Application of Gh4CL7 gene in cultivation of cotton variety with enhanced or reduced high-temperature fertility

Abstract

The invention discloses application of a cotton Gh4CL7 gene in preparation of a cotton variety with improved or reduced high-temperature fertility, and belongs to the technical field of plant genetic engineering. The Gh4CL7 gene has a nucleotide sequence as shown in SEQ ID NO: 1 and can encode an amino acid sequence as shown in SEQ ID NO: 2. According to the invention, a Gh4CL7 gene transgenic cotton plant is obtained through a transgenic technology, so that the fertility of the cotton plant at high temperature is influenced. Furthermore, through paraffin section cytological observation and field test yield trait analysis, the result shows that the Gh4CL7 gene plays an important role in regulating and controlling high-temperature fertility. The invention provides favorable gene resources for cultivation of high-temperature-resistant cotton varieties.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and in particular, relates to the application of the Gh4CL7 gene in cultivating cotton varieties with enhanced or reduced high-temperature fertility. Background Art

[0002] Since 1850, global warming has become an indisputable fact. Against the backdrop of global warming, extreme high temperature events have occurred frequently and intensified (Xu Tingting et al., 2022). Global high temperatures will intensify in the future and have a greater impact on more regions. Xinjiang is located in the hinterland of the Eurasian continent, far from the ocean, with complex terrain. It is a sensitive area to climate change and an ecologically fragile area. Affected by high temperature events, crop growth and development are restricted, and yield and quality decline, which directly endangers Xinjiang's agricultural development. At the same time, Xinjiang is the main base for cotton production in my country. Affected by high temperatures, cotton has male sterility and buds and bolls fall off, which in turn causes a decline in cotton production.

[0003] High temperature (HT) stress generally refers to the temperature exceeding the threshold level for a period of time and causing irreversible damage to the growth and development of plants. High temperature is a major abiotic stress factor that limits crop production and has harmful effects on plants. In male reproductive tissues, HT-induced metabolic changes involve carbohydrates, hormone pathways, DNA methylation, miRNAs, and fatty acids, and cause genetic changes in plants (Khan AH, Min L, Ma Y, et al., 2023. High-temperature stress in crops: male sterility, yield loss and potential remedy approaches [J]. Plant Biotechnology Journal, 21 (4): 680-697.). Globally, many crop varieties, including cotton, are sensitive to high temperature stress, which ultimately affects the economies of various countries by reducing crop yields. Understanding the mechanisms and genes involved in these pathways during the high temperature stress response will provide a new way to improve crops using molecular breeding and biotechnology methods.

[0004] High temperature can affect the development of anthers, leading to male sterility and crop yield reduction. During anther development, the pollen wall can protect pollen grains from damage by the external environment and help promote the recognition and hydration of pollen and stigma to complete the fertilization process. Spore pollen protein is a component of the pollen wall. Studies have shown that phenylpropanoid pathway derivatives are important components of spore pollen proteins in seed plants, and the lignin monomer biosynthesis pathway in the phenylpropanoid metabolic pathway is necessary for pollen to resist high temperature and ultraviolet stress. Therefore, phenylpropanoid pathway derivatives play an important role in anther development and resistance to high temperature. Previous studies have shown that cotton Gh4CL7 belongs to the 4CL gene family, and 4CL is a key enzyme in the phenylpropanoid pathway (Sun Shichao, 2020. Transcriptome analysis of green cotton fiber and identification of the 4CL gene family [D]. Shihezi University.), but there is no research on plant fertility. Summary of the invention

[0005] The present invention cloned the Gh4CL7 gene from upland cotton, constructed an editing vector of the gene, and transformed cotton by Agrobacterium-mediated method, which caused the fertility of cotton to decrease under high temperature weather. The tissue section method was used to further observe that the anther development of cotton was affected by high temperature during anther development, and the pollen fertility was reduced, resulting in a loss of cotton yield. Therefore, it is believed that the Gh4CL7 gene plays an important role in regulating high temperature fertility.

[0006] The present invention provides the use of the Gh4CL7 gene in breeding cotton varieties with enhanced or reduced high temperature fertility, wherein the Gh4CL7 gene has a nucleotide sequence shown in SEQ ID NO: 1. The open reading frame of the gene is 2912 bp.

[0007] The nucleotide sequence shown in SEQ ID NO: 1 can encode the amino acid sequence shown in SEQ ID NO: 2. The amino acid sequence contains 547 amino acids, the relative molecular weight of the protein is 59508.05, and the isoelectric point is 5.84.

[0008] The invention discloses an application of the Gh4CL7 gene in breeding cotton varieties with enhanced or reduced high temperature fertility, wherein the Gh4CL7 gene has a nucleotide sequence shown in SEQ ID NO:1.

[0009] Specifically, by reducing the expression level or activity of the gene in cotton, the fertility of cotton at high temperature is reduced, which can enrich germplasm resources and can also be used to cultivate varieties that are sterile at high temperatures for plant breeding.

[0010] More specifically, this is achieved by knocking out the endogenous Gh4CL7 gene in cotton.

[0011] In a specific embodiment, a plant editing vector containing the gene is used to transform cotton through Agrobacterium-mediated transformation to obtain a transformed plant.

[0012] Further, homozygous cotton varieties with reduced fertility at high temperatures are obtained through screening and self-pollination, or hybrid varieties with reduced fertility at high temperatures are obtained through hybrid breeding.

[0013] In another embodiment, the fertility of cotton under high temperature is improved by increasing the expression level or activity of the gene in cotton.

[0014] Specifically, a plant expression vector containing the gene is used to transform the gene into cotton through Agrobacterium-mediated transformation to obtain a transformed plant.

[0015] The present invention also provides a method for breeding cotton varieties with enhanced or reduced high temperature fertility, which uses a plant editing vector containing the gene to transform into cotton through Agrobacterium-mediated transformation to obtain transformed plants;

[0016] Or by increasing the expression level or activity of the gene in cotton, so as to improve the fertility of cotton under high temperature;

[0017] Further, homozygous cotton varieties with reduced or improved fertility at high temperatures are obtained through screening and self-pollination, or hybrid varieties with reduced or improved fertility at high temperatures are obtained through hybrid breeding.

[0018] The high temperature refers to the plant growth temperature exceeding 37°C in the field, and the indoor high temperature treatment is 37°C treatment for 16 hours and 31°C treatment for 8 hours, simulating the field growth temperature.

[0019] Beneficial effects of the present invention: The cotton plants transgenic with the Gh4CL7 gene obtained by the present invention reduce the fertility of the plants under high temperature. Further cytological observations show that the Gh4CL7 gene plays an important role in regulating high temperature fertility. The present invention provides gene resources for breeding high temperature resistant varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 A shows the Gh4CL7 gene structure and gene editing type.

[0021] Figure 1 B shows tissue culture transgenic plants; Figure 1 C shows the fertility observation of wild-type and Gh4CL7 gene knockout lines after high temperature stress.

[0022] Figure 2The results of paraffin sections of WT and Gh4CL7 transgenic materials at different stages are shown. Among them, paraffin sections of anthers of 4cl7 and WT at different stages. MC, meiotic pollen; TTP, tetrad pollen; UNP, uninucleate pollen; MP, mature pollen; T, tapetum; MSP, microspore

[0023] Figure 3 Shown are the yield trait analysis of WT and Gh4CL7 mutant. DETAILED DESCRIPTION

[0024] In order to make the technical problems, technical solutions and beneficial effects solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with embodiments.

[0025] Example

[0026] The following examples are used to demonstrate preferred embodiments of the present invention. It will be appreciated by those skilled in the art that the techniques disclosed in the following examples represent techniques discovered by the inventors that can be used to implement the present invention and therefore can be considered as preferred embodiments of the present invention. However, it will be appreciated by those skilled in the art based on this specification that many modifications may be made to the specific embodiments disclosed herein and still achieve the same or similar results without departing from the spirit or scope of the present invention.

[0027] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs, and the disclosure and materials cited therein are hereby incorporated by reference.

[0028] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein.

[0029] Example 1

[0030] 1. Cotton material

[0031] The cotton material selected in this experiment was Xincai Cotton No. 7 (C7), which was planted in Erlian Cotton Research Institute, Shihezi University Experimental Field, Xinjiang, China (44°27′N, 85°94′E), and the management measures were normal field management. The materials for paraffin tissue sections were anthers of wild type (WT) and gene-edited plants (CR-Gh4cl7) at meiosis, tetrad, mononucleate and dinucleate stages, and mature stages.

[0032] 2. Reagents and consumables

[0033] 2.1 Enzymes and kits: Phanta Max Super-Fidelity DNA Polymerase and gel recovery kit were purchased from Vazyme; RNA extraction kit was purchased from Adlai Biotechnology, and reverse transcription kit was purchased from Quanshijin. ⅡOne Step Cloning Kit was purchased from Vazyme; plasmid extraction kit was purchased from Vazyme; restriction endonuclease (BsaI) was purchased from NEB; DNA Marker 2000 was purchased from GDSBio.

[0034] 2.2 Other drugs: Agarose is a Spanish original product, peptone (Tryptone), yeast extract (Yeastextract), sodium chloride (NaCl), agar powder (Agar), CTAB, ascorbic acid, β-mercaptoethanol, chloroform, ethanol, isopropanol, sodium acetate, tryptone, glucose, ammonium nitrate (NH4NO3), potassium nitrate (KNO3), magnesium sulfate (MgSO4·7H2O), dimethyl phosphate (KH2PO4), calcium chloride (CaCl2·2H2O), mannitol, glycine, magnesium chloride (MgCl2 ·6H2O), Phytagel, glutamine, asparagine, and phytagel were of domestic analytical grade; MS, 1 / 2MS, and customized differentiation medium were purchased from Coolaber; acetosyringone, 6-benzylaminopurine (6-BA), kinetin (KT), 2,4-dichlorophenoxyacetic acid (2,4-D), kanamycin sulfate (Ka), and cefotaxime (Cef) were purchased from Biotopped; Escherichia coli competent cells Trans5α were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; and Agrobacterium competent cells LBA4404 were stored in the laboratory.

[0035] 2.3 Culture medium: LB liquid medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride; LB solid medium: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar powder, make up to 1 L; LB selective medium: before LB plating, add antibiotics of corresponding concentration when the culture medium is autoclaved and cooled to 55°C, shake well and then spread on the plate. MGL medium: tryptone 5g / L, sodium chloride 5g / L, MgSO4·7H2O 0.1g / L, KH2PO4 0.25g / L, mannitol 5g / L, glycine 1.0g / L, dilute to 1L, PH=5.8; bulk A solution: ammonium nitrate 33g / L, magnesium sulfate 7.4g / L, KH2PO4 3.4g / L, CaCl2·2H2O 8.8g / L, dilute to 1L; seedling medium: bulk A 25ml / L, potassium nitrate 25ml / L, glucose 15g / L, agar powder 7.5-8g / L, dilute to 1L, PH=6.0; selection medium: MS, glucose 30g / L, MgCl2·6H2O 0.3g / L, IBA 0.5mg / L, KT 0.15mg / L, plant gel 2.5g / L, fixed volume to 1L, PH=5.9; Differentiation medium: customized differentiation, glucose 30g / L, glutamine 1g / L, asparagine 0.5g / L, IBA 0.5mg / L, KT 0.15mg / L, plant gel 2.5g / L, fixed volume to 1L, PH=5.9; Rooting medium: 1 / 2MS, glucose 15g / L, plant gel 2.5g / L, fixed volume to 1L, PH=5.9.

[0036] 2.4 Main instruments: PCR amplification instrument (Eppendorf), high-speed centrifuge (Eppendorf 5424), electrophoresis equipment (Beijing Liuyi), Nanodrop 2000 micro-spectrophotometer (NanoDrop Technologies), constant temperature culture oscillator (Tianjin Test), artificial climate test chamber, etc.

[0037] Experimental methods and results

[0038] 1. Bioinformatics Analysis and Cloning of Cotton Gh4CL7 Gene

[0039] 1.1 The gene sequence of Gh4CL7 was obtained from NCBI, primers were designed using Primer Premier 5.0 software, and PCR (Polymerase Chain Reaction) method was used to amplify from Colored Cotton No. 7, encoding 547 amino acids, with a relative molecular weight of 59508.05 and an isoelectric point of 5.84.

[0040] The CDS sequence of the Gh4CL7 gene is (SEQ ID NO: 1):

[0041]

[0042] The amino acid sequence is (SEQ ID NO: 2):

[0043] .

[0044] 1.2 Gene cloning process

[0045] (1) Experimental materials: New Color Cotton No. 7 (C7) was planted in Erlian Cotton Research Institute, Shihezi University Experimental Field, Xinjiang, China, and managed as normal field management. Young leaves of the plants were taken, and three biological replicates were made. The taken materials were quickly frozen in liquid nitrogen and stored in a -80℃ refrigerator for later use.

[0046] (2) The steps for DNA extraction are:

[0047] CTAB genomic DNA extraction solution formula (400mL):

[0048]

[0049] 1) While keeping the sample frozen, place the sample in a 2 mL centrifuge tube, insert two steel balls, freeze it quickly in liquid nitrogen, and shake it on a shaker at 30 rpm for 1 min until the leaf tissue is completely broken into powder.

[0050] 2) Preheat the CTAB liquid in a 65°C water bath, add 800 mL of CTAB to each sample centrifuge tube, invert several times to fully dissolve the sample, and use a magnet to suck out the steel balls in the centrifuge tube.

[0051] 3) Place the centrifuge tube in a 65°C water bath for 30 min, take out the centrifuge tube and place it on ice for 10 min, shake it thoroughly, place it in a 4°C centrifuge, and centrifuge it at 12,000 rpm for 10 min.

[0052] 4) Pipette 800 μL of the supernatant into a new 2 mL centrifuge tube, add 800 μL of chloroform, shake upside down until the solution is not separated, and centrifuge again.

[0053] 5) Pipette 600 μL of supernatant into a 2 mL centrifuge tube, add the same volume of chloroform, mix until the solution is not separated, and centrifuge again.

[0054] 6) Pipette 350 μL of supernatant into a 1.5 mL centrifuge tube, add 100 μL of sodium acetate (NaCHCOOH), mix well, then add two times the volume of pre-cooled isopropanol, slowly invert several times, let stand for 5 minutes, and centrifuge at 12,000 rpm, 4°C for 6 minutes.

[0055] 7) Discard the supernatant, add 500 μL 75% ethanol for washing, and centrifuge at 12000 rpm and 4°C for 2 min.

[0056] 8) Discard the supernatant, add 500 μL 100% ethanol for washing, and centrifuge at 12000 rpm and 4°C for 2 min.

[0057] 9) Discard the supernatant, air-dry the DNA at room temperature, and add 100 μL ddH2O to dissolve it.

[0058] The extracted DNA solution was tested on a UV spectrophotometer: concentration>30 ng / μL, OD260 / 280=1.8-2.2. The DNA quality was tested by agarose gel electrophoresis.

[0059] (3) PCR amplification of target gene

[0060] The amplification reaction was carried out on a PCR instrument. The reaction system included the following reagents, all purchased from Vazyme.

[0061] The PCR reaction system is as follows (50 μL):

[0062]

[0063] The PCR amplification procedure is as follows:

[0064]

[0065] Primer sequences:

[0066] Gh4CL7-F:ATGGTAGCCCAAGCTGAATT

[0067] Gh4CL7-R:ATGTTTTTTAGTGGCCAATTTAGC.

[0068] After the reaction, the samples were stored at 4°C and detected by 1% agarose electrophoresis. If the band size was consistent with the expected design, it was considered a valid result.

[0069] (4) Use a gel recovery kit to excise and recover the target fragment.

[0070] (5) The product recovered from the above glue is ⅡOne Step Cloning Kit was used for ligation of T vector construction and transformation of E. coli.

[0071] (6) Overnight culture at 37°C: Pick a single clone from the resistant LB medium and culture it at 37°C with shaking.

[0072] (7) PCR verification of bacterial solution: select positive clone samples and send them to Sangon Co., Ltd. for sequencing. Add a certain amount of glycerol to the bacterial solution with correct sequencing and store it at -80°C.

[0073] 2. Construction of plant gene editing vectors

[0074] 2.1 Target search and primer design

[0075] Refer to the CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / ) target design website, enter the gene number of the target gene Gh4CL7 for target search, and select the target with a higher score in the search results. In this experiment, in order to achieve simultaneous knockout of homologous genes, when screening targets, select the same targets of two homologous genes (similarity 100%).

[0076] Primer sequences:

[0077]

[0078] 2.2 PCR amplification of target gene

[0079] First PCR

[0080]

[0081] PCR reaction procedure:

[0082]

[0083]

[0084] Second PCR

[0085] Use overlap extension PCR to splice the two small fragments

[0086]

[0087] PCR conditions:

[0088]

[0089] Detect PCR products by electrophoresis and recover the products from gel.

[0090] 2.3 Vector digestion

[0091]

[0092] The enzyme cleavage was detected by gel electrophoresis, and the cleavage products were immediately recovered from the gel.

[0093] 2.4In-fusion connection

[0094]

[0095] React at 37℃ for 30min and store on ice at -20℃ for later use.

[0096] 2.5 Heat shock transformation of competent cells

[0097] (1) Take 100 μL of competent medium and place it on ice for later use. Take 1 μL of the above ligation product and add it to the competent medium and place it on ice for 30 min.

[0098] (2) Heat shock in a 42°C water bath for 90 seconds, then place on ice for 5 minutes.

[0099] (3) Add 700 μL of LB liquid to the competent medium containing the ligation product and culture in a shaking incubator at 37°C for 1 h.

[0100] (4) Centrifuge at 12000 r / min for 30 s to remove the supernatant, aspirate 100 μL of the bacterial solution and spread it evenly on LB solid medium containing Kan resistance, and incubate inverted in a 37°C incubator for 16 h.

[0101] (5) Randomly select monoclonal strains and shake them (containing Kan antibiotics), amplify the bacterial solution and verify it by PCR, screen the positive strains, preserve them in 60% glycerol, and store them in a -80℃ refrigerator.

[0102] PCR verification: Use U6-7 and Inf Gh4CL7as for positive detection. Run gel electrophoresis and screen positive clones for sequencing.

[0103] PCR reaction procedure:

[0104]

[0105] The PCR amplification procedure is as follows:

[0106]

[0107] Positive test / sequencing primers:

[0108] U6-7s: TGTGCCACTCCAAAGACATCAG+Inf Gh4CL7as.

[0109] 2.6 Preparation of competent Agrobacterium

[0110] Preparation steps of Agrobacterium tumefaciens:

[0111] (1) Strain selection: The LBA4404 strain was selected in this experiment.

[0112] (2) Cultivation of strains: The strains were cultured in LB medium at 28°C for 16-18 hours until the bacterial solution reached the logarithmic growth phase (OD600 value was approximately 0.6-0.8).

[0113] (3) Strain treatment: The competent strain was treated by centrifugation at 5000 r for 1 min to remove the inducer and other residues and precipitate the strain to the bottom of the centrifuge tube.

[0114] (4) The strain precipitate was repeatedly washed three times with sterile water, and then suspended with 10% glycerol (previously placed on an ice box) and dispensed into 1.5 mL sterile PE tubes, with each tube containing 100 mL for easy use.

[0115] (5) Place the aliquoted bacterial suspension in liquid nitrogen for 5 min and immediately store it in a -80°C freezer for later use.

[0116] 2.7 Cotton genetic transformation

[0117] (1) Peel off the cotton seeds and place them in a conical flask. Use mercuric chloride to disinfect the seeds for about 15 minutes, and gently shake them during the process. After disinfection, recover the mercuric chloride disinfectant, wash the seeds with sterile water for 5-6 times, and evenly place the seeds at the bottom of the seedling culture medium. Culture them in a dark environment at 28°C for 2 days. When the roots are extended for a while, insert the seeds vertically into the seedling culture medium to ensure that the seedlings grow upright.

[0118] (2) Activate the vector strain by streaking on LB solid medium and incubating it upside down in a 28°C incubator for 2 days. Pick a single colony and verify the presence of the vector using PCR. Then shake the bacteria in a 28°C shaker until the bacterial solution turns orange-yellow. Centrifuge at 4°C, 4000r / min for 5 min, remove the supernatant, resuspend the precipitated bacteria in MGL medium (add AS to activate the strain), and measure its OD600 value to be between 0.6 and 0.8 for use.

[0119] (3) Take out the seedlings and place them on sterilized filter paper. Remove the roots and leaves, cut the hypocotyls into small sections of about 1 cm and place them in a 50 mL conical flask. Infect with the bacterial solution for about 12-15 min, immediately pour out the bacterial solution, and use clean filter paper to absorb the excess bacterial solution on the surface of the hypocotyls. After the bacterial solution is dried as much as possible, spread the hypocotyls flat on the co-culture medium, culture them in the dark at 28°C for 48 h, and transfer them to the selective culture medium.

[0120] (4) As nutrients are consumed, the culture medium will turn brown. Therefore, subculture is required every 30 days or so by transferring the hypocotyls to new culture medium until callus tissue appears.

[0121] (5) The callus will further proliferate and differentiate in the selective medium. Continuously select granular, loose callus for subculture. After 2-3 months, it can be induced to gradually form embryonic callus. The embryonic callus can be transferred to the differentiation medium in batches for proliferation.

[0122] (6) When the embryonic callus has formed a relatively complete embryoid, the embryoid is transferred to a rooting medium to induce the embryoid to differentiate into roots, stems, leaves, etc., and gradually grow into a regenerated seedling.

[0123] (7) When the seedlings grow to about 10 cm (just growing out of the conical bottle mouth), select the seedlings with strong root systems and transplant them into nutrient soil. Cover the seedlings with bottles to keep them warm and moist. After the seedlings have grown for 20-30 days, remove the plastic bottles and move them to an artificial climate chamber for cultivation.

[0124] 2.8 Detection of genetically modified plants

[0125] The CTAB method is used to extract cotton tissue DNA for positive detection of gene-edited plants. When detecting edited plants, PCR is first used to amplify the gene editing vector-specific fragment, and the vector-positive plants are detected for subsequent gene fragment sequencing. Primers are designed with reference to the upland cotton genome database so that the cloned gene fragment contains the target site. After PCR amplification, the T vector is connected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results are compared, and the gene-edited positive plants are determined based on the base deletion or substitution at the target site.

[0126] 2.9T3 generation homozygous transgenic lines were used for plant phenotype observation and data statistics, such as Figure 1 ;

[0127] Phenotypic observations of the T3 transgenic lines and wild-type cotton plants revealed that the wild-type plants could shed pollen normally at temperatures above 37°C, while the knockout plants showed that the petals did not open, the anthers did not crack, and they could not shed pollen normally. Pollen grains on the day of flowering were stained. The pollen of the wild-type plants could be stained normally and the pollen was vigorous, while the knockout plants had no pollen, the pollen could not be stained normally, and the pollen was sterile. Under the appropriate temperature, the knockout plants showed that fertility returned to normal. The above results show that after the Gh4CL7 gene was knocked out, the fertility of pollen under high temperature was significantly reduced, so the Gh4CL7 gene plays an important role in regulating high temperature fertility.

[0128] 2.10 Pollen grain staining

[0129] I2-KI staining solution is a commonly used plant pollen stain, used to detect plant pollen activity:

[0130] I2-KI solution: Dissolve 2g KI in 5-10mL distilled water, add 1g I2 and wait for it to completely dissolve, then add 300mL distilled water. Store in a brown bottle for later use.

[0131] (1) Sample collection: Select flowers that normally shed pollen on the day of flowering, and gently shake the flowers to allow the pollen to scatter evenly onto the slide.

[0132] (2) Staining: Add K2I staining solution and let it stand for 5-10 minutes to allow the staining solution to fully penetrate into the pollen cells.

[0133] (3) Sealing: Place the cover slip on the slide and gently press to seal.

[0134] (4) Observation: Observe the morphology, structure and staining of pollen under a microscope.

[0135] 2.11 Anther section preparation and observation

[0136] Detailed steps for preparing paraffin sections of anther tissue:

[0137] FAA fixative:

[0138]

[0139] (1) Collect fresh cotton anthers, cut them with scissors, and immediately immerse them in FAA fixative.

[0140] (2) Cut the paraffin block into small pieces, add them to a beaker, add an equal amount of ethanol, and heat to boil until the paraffin is completely dissolved.

[0141] (3) Remove the paraffin liquid, cool it to 50-55℃, add a drop of soap liquid, and mix thoroughly.

[0142] (4) Take out the anthers and soak them in 75% ethanol for 10 minutes, then treat them with 95% ethanol for 10 minutes, and then treat them with anhydrous ethanol for 10 minutes.

[0143] (5) Place the anther on a glass slide, place it in paraffin solution so that it is completely immersed, and cool it to room temperature.

[0144] (6) Solidify the paraffin, take out the glass slide with slide forceps, and cut the anther and paraffin into thin slices with a razor blade.

[0145] (7) Rinse the sections in water to remove the paraffin.

[0146] (8) Place the slice on a glass slide and heat it to make it adhere to the slide.

[0147] (9) Place the slide on a microscope and observe the cell structure of cotton anthers.

[0148] Paraffin sections of anthers after high temperature stress were observed, and the results showed normal development during meiosis (MC) and tetrad stage (TTP). During the mononuclear and dinuclear pollen period (UNP), pollen grains in the mutants were abnormal, with no cell wall structure, which led to no pollen grains in the anther cavity at the mature stage (MP). The pollen grains were deformed and the plants were sterile, while WT anthers were normal. The above results indicate that the Gh4CL7 mutant has abnormal pollen wall synthesis after high temperature stress, resulting in pollen abortion.

[0149] 2.12 Determination of yield of wild-type and transgenic plants, such as Figure 3 .

[0150] Field plot tests were conducted on wild-type and Gh4CL7 transgenic materials in the test field to investigate relevant indicators such as seed cotton weight, lint cotton weight, single boll weight, lint percentage and per-acre yield, and to study the impact of high temperature stress on yield. The results showed that the bolls of wild-type plants developed well, while the bolls of knockout materials developed abnormally, with fewer effective bolls, and the seed cotton weight and lint weight were significantly reduced compared with the wild type. Therefore, the knockout of the 4CL7 gene significantly affected the yield of cotton under high temperature stress, further illustrating the important role of the Gh4CL7 gene in regulating high temperature fertility of cotton.

[0151] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. Gh4CL7 Application of genes in breeding cotton varieties with enhanced or reduced high temperature fertility, the Gh4CL7 The gene has the nucleotide sequence shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The nucleotide sequence shown in SEQ ID NO: 1 can encode the amino acid sequence shown in SEQ ID NO:

2.

3. The use according to any one of claims 1 or 2, characterized in that: By reducing the expression level or activity of the gene in cotton, the fertility of cotton is reduced under high temperature.

4. The use according to claim 3, characterized in that: By knocking out cotton endogenous Gh4CL7 Genes to achieve.

5. The use according to claim 4, characterized in that: The plant editing vector containing the gene is used to transform the gene into cotton through Agrobacterium-mediated transformation to obtain transformed plants.

6. The use according to claim 5, characterized in that: Further, homozygous cotton varieties with reduced fertility at high temperatures are obtained through screening and self-pollination, or hybrid varieties with reduced fertility at high temperatures are obtained through hybrid breeding.

7. The use according to any one of claims 1 or 2, characterized in that: By increasing the expression level or activity of the gene in cotton, the fertility of cotton under high temperature is improved.

8. The use according to claim 7, characterized in that The plant expression vector containing the gene is used to transform the gene into cotton through Agrobacterium-mediated transformation to obtain transformed plants.

9. A method for breeding cotton varieties with enhanced or reduced high temperature fertility, characterized in that: Using a plant editing vector containing the gene, the vector is transformed into cotton through Agrobacterium-mediated transformation to obtain a transformed plant; Or by increasing the expression level or activity of the gene in cotton, so as to improve the fertility of cotton under high temperature; Further, homozygous cotton varieties with reduced or improved fertility at high temperatures are obtained through screening and self-pollination, or hybrid varieties with reduced or improved fertility at high temperatures are obtained through hybrid breeding.

10. The method according to claim 9, characterized in that The high temperature refers to the plant growth temperature exceeding 37°C in the field. The indoor high temperature treatment is 37°C treatment for 16 hours and 31°C treatment for 8 hours, simulating the field growth temperature.

Images