Mutant protein of lycopene cyclase and preparation method and application thereof
By performing site-directed amino acid mutations on the lycopene cyclase functional domain of CarRP and constructing a recombinant strain to express the mutant protein, the problem of low carotenoid production efficiency was solved, and efficient carotenoid production and wide application were achieved.
Patent Information
- Application Number
- CN202411786889.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-06
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2044-12-06
AI Technical Summary
The production efficiency of carotenoids in existing technologies is low and cannot meet the needs of industrial production.
By performing site-directed saturation mutagenesis on the lycopene cyclase functional domain of CarRP, a mutant protein that can significantly improve the synthesis efficiency of canthaxanthin and β-carotene was screened, and a recombinant strain was constructed to express the mutant protein.
It significantly improves the yield and production efficiency of carotenoids, reduces production costs, and promotes the widespread application of carotenoids in various fields.
Smart Images

Figure BDA0005174271910000071 
Figure BDA0005174271910000072 
Figure BDA0005174271910000081
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology and relates to a lycopene cyclase mutant protein and a preparation method and application thereof. Background Art
[0002] Carotenoids are a class of natural pigments found throughout nature, possessing important biological functions and a wide range of applications. These pigments not only impart vibrant color to plants, algae, and some microorganisms, but also play a vital role in photosynthesis and offer numerous health benefits, including antioxidant and immune-enhancing properties. Consequently, carotenoids are in widespread demand across industries, including food, medicine, and cosmetics.
[0003] The MVA pathway is one of the pathways for the synthesis of isopentenyl pyrophosphate (IPP) and dimethylallylpyrophosphate (DMAPP). In the MVA pathway, acetyl-CoA is converted to IPP through the catalytic actions of acetyl-CoA acetyltransferase (AtoB), 3-hydroxy-3-methylglutaryl CoA synthase (ERG13), 3-hydroxy-3-methylglutaryl CoA reductase (HMG1), mevalonate kinase (ERG12), phosphomevalonate kinase (ERG8), and mevalonatediphosphate decarboxylase (MVD1). Isopentenyl diphosphate isomerase (IDI) catalyzes the conversion of IPP to its isomer DMAPP. ERG20 and GGS are isomeric enzymes belonging to the FPP / GGPP synthase family. These bifunctional enzymes possess both dimethylallyltransferase and geranyltransferase activities, initially catalyzing the conversion of DMAPP and IPP to GPP (geranylpyrophosphate), and subsequently to FPP (farnesyl diphosphate). Geranylgeranyl pyrophosphate synthase (GGPP synthase, GGPPS) catalyzes the condensation of FPP and IPP to form GGPP (geranylgeranylpyrophosphate).
[0004] CarRP, which is also known as bifunctional phytoene cyclase / phytoene synthase, is a bifunctional enzyme that contains two functional domains, CarRP-R (with phytoene cyclase activity) at the N-terminus and CarRP-P (with phytoene synthase activity) at the C-terminus. CarRP-P is responsible for the synthesis of phytoene from two molecules of GGPP. Phytoene is converted into lycopene by phytoene desaturase (carB). Lycopene is cyclized by CarRP-R to form γ-carotene and β-carotene. β-carotene is converted into astaxanthin, zeaxanthin and lutein by β-carotene ketolase (CrtW) and β-carotene hydroxylase (CrtZ). CarRP plays a crucial role in carotenoid synthesis. However, the current production efficiency of natural carotenoids is low, which is difficult to meet the needs of industrial production.
[0005] In order to improve the production efficiency of carotenoids, researchers have tried to modify CarRP by genetic engineering to enhance its catalytic activity and yield. Among them, mutating the phytoene cyclase functional domain of CarRP is a potential strategy to improve the synthesis efficiency of carotenoids. SUMMARY
[0006] The present application aims to screen mutant proteins that can significantly improve the synthesis efficiency of target substances (astaxanthin and β-carotene) by performing site-directed saturation mutation on specific amino acids of the phytoene cyclase functional domain of CarRP.
[0007] The present application provides a phytoene cyclase mutant protein, a preparation method thereof and an application thereof.
[0008] The present invention provides a mutant protein (a mutant protein of lycopene cyclase), named CarRP-R mutant protein, which is obtained by mutating the amino acid at the target site in the pre-mutation protein to other amino acids; the pre-mutation protein has the segment shown at positions 1 to 239 in SEQ ID NO: 5; the target site is located at position 98 in SEQ ID NO: 5. The CarRP-R mutant protein is obtained by mutating the amino acid at the target site in the pre-mutation protein from arginine to other amino acids. Specifically, the pre-mutation protein is shown at positions 1 to 239 in SEQ ID NO: 5. Specifically, the pre-mutation protein is a wild-type lycopene cyclase.
[0009] The present invention also provides a mutant protein (a mutant protein of a bifunctional lycopene cyclase / phytoene synthase), designated as a CarRP mutant protein, which is obtained by mutating the amino acid at the target site in the pre-mutation protein to another amino acid; the pre-mutation protein has the segment shown in SEQ ID NO: 5; the target site is located at position 98 of SEQ ID NO: 5. The CarRP mutant protein is obtained by mutating the amino acid at the target site in the pre-mutation protein from arginine to another amino acid. Specifically, the pre-mutation protein is shown in SEQ ID NO: 5. Specifically, the pre-mutation protein is a wild-type bifunctional lycopene cyclase / phytoene synthase.
[0010] Specifically, any of the other amino acids mentioned above is a basic amino acid, a neutral amino acid or an acidic amino acid.
[0011] Specifically, any of the above other amino acids is an aliphatic amino acid, a heterocyclic amino acid or an aromatic amino acid.
[0012] Specifically, any of the above other amino acids is alanine, histidine, tyrosine, serine or threonine.
[0013] The present invention also protects the gene encoding the CarRP-R mutant protein.
[0014] Specifically, the gene is as follows (c1) or (c2) or (c3):
[0015] (c1) a DNA molecule whose coding region is shown in positions 1-717 of SEQ ID NO: 3;
[0016] (c2) a DNA molecule having greater than 95% identity with (c1);
[0017] (c3) A DNA molecule that hybridizes to (c1) under stringent conditions.
[0018] The stringent conditions mentioned above can be hybridization and membrane washing at 65° C. using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS in a DNA or RNA hybridization experiment.
[0019] The present invention also protects the gene encoding the CarRP mutant protein.
[0020] Specifically, the gene is as follows (d1) or (d2) or (d3):
[0021] (d1) a DNA molecule whose coding region is shown in SEQ ID NO: 3;
[0022] (d2) a DNA molecule with greater than 95% identity to (d1);
[0023] (d3) DNA molecule that hybridizes to (d1) under stringent conditions.
[0024] The stringent conditions mentioned above can be hybridization and membrane washing at 65° C. using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS in a DNA or RNA hybridization experiment.
[0025] The present invention also protects expression cassettes, DNA molecules, recombinant vectors or recombinant microorganisms having any of the above genes.
[0026] Specifically, the expression cassette consists of P TEFin The promoter initiates transcription of the gene and is activated by T HMG1 The terminator terminates transcription of the gene.
[0027] Specifically, the DNA molecule having the gene is a donor DNA molecule. Specifically, the donor DNA molecule has L-arm, the expression cassette and R-arm in sequence from upstream to downstream. L-arm is the upstream homology arm, and R-arm is the downstream homology arm. The upstream homology arm and the downstream homology arm are used to integrate the expression cassette into the target site. Specifically, the target site is the intC3 site. The L-arm is the upstream homology arm obtained by PCR amplification using a template, and the template and the primers used for PCR amplification are shown in the pintC3-CarRP plasmid part in Table 3. The R-arm is the downstream homology arm obtained by PCR amplification using a template, and the template and the primers used for PCR amplification are shown in the pintC3-CarRP plasmid part in Table 3.
[0028] Specifically, the recombinant vector having the gene is a recombinant vector having the expression cassette. Specifically, the recombinant vector having the gene is a recombinant vector having the donor DNA molecule. Specifically, the recombinant vector may be pintC3-CarRPtb 98-78 Plasmid, pintC3-CarRPtb98-97 , plasmid pintC3-CarRPtb 98-72 Plasmid, pintC3-CarRPtb 98-59 Plasmid or pintC3-CarRPtb 98-75 Compared with pintC3-CarRP plasmid, pintC3-CarRPtb 98-78 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding histidine (CAT). 98-97 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding alanine (GCG). 98-72 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding serine (TCT). 98-59 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding threonine (ACT). 98-75 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding tyrosine (TAT). Construction method of pintC3-CarRP plasmid: L-arm (upstream homology arm obtained by PCR amplification using template, template and PCR primers are shown in Table 3), P TEFin (using the template amplified by PCR TEFin Promoter, template and primers used for PCR amplification are shown in Table 3), CarRP (CarRP gene obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), T HMG1 (T amplified by PCR using the template HMG1terminator, template and primers used for PCR amplification are shown in Table 3), R-arm (downstream homology arm obtained by PCR amplification using the template, template and primers used for PCR amplification are shown in Table 3) and PUC57-GG were sequentially connected using Golden Gate cloning technology to obtain the pintC3-CarRP plasmid.
[0029] Specifically, the donor DNA molecule is the following segment in the recombinant vector: the segment starting from the L-arm and ending at the R-arm and containing the gene encoding the CarRP mutant protein. Specifically, the donor DNA molecule is a linear DNA molecule containing the gene encoding the CarRP mutant protein obtained by digesting the recombinant vector with the restriction endonuclease SwaI.
[0030] Specifically, the recombinant microorganism harboring the gene is a recombinant microorganism harboring the expression cassette. Specifically, the recombinant microorganism harboring the gene is a recombinant microorganism harboring the donor DNA molecule. Specifically, the recombinant microorganism may be a recombinant bacterium. Specifically, the recombinant bacterium may be a recombinant bacterium obtained by introducing the gene into a chassis strain. Specifically, the recombinant bacterium may be a recombinant bacterium obtained by introducing the recombinant vector into a chassis strain. Specifically, the recombinant bacterium may be a recombinant bacterium obtained by integrating the gene into the genomic DNA of the chassis strain. Specifically, the recombinant bacterium may be a recombinant bacterium obtained by integrating the expression cassette of the gene into the genomic DNA of the chassis strain. Specifically, the recombinant bacterium may be a recombinant bacterium obtained by integrating the gene into the intC3 site of the genomic DNA of the chassis strain. Specifically, the recombinant bacterium may be a recombinant bacterium obtained by integrating the expression cassette of the gene into the intC3 site of the genomic DNA of the chassis strain. Specifically, the recombinant bacterium may be a recombinant bacterium obtained by replacing the segment of the genomic DNA of the chassis strain from the beginning of the L-arm to the end of the R-arm with the donor DNA molecule. Specifically, the recombinant bacteria can be a recombinant bacteria in which the donor DNA molecule is integrated into the intC3 site of the genomic DNA obtained by co-transforming the digestion product obtained by digesting the recombinant vector with SwaI and the pintC3-N20 plasmid into the competent cells of the chassis strain.
[0031] The present invention also protects the use of biological materials in preparing products;
[0032] The functions of the product are as follows (b1) and / or (b2) and / or (b3):
[0033] (b1) as lycopene cyclase;
[0034] (b2) as a bifunctional lycopene cyclase / phytoene synthase;
[0035] (b3) Preparation of carotenoids.
[0036] The present invention also protects the use of biological materials in preparing carotenoids.
[0037] Any of the above-mentioned biological materials is any of the above-mentioned CarRP-R mutant proteins, any of the above-mentioned CarRP mutant proteins, any of the above-mentioned genes encoding CarRP-R mutant proteins, any of the above-mentioned genes encoding CarRP mutant proteins, any of the above-mentioned expression cassettes, any of the above-mentioned donor DNA molecules, any of the above-mentioned recombinant vectors or any of the above-mentioned recombinant microorganisms.
[0038] The present invention also protects the use of any of the above-mentioned CarRP-R mutant proteins as lycopene cyclase.
[0039] The present invention also protects the use of any of the above-mentioned CarRP mutant proteins as a bifunctional lycopene cyclase / phytoene synthase.
[0040] The carotenoid is β-carotene or a downstream product of β-carotene.
[0041] Exemplarily, the downstream product of β-carotene is canthaxanthin.
[0042] Exemplarily, the downstream products of β-carotene are canthaxanthin and / or zeaxanthin and / or astaxanthin.
[0043] Specifically, the chassis strain is a strain capable of synthesizing IPP and DMAPP.
[0044] Specifically, the chassis strain is a strain capable of synthesizing GGPP.
[0045] Specifically, the chassis strain is a strain capable of synthesizing phytoene.
[0046] Specifically, the chassis strain is a strain capable of synthesizing lycopene.
[0047] The chassis strain includes but is not limited to: Yarrowia lipolytica, Escherichia coli, Carynebacterium glutamicum, Bacillus subtilis, Bacillus megaterium or Saxxharomyces cerevisiae, etc.
[0048] Specifically, the chassis strain is a recombinant bacterium obtained by transforming the starting bacterium as follows: the target gene is integrated into the genomic DNA and the target protein is expressed; the target gene is a gene encoding the target protein; the target protein is ERG20 protein, ERG12 protein, GGPPS protein, IDI protein, HMG1 protein, GGS protein, CarB protein and HPcrtW protein.
[0049] Specifically, the chassis strain is a recombinant bacterium obtained by transforming the starting bacterium as follows: ERG20 gene, ERG12 gene, GGPPS gene, IDI gene, HMG1 gene, GGS gene, CarB gene and HPcrtW gene are integrated into the genomic DNA.
[0050] Specifically, the chassis strain is a recombinant bacterium obtained by transforming the starting bacterium as follows: ERG20 gene expression cassette, ERG12 gene expression cassette, GGPPS gene expression cassette, IDI gene expression cassette, HMG1 gene expression cassette, GGS gene expression cassette, CarB gene expression cassette and HPcrtW gene expression cassette are integrated into the genomic DNA.
[0051] Specifically, the chassis strain is a recombinant strain obtained by subjecting the starting bacteria to the following transformations (a1) to (a5):
[0052] (a1) The ERG20 and ERG12 gene expression cassettes were integrated into the intE3 site of the genomic DNA;
[0053] (a2) The GGPPS gene expression cassette and the IDI gene expression cassette were integrated into the intE1 site of the genomic DNA;
[0054] (a3) The HMG1 gene expression cassette and the GGS gene expression cassette were integrated into the intF1 site of the genomic DNA;
[0055] (a4) CarB gene expression cassette and HPcrtW gene expression cassette were integrated into the intC2 site of genomic DNA;
[0056] (a5) The CarB gene expression cassette and the HPcrtW gene expression cassette were integrated into the intF2 site of the genomic DNA.
[0057] The ERG20 gene is a gene encoding the ERG20 protein. The ERG12 gene is a gene encoding the ERG12 protein. The GGPPS gene is a gene encoding the GGPPS protein. The IDI gene is a gene encoding the IDI protein. The HMG1 gene is a gene encoding the HMG1 protein. The GGS gene is a gene encoding the GGS protein. The CarB gene is a gene encoding the CarB protein. The HPcrtW gene is a gene encoding the HPcrtW protein. As a specific example, the GGPPS gene is the GGPPxd gene.
[0058] The starting bacteria may specifically be Yarrowia lipolytica Po1g.
[0059] The starting bacteria may specifically be Yarrowia lipolytica YL002.
[0060] The starting bacteria can specifically be a recombinant bacterium obtained by transforming Yarrowia lipolytica Polg as follows: replacing the KU70 gene in the genomic DNA with a DNA molecule having a Cas9 gene expression cassette and a hygromycin resistance gene expression cassette, and knocking out the URA3 gene in the genomic DNA.
[0061] Specifically, the chassis strain is the recombinant strain WM001 obtained by sequentially operating Yarrowia lipolytica YL002 according to steps 2 to 6 of Example 2.
[0062] ERG12: Gene symbol: YALI1_B21004g; YL No: YALI0B16038g; Gene ID: 2906793; The amino acid sequence of ERG12 protein in NCBI is numbered: XP_500956.1 (10-SEP-2024); The nucleotide sequence of ERG12 gene in NCBI is numbered: XM_500956.3 (10-SEP-2024).
[0063] ERG20: Gene symbol: YALI1_E06759g; YL No: YALI0E05753g; GeneID: 2912329;
[0064] The amino acid sequence of ERG20 protein is registered in NCBI as XP_503599.1 (10-SEP-2024); the nucleotide sequence of ERG20 gene is registered in NCBI as XM_503599.3 (10-SEP-2024).
[0065] IDI: Gene symbol: YALI1_F06018g; YL No: YALI0F04015g; Gene ID: 2907710; The amino acid sequence of IDI protein in NCBI is numbered: XP_504974.3 (10-SEP-2024); The nucleotide sequence of IDI gene in NCBI is numbered: XM_504974.3 (10-SEP-2024).
[0066] HMG1: Gene symbol: YALI1_E05731g; YL No: YALI0E04807g; Gene ID: 2912214; The amino acid sequence of HMG1 protein in NCBI is numbered: XP_503558.1 (10-SEP-2024); The nucleotide sequence of HMG1 gene in NCBI is numbered: XM_503558.3 (10-SEP-2024).
[0067] GGS: Gene symbol: YALI1_D21022g; YL No: YALI0D17050g; Gene ID: 2911219; The amino acid sequence of GGS protein in NCBI is numbered: XP_502923.1 (10-SEP-2024); The nucleotide sequence of GGS gene in NCBI is numbered: XM_502923.3 (10-SEP-2024).
[0068] ERG12 protein, ERG20 protein, IDI protein, HMG1 protein and GGS protein are all endogenous proteins of Yarrowia lipolytica. ERG12 gene, ERG20 gene, IDI gene, HMG1 gene and GGS gene are all endogenous genes of Yarrowia lipolytica.
[0069] GGPPS: The GGPPS protein is accessioned as UniProtKB / Swiss-Prot: Q1L6K3 (31-OCT-2006) at NCBI; the nucleotide sequence of the GGPPS gene is accessioned as DQ016502.1 (01-MAY-2006) at NCBI. The GGPPS protein is derived from Phaffia rhodozyma (Xanthophyllomyces dendrorhous). The GGPPS gene is derived from Phaffia rhodozyma (Xanthophyllomyces dendrorhous). The codon-optimized GGPPS gene (GGPPxd gene) is shown in SEQ ID NO: 1.
[0070] The CarB protein is accessioned in NCBI as KAF1801867.1 (29-APR-2020). The CarB protein is derived from phytoenedehydrogenase [Mucor lusitanicus]. The CarB gene is shown in SEQ ID NO: 2.
[0071] The CrtW protein is accessioned at NCBI as UniProtKB / Swiss-Prot: Q39982.1 (02-OCT-2024). The CrtW protein is derived from Haematococcus lacustris. The CrtW gene is shown in SEQ ID NO: 4.
[0072] The mutant protein provided by the present invention has higher enzyme activity, enabling more efficient synthesis of target compounds, and has important application prospects in biotechnology and industrial production. The present invention not only significantly increases carotenoid production and reduces production costs, but also promotes the widespread application of carotenoids in various fields, with significant economic and social benefits. BRIEF DESCRIPTION OF THE DRAWINGS
[0073] Figure 1 Flowchart for the construction of chassis strain WM001.
[0074] Figure 2 The HPLC chromatogram in Example 3 is shown.
[0075] Figure 3 is the canthaxanthin content and β-carotene content in Example 3. DETAILED DESCRIPTION
[0076] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0077] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in this area or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial channels. Unless otherwise specified, the quantitative tests in the following examples were all repeated three times, and the results were averaged. The kit used for seamless cloning is Seamless Cloning Kit, produced by Beyotime, with a catalog number of D7010M. pUC57 plasmid: GenScript, with a catalog number of SD1176. pUC57-Kan plasmid: GenScript.
[0078] Plasmid pURA-YL-IntC2 and strain Po1g of Yarrowia lipolytica are both described in the following literature: Meng Zhang, Qing Yan Li, Feiyu Fan, Fuping Lu and Xue Li Zhang, Combinatorial metabolic engineering and tolerance evolution of Yarrowialipolytica for improved γ-decalactone synthesis, Process Biochemistry. (2023) 132: 248–254.
[0079] SD-URA - Plate preparation: Dissolve 1.6 g of SD-URA in 60 mL of water and autoclave to obtain Solution A. Dissolve 4 g of agar powder in 120 mL of water and autoclave to obtain Solution B. Prepare a 20 g / 100 mL glucose aqueous solution using glucose and water, then sterilize by filtration through a 0.22 μm pore size filter to obtain 20 mL of Solution C. Mix 60 mL of Solution A, 120 mL of Solution B, and 20 mL of Solution C, and pour onto a plate. SD-URA: FUNGENOME, catalog number YGM003A-3.
[0080] The method for detecting the carotenoid production ability of the test bacteria is as follows:
[0081] A single colony of the test bacteria was inoculated into a test tube containing 4 ml of YPD medium and cultured at 30°C and 250 rpm for 24 hours to obtain a seed solution. Then, 300 μl of the seed solution was inoculated into a test tube containing 15 ml of In a 100 ml YPD medium flask, shake culture was carried out at 30 ° C and 250 rpm (the culture time in Example 3 was 96 h, and the culture time in Example 4 was 120 h); then, 200 μL of the bacterial solution was sampled and centrifuged at 13000 rpm for 3 min, the supernatant was discarded, the bacteria were washed with sterile water, and then 1 ml of acetone was added to resuspend the bacteria, and glass beads with a diameter of 0.5 mm were added. The culture was ground using an automatic sample rapid grinder (70 Hz oscillation for 60 s, interruption for 10 s, for a total of 10 cycles), and then centrifuged at 13000 rpm for 10 min, and the supernatant was collected; then, the supernatant was taken and filtered with a 0.22 μm pore size filter membrane to collect the filtrate; then, the filtrate was taken and analyzed for carotenoid content by high performance liquid chromatography (HPLC).
[0082] HPLC parameters are as follows:
[0083] Chromatographic column: Agilent C18 column (250 mm × 4.6 mm, 5 μm) (Cat. No.: 880975-902);
[0084] Column temperature: 30°C;
[0085] Detector: VWD detector; detection wavelength: 476nm;
[0086] Injection volume: 20 μL;
[0087] Mobile phase: A mixture of 21 parts by volume of acetonitrile, 21 parts by volume of methanol, and 8 parts by volume of dichloromethane;
[0088] Mobile phase flow rate: 1 mL / min;
[0089] Detection time: 30 minutes;
[0090] The peak times of various carotenoids (all peak times were determined by HPLC using standard samples according to the same HPLC parameters): Canthaxanthin: 5.44 min; Echinenone: 10.117 min; Lycopene: 13.88 min; γ-carotene: 17.76 min; β-carotene: 22.78 min. Canthaxanthin standards with different contents were subjected to HPLC using the same HPLC parameters to create a standard curve equation, and the canthaxanthin content in the filtrate was determined based on the standard curve equation. β-carotene standards with different contents were subjected to HPLC using the same HPLC parameters to create a standard curve equation, and the β-carotene content in the filtrate was determined based on the standard curve equation.
[0091] Example 1: Construction of recombinant plasmid
[0092] 1. Construction of cloning series plasmids
[0093] The cloning series plasmids are: pUC57-GGPPxd plasmid, pUC57-CarB plasmid, pUC57-CarRP plasmid and pUC57-HPcrtW plasmid.
[0094] The DNA molecule shown in SEQ ID NO: 1 is obtained by codon-optimizing the GGPPS gene and is named the GGPPxd gene. The DNA molecule shown in SEQ ID NO: 2 is the CarB gene. The DNA molecule shown in SEQ ID NO: 3 is the CarRP gene. The DNA molecule shown in SEQ ID NO: 4 is the crtW gene.
[0095] The DNA molecule represented by SEQ ID NO:1 was inserted into the pUC57 plasmid to generate the pUC57-GGPPxd plasmid. The DNA molecule represented by SEQ ID NO:2 was inserted into the pUC57 plasmid to generate the pUC57-CarB plasmid. The DNA molecule represented by SEQ ID NO:3 was inserted into the pUC57 plasmid to generate the pUC57-CarRP plasmid. The DNA molecule represented by SEQ ID NO:4 was inserted into the pUC57 plasmid to generate the pUC57-HPcrtW plasmid. In constructing the above four plasmids, the DNA molecule insertion sites were all between "cctcgcgaatgcatctagat" and "atcggatcccgggcccgtcg" in the pUC57 plasmid.
[0096] 2. Construction of gRNA series plasmids
[0097] The gRNA series plasmids are: pintE3-N20 plasmid, pintE1-N20 plasmid, pintC2-N20 plasmid, pintF2-N20 plasmid, pintF1-N20 plasmid and pintC3-N20 plasmid.
[0098] Construction method of pintE3-N20 plasmid: Using pURA-YL-IntC2 plasmid as a template, PCR amplification was performed using a primer pair consisting of gRNA-F (universal primer) and IntE3-N20-R to obtain a circular plasmid, namely the recombinant plasmid pintE3-N20.
[0099] The construction method for the pintE1-N20 plasmid differs only in that IntE3-N20-R is replaced with IntE1-N20-R. The construction method for the pintC2-N20 plasmid differs only in that IntE3-N20-R is replaced with IntC2-N20-R. The construction method for the pintF2-N20 plasmid differs only in that IntE3-N20-R is replaced with IntF2-N20-R. The construction method for the pintF1-N20 plasmid differs only in that IntE3-N20-R is replaced with intF1-N20-R. Compared with the construction method of the pintE3-N20 plasmid, the construction method of the pintC3-N20 plasmid differs only in that IntE3-N20-R is replaced by IntC3-N20-R.
[0100] The primer sequences are shown in Table 1. The underlined sequences in the primers are the reverse complementary sequences of the guide RNA.
[0101] Table 1
[0102]
[0103] 3. Construction of donor DNA plasmid series
[0104] The plasmid names of the donor DNA plasmid series, the element composition of the donor DNA molecules in each plasmid, and the target integration sites of the donor DNA molecules in the genomic DNA are shown in Table 2.
[0105] Table 2 Information on integrated genes and integration sites
[0106]
[0107]
[0108] Note: P represents promoter, the subscript of P represents promoter name, T represents terminator, the subscript of T represents terminator name, L-arm represents upstream homology arm, and R-arm represents downstream homology arm.
[0109] Using the pUC57-Kan plasmid as a template, PCR amplification was performed using a primer pair consisting of PUC57-CPEC-F and PUC57-CPEC-R. The PCR amplification product was recovered to obtain a linear plasmid backbone (named PUC57-CPEC).
[0110] The construction method of pintE3-ERG12-ERG20 plasmid was as follows: L-arm (upstream homology arm obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), P TEFin (using the template amplified by PCR TEFin Promoter, template and primers used for PCR amplification are shown in Table 3), ERG20 (ERG20 gene was obtained by PCR amplification using the template, template and primers used for PCR amplification are shown in Table 3), T cyc1 (T amplified by PCR using the template cyc1 The terminator, template and primers used for PCR amplification are shown in Table 3), P lip2 (using the template amplified by PCR lip2 Promoter, template and primers used for PCR amplification are shown in Table 3), ERG12 (ERG12 gene obtained by PCR amplification using the template, template and primers used for PCR amplification are shown in Table 3), T HMG1 (T amplified by PCR using the template HMG1The terminator (template and primers used for PCR amplification are shown in Table 3), R-arm (downstream homology arm obtained by PCR amplification using the template; template and primers used for PCR amplification are shown in Table 3), and PUC57-CPEC were sequentially connected by seamless cloning to generate the pintE3-ERG12-ERG20 plasmid. In the pintE3-ERG12-ERG20 plasmid, the donor DNA molecule containing the ERG20 and ERG12 gene expression cassettes is located between the two SwaI restriction sites.
[0111] The construction method of pintF1-HMG1-GGS plasmid was as follows: L-arm (upstream homology arm obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), P EXP (Use the template to amplify P EXP Promoter, template and primers used for PCR amplification are shown in Table 3), HMG1-T HMG1 (The HMG1 gene and T HMG1 The DNA molecules of the terminator, templates and primers used for PCR amplification are shown in Table 3), P GPD (using the template amplified by PCR GPD Promoter, template and primers used for PCR amplification are shown in Table 3), GGS-T GGS (The GGS gene and T GGS The terminator DNA molecule (template and primers used for PCR amplification are shown in Table 3), the R-arm (downstream homology arm amplified from the template; template and primers used for PCR amplification are shown in Table 3), and PUC57-CPEC were sequentially connected by seamless cloning to generate the pintF1-HMG1-GGS plasmid. In the pintF1-HMG1-GGS plasmid, the donor DNA molecule containing the HMG1 and GGS gene expression cassettes is located between the two SwaI restriction sites.
[0112] Using the pUC57-Kan plasmid as a template, PCR amplification was performed using the primer pair consisting of PUC57-bsaI-GCTC-F and PUC57-bsaI-CTGG-R. The PCR amplification product was recovered, which was the linear plasmid backbone (named PUC57-GG).
[0113] The construction method of pintE1-GGPPxd-IDI plasmid was as follows: L-arm (upstream homology arm obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), P TEFin (using the template amplified by PCR TEFinPromoter, template and primers used for PCR amplification are shown in Table 3), GGPPxd (GGPPxd gene obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), T HMG1 (T amplified by PCR using the template HMG1 The terminator, template and primers used for PCR amplification are shown in Table 3), P EXP (using the template amplified by PCR EXP Promoter, template and primers used for PCR amplification are shown in Table 3), IDI-T IDI (The IDI gene and T IDI The terminator DNA molecule (template and primers used for PCR amplification are shown in Table 3), the R-arm (downstream homology arm amplified from the template (template and primers used for PCR amplification are shown in Table 3), and PUC57-GG were sequentially ligated using Golden Gate cloning to generate the pintE1-GGPPxd-IDI plasmid. In the pintE1-GGPPxd-IDI plasmid, the donor DNA molecule containing the GGPPxd and IDI gene expression cassettes is located between the two SwaI restriction sites.
[0114] The construction method of pintC2-CarB-HPcrtW plasmid was as follows: L-arm (upstream homology arm obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), P EXP (using the template amplified by PCR EXP Promoter, template and primers used for PCR amplification are shown in Table 3), CarB (CarB gene obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), T HMG1 (T amplified by PCR using the template HMG1 The terminator, template and primers used for PCR amplification are shown in Table 3), P TEFin (using the template amplified by PCR TEFin Promoter, template and primers used for PCR amplification are shown in Table 3), HPcrtW (HPcrtW gene obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), T cyc1 (T amplified by PCR using the template cyc1The terminator (template and primers used for PCR amplification are shown in Table 3), R-arm (downstream homology arm obtained by PCR amplification using the template; template and primers used for PCR amplification are shown in Table 3), and PUC57-GG were sequentially ligated using Golden Gate cloning technology to generate the pintC2-CarB-HPcrtW plasmid. In the pintC2-CarB-HPcrtW plasmid, a donor DNA molecule containing the CarB and HPcrtW gene expression cassettes is located between the two SwaI restriction sites.
[0115] The pintF2-CarB-HPcrtW plasmid construction method is essentially the same as the pintC2-CarB-HPcrtW plasmid construction method, with the only differences being the L-arm and R-arm. The L-arm (upstream homology arm obtained by PCR amplification using the template; templates and primers used for PCR amplification are shown in Table 3) and the R-arm (downstream homology arm obtained by PCR amplification using the template; templates and primers used for PCR amplification are shown in Table 3) are used to obtain the pintF2-CarB-HPcrtW plasmid. In the pintF2-CarB-HPcrtW plasmid, a donor DNA molecule containing the CarB and HPcrtW gene expression cassettes is located between the two SwaI restriction sites.
[0116] The construction method of pintC3-CarRP plasmid was as follows: L-arm (upstream homology arm obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), P TEFin (using the template amplified by PCR TEFin Promoter, template and primers used for PCR amplification are shown in Table 3), CarRP (CarRP gene obtained by PCR amplification using template, template and primers used for PCR amplification are shown in Table 3), T HMG1 (T amplified by PCR using the template HMG1 The terminator (template and primers used for PCR amplification are shown in Table 3), R-arm (downstream homology arm obtained by PCR amplification using the template; template and primers used for PCR amplification are shown in Table 3), and PUC57-GG were sequentially ligated using Golden Gate cloning to generate the pintC3-CarRP plasmid. In the pintC3-CarRP plasmid, the donor DNA molecule containing the CarRP gene expression cassette is located between the two SwaI restriction sites.
[0117] Table 3
[0118]
[0119]
[0120]
[0121]
[0122] In Table 3, "Polg total DNA" refers to the total DNA of Yarrowia lipolytica Polg.
[0123] Example 2: Construction of chassis strain WM001
[0124] The construction flow chart of chassis strain WM001 is shown in Figure 1 .
[0125] 1. Construction of recombinant strain YL002
[0126] Using Yarrowia lipolytica Po1g as the starting strain, the KU70 gene in its genomic DNA was replaced with a DNA molecule containing a Cas9 gene expression cassette and a hygromycin resistance gene expression cassette, resulting in recombinant strain YL001. Using recombinant strain YL001 as the starting strain, the URA3 gene was knocked out to generate recombinant strain YL002. Recombinant strain YL002 is described in the following literature: Meng Zhang, Qing Yan Li, Fei Yu Fan, Fu Ping Lu and Xue Li Zhang, Combinatorial metabolic engineering and tolerance evolution of Yarrowia lipolytica for improved γ-decalactone synthesis, Process Biochemistry. (2023) 132:248–254.
[0127] 2. Construction of recombinant strain YL045
[0128] Take the pintE3-ERG12-ERG20 plasmid, cut it with restriction endonuclease SwaI, and co-transform the digestion product and pintE3-N20 plasmid into the competent cells of the recombinant bacteria YL002. After incubation for 1 hour, coat the cells with SD-URA. - The plate was cultured at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain a recombinant bacterium in which the ERG20 gene expression cassette and the ERG12 gene expression cassette were integrated into the intE3 site of the genomic DNA. The recombinant bacterium was named YL045.
[0129] 3. Construction of recombinant strain YL046
[0130] Take the pintE1-GGPPxd-IDI plasmid, cut it with the restriction endonuclease SwaI, and co-transform the digestion product and the pintE1-N20 plasmid into the competent cells of the recombinant bacteria YL045. After incubation for 1 hour, coat the cells with SD-URA. - The plate was cultured at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain a recombinant bacterium in which the GGPPxd gene expression cassette and the IDI gene expression cassette were integrated into the intE1 site of the genomic DNA. The recombinant bacterium was named YL046.
[0131] 4. Construction of recombinant strain YL050
[0132] Take the pintF1-HMG1-GGS plasmid, cut it with restriction endonuclease SwaI, and co-transform the digestion product and pintF1-N20 plasmid into the competent cells of the recombinant bacteria YL046. After incubation for 1 hour, coat the cells with SD-URA. - The plate was cultured at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain a recombinant bacterium in which the HMG1 gene expression cassette and the GGS gene expression cassette were integrated into the intF1 site of the genomic DNA. The recombinant bacterium was named YL050.
[0133] 5. Construction of recombinant strain YL051
[0134] Take the pintC2-CarB-HPcrtW plasmid, cut it with restriction endonuclease SwaI, and co-transform the digestion product and pintC2-N20 plasmid into the competent cells of the recombinant bacteria YL050. After incubation for 1 hour, coat the cells with SD-URA. - The plate was cultured at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain a recombinant bacterium in which the CarB gene expression cassette and the HPcrtW gene expression cassette were integrated into the intC2 site of the genomic DNA. The recombinant bacterium was named YL051.
[0135] VI. Construction of recombinant strain WM001
[0136] Take the pintF2-CarB-HPcrtW plasmid, cut it with restriction endonuclease SwaI, and co-transform the digestion product and pintF2-N20 plasmid into the competent cells of the recombinant bacteria YL051. After incubation for 1 hour, coat the cells with SD-URA. - The plate was cultured at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain a recombinant bacterium in which the CarB gene expression cassette and the HPcrtW gene expression cassette were integrated into the intF2 site of the genomic DNA. The recombinant bacterium was named WM001.
[0137] The characteristics of the starting bacteria and each recombinant bacteria are described in Table 4.
[0138] Table 4
[0139] Name of the starting strain or recombinant strain Feature Description Po1g MATa,leu2-270,ura3-302::URA3,xpr2-332,axp-2 YL001 Po1g-Δku70::Cas9-HY YL002 Po1g-Δku70::Cas9-HY,Δura3 YL045 YL002-intE3::ERG12-ERG20 YL046 YL045-intE1::GGPPxd-IDI YL050 YL046-intF1::HMG1-GGS YL051 YL050-intC2::CarB-crtW WM001 YL051-intF2::CarB-crtW
[0140] Example 3: Screening of mutant proteins
[0141] 1. Construction of reference strains
[0142] Take the pintC3-CarRP plasmid, cut it with restriction endonuclease SwaI, and co-transform the digestion product and pintC3-N20 plasmid into the competent cells of the recombinant bacteria WM001. After incubation for 1 hour, coat the cells with SD-URA. - The plates were incubated at 30°C for 2 days. Grown colonies were picked and identified by PCR. Recombinant strain WM001-1 was identified, harboring the wild-type CarRP gene expression cassette integrated at the intC3 site of its genomic DNA. The wild-type CarRP gene is represented by SEQ ID NO:3, encoding the wild-type CarRP protein represented by SEQ ID NO:5.
[0143] In the wild-type CarRP protein, amino acid residues 1-239 constitute CarRP-R (having lycopene cyclase activity), and amino acids 246-614 constitute CarRP-P (having phytoene synthase activity).
[0144] 2. Screening of mutant proteins
[0145] 1. Using the pintC3-CarRP plasmid as a template, saturation mutagenesis was performed on the codon encoding the 98th amino acid residue of CarRP to obtain a library consisting of mutant plasmids (single-point saturation mutagenesis, including at least 20 amino acid types, 3-fold coverage, so at least 60 single colonies are required for a full coverage mutation library. Therefore, to ensure full coverage of mutation types, the mutation library includes at least 200 single colonies).
[0146] 2. Take the library prepared in step 1, digest it with restriction endonuclease SwaI, and co-transform the digestion product and pintC3-N20 plasmid into the competent cells of recombinant bacteria WM001. After incubation for 1 hour, coat the cells with SD-URA - Plates were incubated at 30°C for 2 days.
[0147] 3. After completing step 2, pick 100 red colonies (named clones 98-1 to 98-100) and streak inoculate them into new SD-URA - Plates were incubated at 30°C for 2 days.
[0148] 4. After completing step 3, select 30 strains with deep red color as test bacteria.
[0149] 5. Detect the carotenoid-producing ability of the test bacteria (use the recombinant bacteria WM001-1 as a reference strain of the test bacteria to detect its carotenoid-producing ability).
[0150] The HPLC chromatogram of recombinant strain WM001-1 is shown in Figure 2 A. The HPLC chromatogram of the exemplary test bacteria (clone 98-97) is shown in Figure 2 B.
[0151] The canthaxanthin content and β-carotene content in the filtrate are shown in Figure 3 , the unit is mg / L.
[0152] High-yielding clones were selected, and genomic DNA was extracted from each clone for sequencing. Based on the sequencing results, a mutant CarRP protein was discovered.
[0153] Example 4: Directed preparation of recombinant bacteria and verification of their production performance
[0154] 1. Directed preparation of five recombinant bacteria
[0155] Preparation of pintC3-CarRPtb 98-78 Compared with pintC3-CarRP plasmid, pintC3-CarRPtb 98-78 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding histidine (CAT). 98-78 The plasmid was digested with restriction endonuclease SwaI, and the digestion product and pintC3-N20 plasmid were co-transfected into the competent cells of the recombinant bacteria WM001. After incubation for 1 hour, SD-URA was applied. - The plate was cultured at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain a recombinant bacterium with the mutant CarRP gene expression cassette integrated into the intC3 site of the genomic DNA. The recombinant bacterium was named recombinant bacterium 98-78.
[0156] Preparation of pintC3-CarRPtb 98-97 Compared with pintC3-CarRP plasmid, pintC3-CarRPtb 98-97 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding alanine (GCG). 98-97The plasmid was digested with restriction endonuclease SwaI, and the digestion product and pintC3-N20 plasmid were co-transfected into the competent cells of the recombinant bacteria WM001. After incubation for 1 hour, SD-URA was applied. - The plate was incubated at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain a recombinant bacterium with the mutant CarRP gene expression cassette integrated into the intC3 site of the genomic DNA. The recombinant bacterium was named recombinant bacterium 98-97.
[0157] Preparation of pintC3-CarRPtb 98-72 Compared with pintC3-CarRP plasmid, pintC3-CarRPtb 98-72 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding serine (TCT). 98-72 The plasmid was digested with restriction endonuclease SwaI, and the digestion product and pintC3-N20 plasmid were co-transfected into the competent cells of the recombinant bacteria WM001. After incubation for 1 hour, SD-URA was applied. - The plate was cultured at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain a recombinant bacterium with the mutant CarRP gene expression cassette integrated into the intC3 site of the genomic DNA. The recombinant bacterium was named recombinant bacterium 98-72.
[0158] Preparation of pintC3-CarRPtb 98-59 Compared with pintC3-CarRP plasmid, pintC3-CarRPtb 98-59 The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding threonine (ACT). 98-59 The plasmid was digested with restriction endonuclease SwaI, and the digestion product and pintC3-N20 plasmid were co-transfected into the competent cells of the recombinant bacteria WM001. After incubation for 1 hour, SD-URA was applied. - The plate was incubated at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain a recombinant bacterium with the mutant CarRP gene expression cassette integrated into the intC3 site of the genomic DNA. The recombinant bacterium was named as recombinant bacterium 98-59.
[0159] Preparation of pintC3-CarRPtb 98-75 Compared with pintC3-CarRP plasmid, pintC3-CarRPtb 98-75The only difference between the plasmids is that the codon encoding the 98th amino acid residue of CarRP has been replaced from the codon encoding arginine (AGA) to the codon encoding tyrosine (TAT). 98-75 The plasmid was digested with restriction endonuclease SwaI, and the digestion product and pintC3-N20 plasmid were co-transfected into the competent cells of the recombinant bacteria WM001. After incubation for 1 hour, SD-URA was applied. - The plate was incubated at 30°C for 2 days, and the grown colonies were picked and identified by PCR to obtain a recombinant bacterium with the mutant CarRP gene expression cassette integrated into the intC3 site of the genomic DNA. The recombinant bacterium was named recombinant bacterium 98-75.
[0160] 2. Verification of the production performance of recombinant bacteria
[0161] The five recombinant bacteria prepared in step 1 were used as test bacteria (the recombinant bacteria WM001-1 constructed in Example 3 was used as a reference strain for the test bacteria) to detect their ability to produce carotenoids.
[0162] The canthaxanthin content and β-carotene content in the filtrate are shown in Table 5, both in mg / L.
[0163] Table 5
[0164]
[0165] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.
Claims
1. A lycopene cyclase / phytoene synthase mutant protein, obtained by mutating the amino acid at a target site in the pre-mutation protein to another amino acid; the sequence of the pre-mutation protein is shown in SEQ ID NO: 5; the target site is located at position 98 of SEQ ID NO: 5; and the other amino acid is alanine, histidine, tyrosine, serine, or threonine.
2. A gene encoding the mutant protein according to claim 1.
3. An expression cassette, DNA molecule, recombinant vector or recombinant microorganism comprising the gene of claim 2.
4. Use of the mutant protein according to claim 1 in the preparation of β-carotene or downstream products of β-carotene.
5. Application of biomaterials in product preparation; The biological material is the gene according to claim 2, the expression cassette according to claim 3, the DNA molecule according to claim 3, the recombinant vector according to claim 3, or the recombinant microorganism according to claim 3; The prepared product is as follows (b1) and / or (b2): (b1) preparing bifunctional lycopene cyclase / phytoene synthase; (b2) preparing β-carotene or downstream products of β-carotene.
Citation Information
Patent Citations
Yarrowia lipolytica with high yield of [beta]-carotene and application thereof
CN112831427A
Method for improving beta-carotene produced by Yarrowia lipolytica through molecular docking, obtained engineering bacteria, and construction method and application of engineering bacteria
CN117264793A