Acinetobacter pekinensis LGC1-1 and its application in preventing and controlling pepper vein mottle virus
By using Acinetobacter pekinensis LGC1-1 as a natural antagonistic strain, the problem of prevention and control of pepper vein mottle virus was solved, and efficient virus inhibition effect was achieved, while reducing the use of chemical pesticides and environmental pollution.
Patent Information
- Application Number
- CN202411792922.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-04
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2044-12-04
AI Technical Summary
The existing technology lacks effective agents to control the infection of pepper vein mottle virus, and the use of chemical pesticides pollutes the environment and affects biodiversity.
Acinetobacter pekinensis LGC1-1 was used as a natural antagonistic strain, which was prepared and applied to the prevention and control of pepper vein mottle virus through purification culture and 16S rDNA sequence identification, and its high inhibitory effect was used to reduce the use of chemical pesticides.
The inhibition rate of Acinetobacter pekinensis LGC1-1 on pepper vein mottle virus is as high as 85.9%, which is much higher than the conventional agent Ningnanmycin. It is also pollution-free to the environment and protects biodiversity.
Smart Images

Figure CN119506166B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of biological control, and in particular to Acinetobacter pekinensis LGC1-1 and application thereof in preventing and controlling pepper vein mottle virus. Background Art
[0002] Chili vein mottle virus (ChiVMV), a member of the Potyvirus genus of the Potyviridae family, is a major virus that affects Solanaceae crops and severely harms their production. While ChiVMV primarily harms peppers, it was first reported in China in 2011 to also harm tobacco production. ChiVMV-infected tobacco plants experience punctate necrosis of leaves, perforation, and localized necrosis before harvest, severely impacting the quality of the cured leaves. In more severe cases, leaves may become deformed, and stems may become systemically necrotic, ultimately leading to plant death.
[0003] Viruses are obligate intracellular parasites. Once infected, tobacco plants lack effective pesticides to completely control them. Therefore, screening for natural microbial antagonists to combat crop viral diseases aligns with national efforts to develop green pest control strategies and reduce soil and environmental pollution from chemical pesticides. Summary of the Invention
[0004] The present invention provides an Acinetobacter pirimi LGC1-1 and its application in preventing and controlling pepper vein mottle virus in order to screen natural microbial antagonists for preventing and controlling pepper vein mottle virus and reduce the pollution of chemical pesticides to soil and the environment.
[0005] The present invention achieves the above-mentioned purpose through the following technical solutions:
[0006] The present invention provides an Acinetobacter pekinensis LGC1-1, Acinetobacter sp.LGC1-1. The living pure culture of the Acinetobacter pekinensis LGC1-1 (Acinetobacter sp, named Acinetobacter pekinensis LGC1-1 / Acinetobacter sp.LGC1-1) has been registered and preserved in the China Center for Type Culture Collection, the preservation time is November 13, 2024, the preservation address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, on the campus of Wuhan University, and the preservation number is CCTCC NO: M20242552.
[0007] The Acinetobacter pekinensis LGC1-1 produces milky white, round colonies with neat edges, a smooth surface, and opaque protrusions. Gram staining confirmed that the bacterium is a Gram-negative bacterium. During purification, the culture was performed using a spread plate method on NA medium (3.0 g / L beef extract, 10.0 g / L sucrose, 5.0 g / L peptone, 1.0 g / L yeast extract, 15.0 g / L agar, pH = 7.1) and cultured at 28°C for 24 hours.
[0008] The 16S rDNA sequence of the Acinetobacter pekinensis LGC1-1 is shown in SEQ ID NO.1.
[0009] The amplification primers for the 16S rDNA sequence of the Acinetobacter pekinensis LGC1-1 are:
[0010] SEQ ID NO.2: F-P0: GAGAGTTTGATCCTGGCTCAG;
[0011] SEQ ID NO. 3: R-P6: CTACGGCTACCTTGTTACGA.
[0012] The present invention also provides an application of Acinetobacter sp. LGC1-1 in preventing and treating pepper vein mottle virus. The Acinetobacter sp. LGC1-1 is used as an antagonistic strain to inhibit the infection of pepper vein mottle virus ChiVMV.
[0013] The beneficial effects of the present invention are as follows: the inhibition rate of the Acinetobacter pekinensis LGC1-1 on the pepper vein mottle virus ChiVMV is as high as 85.9%, while the inhibition rate of the conventional agent Ningnanmycin on the pepper vein mottle virus ChiVMV is only 48.6%, indicating that the passivation effect of Acinetobacter pekinensis LGC1-1 on the pepper vein mottle virus ChiVMV is outstanding, which is much higher than the prevention effect of the conventional agent Ningnanmycin, and the Acinetobacter pekinensis LGC1-1 is a natural virus-linked antibacterial that is screened out and has no pollution to the environment and will not destroy biodiversity. BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figure 1 This is a colony morphology diagram of Acinetobacter pilosellae LGC1-1 of the present invention;
[0015] Figure 2 This is a comparison chart (tobacco leaves) of the inactivation effects of the Acinetobacter pilosellae LGC1-1 of the present invention and the conventional antiviral agent Ningnanmycin on pepper vein mottle virus (ChiVMV). DETAILED DESCRIPTION
[0016] The present application will be described in further detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.
[0017] 1. Materials
[0018] 1. Acinetobacter piemannii LGC1-1 (Acinetobacter sp, named Acinetobacter piemannii LGC1-1 / Acinetoba cter sp.LGC1-1). The live pure culture of Acinetobacter piemannii LGC1-1 has been registered and preserved in the China Center for Type Culture Collection on November 13, 2024. The preservation address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the preservation number is CCTCC NO: M 20242552.
[0019] Unless otherwise specified, the methods used in this example are conventional methods known to those skilled in the art, and the reagents and other materials used are commercially available products unless otherwise specified.
[0020] 2. Methods
[0021] 2.1 Preparation of Acinetobacter pekinensis LGC1-1:
[0022] 1. Sampling: In tobacco fields where mosaic disease has occurred, select healthy tobacco plants and collect soil from the rhizosphere at a depth of 20 cm from the roots of the tobacco plants for later use;
[0023] 2. Grinding: Place 10g of the reserved soil in a sterilized Erlenmeyer flask, add 20ml of sterile water, shake until the liquid becomes turbid, let it stand at room temperature for 10 minutes, and set aside;
[0024] 3. Purification: 200 μL of the supernatant liquid after standing was sucked up with a sterile pipette tip, and the plate method was used on NA medium (3.0 g / L beef extract, 10.0 g / L sucrose, 5.0 g / L peptone, 1.0 g / L yeast extract, 15.0 g / L agar, pH = 7.1). The culture was carried out at 28°C for 24 h. After the colonies grew on the separation plate, the isolated single colonies were picked out one by one with an inoculating loop according to the characteristics of the microbial colonies such as morphology, size, surface structure, edge structure, texture, gloss, transparency, color and soluble pigment produced. The single colonies with different morphologies were picked out and streaked on the corresponding blank NA medium plates for purification, and then incubated inverted in a constant temperature incubator at 28°C for 24 h to obtain the purified strains for later use;
[0025] like Figure 1As shown, Acinetobacter pekinensis LGC1-1 has milky white circular colonies with neat edges, smooth surface, and opaque convexities. Gram staining confirmed that the bacterium is a Gram-negative bacterium. Pathogenic bacterial DNA was extracted using the Wizard genomic DNA purification kit (Promega, Madison, WI).
[0026] The primers for amplification of 16S rDNA sequences are:
[0027] SEQ ID NO.2: F-P0: GAGAGTTTGATCCTGGCTCAG;
[0028] SEQ ID NO. 3: R-P6: CTACGGCTACCTTGTTACGA.
[0029] PCR amplification was performed using the above primers. The PCR amplification reaction system was 50 μL (10× PCR buffer 5 μL, dNTP 1 μL, P0 2 μL, P6 2 μL, Tag enzyme 1 μL, template DNA 2 μL, dd H2O 37 μL).
[0030] PCR amplification conditions were: 94°C for 5 minutes, 30 cycles of 94°C for 30 seconds, 55°C for 1 minute, and 72°C for 90 seconds, followed by 72°C for 1 minute and 10°C for 20 minutes. The 16S rDNA gene sequencing results of the strain were compared with BLAST software on the NCBI website, and the biocontrol bacterium was preliminarily identified as Acinetobacter sp.
[0031] 4. Screening: Select a single bacterial colony and place it in a sterilized 100 ml conical flask containing 20 ml of culture medium. Culture it with shaking (28°C, 200 r / min) for 24 hours to ensure that the bacterial liquid content is large enough to be used as a fermentation strain.
[0032] 2.2 Infection inhibition test of pepper vein mottle virus ChiVMV:
[0033] Nicotiana tabacum var. samsun NN has an allergic necrosis reaction to the pepper vein mottle virus ChiVMV. This experiment used the half-leaf method to determine the inhibition rate of ChiVMV infection by Acinetobacter pylori LGC1-1. Specifically, the young leaves of the fully diseased ChiVMV virus source were ground and filtered with distilled water at a ratio of 1:10 (mass to volume) and used as virus test samples. The virus test sample was mixed with an equal volume of liquid NA culture medium, and after 30 minutes, it was rubbed on the left half of the Nicotiana tabacum leaf (seen from the front of the leaf, the same below) as a control. The LGC1-1 to be tested was mixed with an equal volume of the virus sample, and after 30 minutes, it was rubbed and inoculated on the right half of the Nicotiana tabacum leaf as a treatment. In the same way, the treatment and control of Ningnanmycin (purchased from Chengdu Jiaye Biotechnology Co., Ltd.) were set.
[0034] After necrotic spots appear, record the number of necrotic spots on the left and right halves of the leaf. Repeat three times, with three leaves per tobacco plant inoculated. The number of necrotic spots on the left and right halves of the leaf and the inhibition rate are shown in the following table:
[0035]
[0036] The inhibition rate was calculated as follows: inhibition rate (%) = [(number of control necrosis spots - number of treated necrosis spots) / number of control necrosis spots] × 100%, and the average inhibition rate was used for evaluation.
[0037] The data in the table show that Acinetobacter pilosellae LGC1-1 has a significantly better antagonistic effect on ChiVMV. The results of three repeated tests showed that the inhibition rate of LGC1-1 fermentation broth on ChiVMV was as high as 85.9%, while the inhibition rate of conventional Ningnanmycin on pepper vein mottle virus ChiVMV was only 48.6%. The specific control effect is shown in Figure 2 .
[0038] The above-described embodiments merely illustrate several implementations of the present invention. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, and all such variations and improvements fall within the scope of protection of the present invention.
Claims
1. A Acinetobacter pilosellae LGC1-1, Acinetobacter sp.LGC1-1 , characterized in that, The Acinetobacter pilomii LGC1-1 was deposited in the China Center for Type Culture Collection on November 13, 2024, with the deposit number CCTCC NO: M20242552.
2. A use of Acinetobacter pilosellae LGC1-1 as claimed in claim 1 in preventing and treating pepper vein mottle virus, characterized in that: The Acinetobacter piezocera LGC1-1 is used as an antagonistic strain to treat pepper vein mottle virus ChiVMV Inhibition of infection.
Citation Information
Patent Citations
Application of enterobacter adamsii AV1 in prevention and treatment of tobacco pepper vein mottle virus
CN117126770A
Specific primer set for detecting ChiVMV and uses thereof
KR102279787B1