer wall of the microspores was significantly thickened. The tapetum of the mutant also became a hill-like shape, but the vacuole did not completely disappear; the microspores seemed to be excessively enlarged in size, accumulated in the anther cavity, squeezed each other, resulting in an irregular shape, and the outer wall did not show obvious thickening ( Figure 3 G and H). At stage 11, the middle layer of the wild type completely disappeared, and the tapetum was almost completely disintegrated; the microspores became hook-shaped and underwent mitosis. At this time, the anther wall of ms16600 began to collapse, the microspores were reduced in size, and the shape was still irregular ( Figure 3 I and J). At stage 12, the wild-type anther wall only had a complete epidermis, and a large number of starch grains were visible in the microspores, becoming mature pollen grains. However, the anther wall of ms16600 collapsed, there were no normal pollen grains in the cavity, and the microspores were severely shrunken ( Figure 3 K and L). In summary, the development of the tapetum is blocked in the ms16600 mutant, resulting in pollen abortion.

[0030] Example 4: Gene knockout to create ossndp4 allele mutant

[0031] On the CRISPR-GE website (http: / / skl.scau.edu.cn / ), four specific CRISPR knockout target sites were designed for the OsSNDP4 gene (the 3' end 3 bases are PAM sequences), the sequences are as follows:

[0032] CR-OsSNDP4-5: GGCATCTCGATCGCCTCGCGCGG (located in the first exon);

[0033] CR-OsSNDP4-6: GAAGAGGAGGAGCGGCAGTCGGG (located in the second exon);

[0034] CR-OsSNDP4-1: ATATGTAAGATACCATGTGAAGG (located in the 4th exon);

[0035] CR-OsSNDP4-3:GAATTGCCGGAATTCCTTGGTGG (located in the 8th exon).

[0036] The gene knockout vector was constructed using the pYLCRISPR / Cas9-MH vector provided by Professor Liu Yaoguang's research group at South China Agricultural University. The specific construction steps were carried out according to the supporting operation guide provided by the research group. First, the adapter primers of the four targets were synthesized, and the target adapters were annealed separately. The target adapters were connected to the gRNA expression cassette by the BsaⅠ endonuclease and T4 DNA ligase cutting and ligating method, and then the gRNA expression cassettes of the four targets were obtained by two rounds of PCR amplification. After gel recovery, the four gRNA expression cassettes were connected to the pYLCRISPR / Cas9-MH plasmid by the cutting and ligating method, and transformed into the competent Escherichia coli DH5α. After positive detection and sequencing identification, the knockout vector was named CR-OsSNDP4-5613. Subsequently, the CR-OsSNDP4-5613 plasmid was transferred into Agrobacterium, and the callus tissue of the wild-type Huang Huazhan was infected by the Agrobacterium-mediated method. After obtaining the T0 generation plants, the sequence variation of the segment where the OsSNDP4 gene target site is located was identified by sequencing.

[0037] In the knockout plants obtained, Cr-1 inserted A in exon 1, GCA was missing in exon 2, there was no mutation in exon 4, and CT was missing in exon 8, resulting in premature termination of the protein encoded by the OsSNDP4 gene ( Figure 2 B). Since the tissue culture process often affects the fertility of T0 generation plants, in order to more accurately determine the fertility of OsSNDP4 gene knockout plants, the T0 generation plants of Cr-1 were used as the mother parent to pollinate the wild type HHZ pollen, and homozygous knockout plants and heterozygous knockout plants were obtained from the offspring segregation population. The results showed that the heterozygous knockout plants had normal fruiting, while the phenotype of the homozygous knockout plants was similar to that of the ms16600 mutant, both of which showed thin and white anthers and pollen abortion ( Figure 1 G–I), indicating that OsSNDP4 gene knockout can lead to male sterility in rice.

[0038] Example 5: Genome complementation to restore ossndp4 mutation virility

[0039] In order to construct the complementary vector of OsSNDP4 gene, the genomic DNA of wild type Huang Huazhan was used as template, 1300-SNDP4-F: CCATGATTACGAATTCCCCGCCCACCAGCAGTTGCACAGTA (shown in SEQ ID NO: 9) and 1300-SNDP4-R: GGCCAGTGCCAAGCTTCTTATTATATAGGCTTGATTACGTT (shown in SEQ ID NO: 10) were used as primers, and high-fidelity DNA polymerase KOD-FX neo was used to amplify a genomic fragment of 8361 bp including 3121 bp upstream of the start codon of OsSNDP4 gene, the OsSNDP4 gene region and 896 bp downstream of the stop codon (shown in SEQ ID NO: 5, Figure 2 B). Primer 1300-SNDP4-F contains the homology arm of the EcoRⅠ restriction site of the pCAMBIA1300 vector, and primer 1300-SNDP4-R contains the homology arm of the HindⅢ restriction site. At the same time, the pCAMBIA1300 vector was digested into linearized DNA molecules with restriction endonucleases EcoRⅠ and HindⅢ, and the amplified complementary fragment products and vector digestion products were subjected to gel electrophoresis and recovered and purified. Finally, the above 8361bp OsSNDP4 genome complementary fragment was cloned into the pCAMBIA1300 vector backbone by In-fusion HD Cloning. The recombinant plasmid was transformed into Escherichia coli competent DH5α. After positive detection and sequencing identification, the obtained genome complementary vector was named pCAMBIA1300-OsSNDP4. Subsequently, the plasmid was transferred into Agrobacterium, and the callus tissue induced by seeds of ossndp4 mutant heterozygous strains was infected by Agrobacterium-mediated method. From the transgenic positive plants obtained, plants with homozygous mutations in the genomic background of ossndp4 were screened and the fertility of the plants was investigated. The results showed that the potassium iodide staining of pollen and the fruiting of the complementary positive plants Com-1 with homozygous mutation background returned to normal, which was no different from the wild type ( Figure 1 J–L), indicating that the 8361 bp OsSNDP4 genomic complementation fragment can restore the male sterility phenotype of the ossndp4 mutant.

Claims

1. A mutant protein OsSNDP4 causing rice male sterility phenotype, characterized in that: Compared with the wild-type protein, the cysteine ​​at position 351 of this protein is mutated to a stop codon.

2. The method of claim 1, wherein the amino acid sequence of the mutant protein OsSNDP4 is shown in SEQ ID NO: 3, and the amino acid sequence of the wild-type protein is shown in SEQ ID NO:

2.

3. The method of claim 1, wherein the nucleotide sequence of the gene encoding the mutant protein OsSNDP4 is shown in SEQ ID NO:

4.

4. A method for causing abnormal pollen development in rice or male sterility in rice, characterized in that: Using genetic engineering to influence wild-type rice OsSNDP4 The expression of the gene, wherein the wild-type OsSNDP4 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

5. A rice gene OsSNDP4 A method for restoring rice male fertility or reduced fruiting rate caused by mutation, characterized in that: Wild-type OsSNDP4 The gene and its promoter region were integrated into OsSNDP4 On the mutant chromosome, OsSNDP4 The nucleotide sequence of the mutant is shown in SEQ ID NO: 4, and the wild type OsSNDP4 The gene and its promoter region are shown in SEQ ID NO: 5.

Images