Novel single-cell CRISPR screening library

Abstract

The invention discloses a novel single-cell CRISPR screening library. The invention provides a double-gRNA expression cassette, a double-gRNA expression cassette vector for single-cell CRISPR (clustered regularly interspaced short palindromic repeats) screening and a construction method of a single-cell CRISPR screening library. According to the CRISPR screening library constructed by the method, the single-cell CRISPR screening range can be expanded from a protein coding gene to ncRNA, and the ncRNA can be knocked out.

Description

Technical Field

[0001] The present invention relates to the field of gene screening technology, and in particular, to a method for constructing a novel single-cell CRISPR screening library. Background Art

[0002] CRISPR screening technology refers to the introduction of a large number of gRNAs and recombinant Cas9 proteins of Streptococcus pyogenes into cells, followed by the determination of specific gene manipulation results through genome sequencing, transcriptome sequencing or single-cell transcriptome sequencing, thereby establishing a connection with the phenotype of the cell and exploring the function of the gene in a high-throughput manner. The specific principle is that gRNA will bind to the recombinant Cas9 protein of Streptococcus pyogenes (~160KD) to form a nucleic acid-protein complex, and the gRNA will use the principle of sequence complementarity to guide the complex into the genome, and then the complementary sequence will be excised. After excision, the non-homologous end recombination repair in the body will produce mutations, causing the open reading frame of the gene to shift, resulting in a frameshift mutation in the gene, encoding a non-functional protein, and ultimately achieving gene knockout.

[0003] Currently, CRISPR gene screening is the main method for high-throughput research on the role of genes or other elements in life processes. However, due to the strong heterogeneity of stem cells, the resolution should be increased to the single-cell level to study the role of these elements in the fate determination process of stem cells. However, the current single-cell CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) screening is based on a single gRNA (guide RNA) system, so it can only knock out protein-coding genes, but cannot study the role of lncRNA (long non-protein-coding genes) and non-coding sequences in life processes.

[0004] The single-cell CRISPR screening currently developed is mainly CROP-seq (CRISPR Droplet sequencing, droplet-mediated CRISPR screening sequencing) and perturb-seq (interference sequencing). Both methods are gene screening systems mediated by a single gRNA system, which cannot study the functions of lncRNA, miRNA (microRNA), non-coding sequences and other components. However, the CRISPRi (CRISPR interference) technology currently used to study lncRNA and miRNA still cannot be improved to the single-cell accuracy and cannot achieve single-cell level gene screening. In addition, due to the large size of the viral plasmid, the virus is very difficult to package, resulting in low virus titer and high economic cost in the experiment. Therefore, it is of great significance to provide a new single-cell CRISPR screening technology that can study the functions of lncRNA, miRNA (microRNA), non-coding sequences and other components. Summary of the invention

[0005] In order to make up for the deficiencies of the prior art, the purpose of the present invention is to provide a novel single-cell CRISPR screening library for studying the function of ncRNA (non-coding RNA).

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] The first aspect of the present invention provides a dual gRNA expression cassette.

[0008] Furthermore, the dual gRNA expression cassette includes a first gRNA expression cassette and a second gRNA expression cassette.

[0009] Furthermore, the first gRNA expression cassette comprises a macU6 promoter, a gRNA1 placeholder sequence, a new scaffold and a Terminator in sequence from 5' to 3'.

[0010] Furthermore, the second gRNA expression cassette includes a U6 promoter, a gRNA2 placeholder sequence, a second scaffold and a Terminator in sequence from 5' to 3' direction.

[0011] Furthermore, the sequence of the macU6 promoter is shown in SEQ ID No: 1; the sequence of the new scaffold is shown in SEQ ID No: 2; and the sequence of the Terminator is tttttt.

[0012] Furthermore, the sequence of the U6 promoter is shown in SEQ ID No:4; and the sequence of the second scaffold is shown in SEQ ID No:5.

[0013] Further, the promoter sequences of the first gRNA expression cassette and the second gRNA expression cassette are in operable connection with the gRNA placeholder sequence.

[0014] In the present invention, the term "gRNA", also known as "guide RNA", generally refers to an RNA sequence or molecule (or a set of RNA molecules) that can bind to a Cas protein and help target the Cas protein to a specific position within a target polynucleotide (e.g., DNA or RNA). The guide RNA may include a crRNA segment and a tracrRNA segment. As used herein, the term "crRNA" or "crRNA segment" refers to an RNA molecule or a portion thereof, which includes a guide sequence, a stem sequence, and optionally a 5' overhang sequence targeting a polynucleotide. The term "tracrRNA" or "tracrRNA segment" refers to an RNA molecule or a portion thereof including a protein binding segment (e.g., a protein binding segment that can interact with a CRISPR-associated protein (e.g., Cas9)). The term "guide RNA" also encompasses single guide RNA (sgRNA), wherein the crRNA segment and the tracrRNA segment are located in the same RNA molecule. The term "guide RNA" also includes a group of two or more RNA molecules together, wherein the crRNA segment and the tracrRNA segment are located in separate RNA molecules.

[0015] In the present invention, the gRNA placeholder or gRNA placeholder sequence is understood to be a randomly selected gRNA sequence, which is intended to be replaced by a pair of gRNA sequences designed according to the target gene of the study. In addition to random gRNA sequences, any other random sequences can also be used. There are n double gRNA sets in the double gRNA expression cassette, and the n double gRNA sets are designed for n different target genes. A pair of gRNAs in the double gRNA set for a target gene are respectively located in the first gRNA expression cassette and the second gRNA expression cassette.

[0016] In some embodiments, in each gRNA expression cassette, the RNA promoter sequence and the gRNA placeholder sequence are in operable connection, which should be understood such that when a gRNA sequence is introduced into the placeholder according to the present invention, the gRNA sequence is expressed under the control of the RNA promoter sequence.

[0017] In the present invention, the term "promoter" is understood to refer to a regulatory sequence / element or control sequence / element that is capable of binding / recruiting RNA polymerase and initiating transcription of sequences downstream or in the 3' direction from the promoter. The promoter can be, for example, constitutively active, or always on or inducible, wherein the promoter is active or inactive in the presence of an external stimulus. Examples of RNA promoters include h7SK, T7 promoter or U6 promoter. In a specific embodiment of the present invention, the promoter is U6 promoter and macU6 promoter (human U6 promoter).

[0018] In some embodiments, the length of the guide RNA (gRNA) encoding sequence is at least 10 nucleotides to 200 nucleotides, more preferably 10 to 50, more preferably 10 to 30, more preferably 15 to 30, more preferably 15 to 25, most preferably 17 to 23, and even more preferably about 20 nucleotides in length.

[0019] A second aspect of the present invention provides a dual gRNA expression cassette vector for single-cell CRISPR screening.

[0020] Furthermore, the vector comprises the dual gRNA expression cassette described in the first aspect of the present invention.

[0021] Furthermore, the vector also contains a lentiviral CROP-seq vector backbone carrying PuroR-P2A-GFP.

[0022] Furthermore, the first gRNA expression cassette is located at the front end of the EF1A sequence of the lentiviral CROP-seq vector backbone; the second gRNA expression cassette is located 155 bp from the rear end of the WPRE sequence of the lentiviral CROP-seq vector backbone.

[0023] Furthermore, the backbone of the lentiviral CROP-seq vector carrying PuroR-P2A-GFP is a LentiCROP-PuroR-P2A-GFP-U6 plasmid.

[0024] In the present invention, in order to expand the scope of single-cell CRISPR screening from protein-coding genes to ncRNA (non-coding RNA), such as lncRNA, miRNA, etc., the applicant modified the lentiviral system based on the CROP-seq vector backbone, optimized the gRNA expression cassette and inserted a new gRNA expression cassette, thereby achieving CRISPR screening at the single-cell level without affecting the virus yield.

[0025] A third aspect of the present invention provides a cell.

[0026] Furthermore, the cell comprises the dual gRNA expression cassette described in the first aspect of the present invention or the dual gRNA expression cassette vector described in the second aspect of the present invention.

[0027] In the present invention, there is no particular limitation on the cells, which may be prokaryotic cells or eukaryotic cells, for example, but not limited to, various eukaryotic cells or prokaryotic cells commonly used in the art, for example, K562 cells, Jurkat cells, HEK293T cells, yeast cells, Escherichia coli cells, etc.

[0028] A fourth aspect of the present invention provides a method for constructing a single-cell CRISPR screening library.

[0029] Furthermore, the method comprises: packaging the dual gRNA expression cassette vector described in the second aspect of the present invention with a lentivirus and infecting target cells.

[0030] Furthermore, the method includes: first, splicing the designed and synthesized n pairs of gRNAs into the first gRNA expression cassette and the second gRNA expression cassette described in the first aspect of the present invention, respectively, where n is an integer greater than or equal to 1; then, assembling the spliced ​​first gRNA expression cassette into the front end of the EF1A sequence of the LentiCROP-seq vector backbone LentiCROP-PuroR-P2A-GFP-U6 plasmid, and assembling the spliced ​​second gRNA expression cassette into the 155 bp at the rear end of the WPRE sequence of the LentiCROP-seq vector backbone LentiCROP-PuroR-P2A-GFP-U6 plasmid.

[0031] Furthermore, the MOI of the infected target cells is 250-300.

[0032] Preferably, the method further comprises sequencing to detect whether the n pairs of gRNAs are correctly combined into the first gRNA expression cassette and the second gRNA expression cassette.

[0033] Preferably, the method for splicing gRNA into the gRNA expression cassette is the Gatway method.

[0034] Preferably, the method for assembling the first gRNA expression cassette and the second gRNA expression cassette into the LentiCROP-PuroR-P2A-GFP-U6 plasmid is the Gibson assembly technique.

[0035] In the present invention, gRNA can be ordered from a commercial platform or designed and synthesized by oneself according to the research purpose. The present invention is not limited to the source of gRNA.

[0036] In the present invention, the applicant optimized the lentiviral infection conditions to ensure that one virus enters one cell (i.e., to ensure that only one pair of gRNA enters one cell) when packaging the lentivirus to infect the target cells, and found that when the MOI is 250-300, only one pair of gRNA can be packaged into one cell, thereby achieving screening at the single-cell level.

[0037] In the present invention, the Gateway method is based on the principle of site-specific recombination, allowing researchers to efficiently and flexibly transfer DNA fragments between different vectors. The core of this method is to use the site-specific recombination system of λ phage, especially the Int integrase and Xis auxiliary protein to catalyze the recombination between DNA fragments at specific sites (i.e., att sites).

[0038] The Gateway system uses two types of att sites - attB and attP. The attB site is located on the entry vector, while the attP site is located on the destination vector. Both sites contain a specific DNA sequence, which is the recognition site of Int integrase. In the BP reaction (BP Clonase Reaction), Int integrase and Xis auxiliary protein catalyze the recombination between the attB site and the attP site, generate attL and attR sites, and transfer the DNA fragment on the entry vector to the destination vector. This reaction is unidirectional, that is, it can only go from attB to attL / attR. In the LR reaction (LR Clonase Reaction), the same enzyme catalyzes the recombination between the attL site and the attR site, generates attB and attP sites, and may transfer DNA fragments from one vector to another. This reaction is also unidirectional, but the direction is opposite to the BP reaction.

[0039] In the present invention, the Gibson assembly technique uses T5 exonuclease to cut from the 5' end of the DNA fragment to produce single-stranded DNA end pairing to form circular DNA with gaps. Phusion DNA polymerase fills the gaps to produce circular DNA with only nicks.

[0040] Taq DNA ligase repairs the nick to obtain a complete double-stranded DNA plasmid.

[0041] A fifth aspect of the present invention provides a library for single-cell sequencing.

[0042] Furthermore, the library is constructed from the cell population obtained by the method described in the fourth aspect of the present invention.

[0043] The sixth aspect of the present invention provides any of the following applications.

[0044] Furthermore, the application includes:

[0045] 1) Use of the dual gRNA expression cassette vector described in the second aspect of the present invention in gene knockout;

[0046] 2) Application of the single-cell CRISPR screening library constructed by the method described in the fourth aspect of the present invention in studying gene function.

[0047] Furthermore, the gene is ncRNA.

[0048] In the present invention, the term "ncRNA", also known as non-coding RNA, refers to RNA molecules that do not encode proteins. They play an important regulatory role in cells. ncRNA is a type of RNA that is not translated into protein. They directly participate in various biological processes in cells in the form of RNA. There are many types of ncRNA, including miRNA, lncRNA, circRNA, etc., each type has its specific function and mechanism of action. ncRNA mainly regulates biological processes such as gene expression, chromatin modification, and transcriptional regulation by interacting with DNA, RNA or protein. The expression of many ncRNAs is tissue- and cell-type-specific and is closely related to specific physiological and pathological processes. miRNA is a short endogenous non-coding RNA with a length of about 21-25 nucleotides. miRNA mainly regulates the expression level of target genes by binding to the 3'UTR region of the target mRNA, inhibiting its translation or promoting its degradation. They play an important role in cell differentiation, development, metabolism, proliferation, apoptosis, and tumorigenesis. lncRNA is a type of non-coding RNA with a length of more than 200 nucleotides. lncRNA participates in a variety of biological processes, such as chromatin modification, transcriptional regulation, ceRNA regulation, etc., and has a profound impact on gene expression and cell function. They play an important role in the occurrence and development of a variety of diseases, including cancer, cardiovascular disease, etc. : circRNA is a type of non-coding RNA with a circular structure, which is formed by a special splicing method. circRNA exists stably in cells and has potential regulatory effects, such as acting as a sponge for miRNA and participating in protein translation.

[0049] Advantages and benefits of the present invention:

[0050] The present invention transforms the lentiviral system based on CROP-seq, optimizes the gRNA expression cassette and inserts a new gRNA expression cassette, and realizes CRISPR screening at the single-cell level without affecting the virus yield. This method can expand the scope of single-cell CRISPR screening from protein-coding genes to lncRNA, miRNA, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 It is a schematic diagram of the structure of the first gRNA expression cassette system in the LentiCROP-PuroR-P2A-GFP-U6 plasmid;

[0052] Figure 2 This is a schematic diagram of the structure of the dual gRNA expression cassette vector provided by the present invention;

[0053] Figure 3 This is the gRNA sequencing distribution map;

[0054] Figure 4 This is the knockout result diagram of HBBP1 gene at DNA level;

[0055] Figure 5 This is the knockout result diagram of HBBP1 gene RNA level;

[0056] Figure 6 Flow chart of experimental verification of the feasibility of single-cell screening by the dual gRNA expression cassette vector provided by the present invention;

[0057] Figure 7 This is a graph of infection results under normal conditions;

[0058] Figure 8 This is the infection result diagram after the first optimization condition;

[0059] Fig. 9 This is the infection result diagram after the second optimization condition;

[0060] Fig.10 This is the result of cell apoptosis detection after the second optimization condition;

[0061] Fig.11 Single-cell sequencing results;

[0062] Fig.12 This is the quality control diagram of the knockout effect of the dual gRNA single-cell CRISPR library;

[0063] Fig.13 This is a result diagram of candidate pseudogenes related to hematopoietic stem / progenitor cell proliferation and apoptosis. DETAILED DESCRIPTION

[0064] In order to enable those skilled in the art to better understand the scheme of the present invention, the technical scheme of the present invention will be further described in detail below in combination with the embodiments of the present invention and the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0065] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present invention can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0066] Example 1 Construction of the first gRNA expression cassette

[0067] 1. Experimental Materials

[0068] LentiCROP-PuroR-P2A-GFP-U6 (China Zhuangmeng Biotechnology, Plasmid #200029), Gibson seamless ligation kit (China Xinhai Gene, Cat. No.: D2601), Phanta ultra-high fidelity enzyme (China Novizan, P521-d1), px552-U6-gRNA1-U6-gRNA2-CMV-eGFP (China Zhuangmeng Biotechnology, #211760), BSMB1 V2 (US NEB, R0580).

[0069] 2. Experimental Methods

[0070] First, primers were designed and the U6-gRNA1-U6-gRNA2 sequence in the px552-U6-gRNA1-U6-gRNA2-CMV-eGFP plasmid was amplified using PCR technology to obtain the first gRNA expression cassette system. The first gRNA expression cassette system was inserted into the front end of the EF1A sequence in LentiCROP-PuroR-P2A-GFP-U6 using the Gibson seamless connection kit. The primer sequences used in the experiment are as follows:

[0071] macU6-gRNA1-F: gagggcctatttcccatgagtc (SEQ ID No: 5);

[0072] macU6-gRNA1-R: gataaaaaagcaccgactcggtg (SEQ ID No: 6);

[0073] U6-gRNA2-F: gagggcctatttcccatgattcc (SEQ ID No:7);

[0074] U6-gRNA2-R: tctagttacgccaagcttaaaaaagca (SEQ ID No: 8).

[0075] 3. Experimental Results

[0076] The sequencing results of the EF1A sequence front end of the first gRNA expression cassette system inserted into LentiCROP-PuroR-P2A-GFP-U6 are as follows Figure 1As shown. macU6, gRNA#1, new scaffold and Terminator are the sequences obtained by insertion after amplification. Among them, the sequence of macU6 is gagggcctatttcccatgagtccttcatatttgcatatacgatgcaagaatgttagagagataattagaattaatttggctataaacataaagatattagtacaaaatattgatgcagaa agtaataatttcttgggtagtttgtaattttaaaattatgttttaaaatggaccatgacatacttgccgtaagtgtaaagtatttctatttcttgcctttatatatcttctggcaagttaccaacaccg (seq ID No: 1); the new scaffold sequence is gtttcagagctatgctggaaactgcatagcaagttgaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc (SEQ ID No: 2); the Terminator sequence is tttttt.

[0077] Example 2 Construction of a dual gRNA expression cassette system

[0078] 1. Experimental Materials

[0079] Oligo gRNA (commissioned by Yunzhou Biotechnology Co., Ltd.), Gibson seamless ligation kit (China Xinhai Gene, Cat.No.: D2601), Phanta ultra-high fidelity enzyme (China Novizan, P521-d1), px552-U6-gRNA1-U6-gRNA2-CMV-eGFP (China Zhuangmeng Biotechnology, #211760), BSMB1 V2 (US NEB, R0580).

[0080] 2. Experimental Methods

[0081] Construction of the second gRNA expression cassette: The second gRNA expression cassette contains U6 promoter, gRNA2 placeholder sequence, second scaffold and Terminator. The sequence of the U6 promoter is gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattagaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccg (SEQ ID No: 3); the sequence of the second scaffold is gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc (SEQ ID No: 4); and the sequence of the terminator is tttttt.

[0082] Using the ncRNA collection of interest obtained from previous studies, the chromosomes in the genome of the ncRNAs in this collection, as well as the 5' start and 3' end, were determined. The chromosomal locations and 5' positions of these ncRNAs were imported into Cas-Designer (http: / / www.rgenome.net / cas-designer / ) to obtain the entire sequence of gRNA1. Subsequently, the chromosomal locations and 3' positions of all ncRNAs were imported into Cas-Designer to obtain the entire sequence of gRNA2, which was then synthesized in batches in the form of oligonucleotides. The entire sequence of gRNA1 and the entire sequence of gRNA2 were spliced ​​into the gRNA placeholder sequences of the first gRNA expression cassette and the second gRNA expression cassette using the Gatway method, and then sequencing was performed to detect whether gRNA1-gRNA2 were correctly combined into the expression cassette.

[0083] The dual gRNA expression cassette system was assembled into LentiCROP-PuroR-P2A-GFP-U6 using Gibson assembly technology. Specifically, the first gRNA expression cassette was assembled into the front end of the EF1A sequence in LentiCROP-PuroR-P2A-GFP-U6, and the second gRNA expression cassette was assembled into the missing region of the 3'LTR in LentiCROP-PuroR-P2A-GFP-U6, that is, 155bp at the rear end of the WPRE sequence. During the construction process of LentiCROP-PuroR-P2A-GFP-U6 plasmid, the 3'LTR region was hollowed out and the gRNA expression cassette was inserted. Using the self-integration ability of the lentivirus, the gRNA expression cassette will jump to the front of the EF1A position and the U6 promoter can recruit pol III to encode the gRNA for gene editing for gene editing. The second gRNA expression cassette in the 3'LTR will be included in the mRNA sequence encoded by pol II recruited by EF1A and detected by sequencing. Based on this, this patent inserts the first gRNA expression cassette before the EF1A sequence, and inserts the second gRNA expression cassette into the position of the gRNA expression cassette of the original plasmid. The above principle is used to express a pair of gRNAs (gRNA1, gRNA2) for gene editing. gRNA2 can be detected by sequencing to determine each pair of gRNAs entering the cell.

[0084] 3. Experimental Results

[0085] The gRNA fragment was inserted into the lentiviral backbone, and finally a first-step lentiviral library consisting of 5.5×10^5 single clones was obtained. The first-step library was used as a template to construct a sequencing library for next-generation sequencing. The sequencing library was sequenced using the PE150 sequencing strategy on an Illumina NovaSeq sequencer.

[0086] Analysis and comparison of sequencing results: Among the 3717 gRNA pairs designed, 3710 gRNA pairs were identified in the second-generation sequencing (coverage rate was 99.81%). Figure 3 As shown, the horizontal axis is the Log2 value of the Readcount of a single gRNA on the genome, and the vertical axis is the distribution density, that is, the distribution probability of each gRNA Readcount; it can be seen that the gRNAs in the plasmid library are between 2^6 and 2^10, which is relatively clustered, indicating that the probability of each pair of gRNA entering the cell is equal, and it can be ruled out that the subsequent phenotype is caused by the uneven distribution of gRNA pairs.

[0087] Example 3 Verification of knockout efficiency of dual gRNA expression cassette vector

[0088] 1. Experimental Materials

[0089] PEI reagent (Boaolong, China, KX010041), 293T cells, K562 cells, electrophoresis instrument, lentivirus titer ELISA detection kit (Boaolong, China, BF06203), qPCR related reagents.

[0090] 2. Experimental Methods

[0091] A pair of gRNAs (gRNA1: GGTTAAGGTGAGAAGGCTGG; gRNA2: AGGGTGGGTTGTGACTCCAG) were designed for the HBBP1 gene. The gRNAs were inserted into the double gRNA expression cassette vector plasmid according to the methods of Examples 1 and 2 above. The plasmids were then transfected into 293T cells for virus packaging, followed by lentiviral titer detection. The cells were infected at MOI 300, the integrity of the HBBP1 gene fragments in the cells was detected, and primers were designed on both sides of the target gene to obtain DNA sequences by PCR to determine whether the knockout at the DNA level was completed. At the same time, RNA was extracted, and the RNA level was determined to be successfully knocked out after reverse transcription.

[0092] 3. Experimental Results

[0093] The results of knocking out the HBBP1 gene at the DNA and RNA levels are shown in Figure 4 and Figure 5 As shown in Figure 2, the fragments of the HBBP1 gene became smaller at both the DNA level and the RNA level, indicating that the dual gRNA expression cassette vector system we constructed can function normally to complete gene knockout.

[0094] Example 4 Optimizing infection conditions to ensure that only one pair of gRNA enters a cell

[0095] 1. Experimental Materials

[0096] PEI reagent (Boaolong, China, KX010041), CD34 cells, centrifuge, polyberene, lentiviral library, and puromycin.

[0097] 2. Experimental methods and results

[0098] For the 684 pseudogenes found in previous studies that may be involved in the hematopoiesis process, 3-5 pairs of gRNAs were designed for each pseudogene to achieve the knockout of the entire fragment and observe the changes in the transcriptome level of stem cells and the changes in cell proliferation ability and differentiation preference to determine the role of this type of ncRNA in the hematopoiesis process. After the dual gRNA expression cassette vector was constructed using the methods of Example 1 and Example 2 to synthesize the CRISPR library, single-cell screening was performed in human hematopoietic stem / progenitor cells to verify the feasibility of the library.

[0099] With the informed consent of the volunteers, we obtained umbilical cord blood stem cells from the umbilical cord blood, added polybrene to the CD34 cells, and then added the lentiviral library 6 hours later to explore and optimize the infection conditions.

[0100] First, we explored the infection results under conventional infection conditions (MOI 30, 5ug / mL polybrene). Figure 7 As shown in the figure, under normal infection conditions, the infection rate will be too low. Since the gRNA plasmid contains GFP protein, the successfully infected cells will have green fluorescence, such as Figure 7 The conventional infection GFP+ ratio is only 9.6%, and the Cas9 protein infection efficiency is also very low, only 0.035%. Therefore, the conditions need to be optimized.

[0101] The first optimization conditions: The low efficiency of conventional infection may be due to the low probability of contact between the virus and the suspended cells. Therefore, the cells are centrifuged to the bottom by physical means, and the MOI is adjusted to increase the amount of virus, thereby increasing the probability of virus infection of cells. Therefore, during infection, the MOI of cas9 virus and gRNA virus are set to 300 (cas9) and gRNA (150) respectively, while ensuring that the polybrene concentration is 5ug / mL, centrifuged at 800g, 90min. Among them, the cas9 protein has puromycin resistance, and puromycin 1mg / ml concentration is used for screening for 12h. The results are as follows Figure 8 As shown, although GFP + There was no significant improvement in this experiment, but GFP + Cas9 in cells + The cell ratio increased to 50%.

[0102] Second infection condition optimization: The first optimization found that the gRNA positive rate was lower than the cas9 positive rate, indicating that the amount of gRNA virus was insufficient. In addition, by consulting the literature, it was found that stem cells need to add immunosuppressants during viral infection to increase the ability of the virus to integrate into cells. Therefore, based on the first optimization, the immunosuppressant CSH (cyclosporine H) was added and the amount of gRNA lentivirus was increased. The specific method is: CD34 + The cell culture medium was pre-stimulated with polybrene (5ug / mL) and CSH (working concentration 15uM) for 6h, and then the cas9 lentivirus with an MOI of 260 and the gRNA lentivirus with an MOI of 260 were added and centrifuged at 800g, 90min, 37℃, and the medium was changed after 16h. 36h after the medium change, the cells were screened with puromycin at a concentration of 1mg / ml for 12h. The results are shown in the figure. Fig. 9 As shown in the figure, it can be seen that after the second infection conditions are optimized, the infection efficiency can be significantly improved. GFP was measured 72 hours after infection + The infection efficiency is about 40%.

[0103] Cell apoptosis detection: Since excessive infection can lead to cell apoptosis, we performed flow cytometry to determine the cell apoptosis to exclude the possibility of cell apoptosis caused by excessive virus infection, which would affect the subsequent single-cell sequencing detection of molecular phenotypes. Annexin V is a Ca2+-binding protein with a molecular weight of 35-36 kDa. 2+ Annexin V is a phospholipid-dependent binding protein that can bind to PS with high affinity. Annexin V is labeled with fluorescein, and the occurrence of cell apoptosis can be detected using a flow cytometer or a fluorescence microscope. Propidium iodide (PI) is a dye that can bind to DNA. It cannot penetrate the intact cell membrane of normal cells or early apoptotic cells, but in cells in the middle and late stages of apoptosis and dead cells, PI can penetrate the cell membrane and dye the cell nucleus red. Therefore, when Annexin V is used in combination with PI, it can be used to identify living cells, apoptotic cells, and dead cells. The specific steps of the experimental operation are as follows: collect cells, take an appropriate amount of logarithmic growth phase cells and inoculate them in a 6-well plate, collect cells after treatment under corresponding conditions (such as drugs) for corresponding time, and pay attention to combining the supernatant and digested cells (Note: suspended cells can be directly centrifuged); wash cells, wash cells twice with pre-cooled PBS; group, each experiment is divided into unstained group, single-stained Annexin V group, single-stained PI group and PI and Annexin V double-stained group, and the treatment groups are double-stained from low to high; stain, dilute 4× binding buffer to 1× buffer with PBS, aspirate the residual PBS in the centrifuge tube, add 100μL of 1× binding buffer to each tube, blow the cells with a pipette to fully resuspend the cells, and add dye under light-proof conditions; no dye is added to the unstained group, 5μL of Annexin V or PI is added to the single-stained group, and Annexin V is added to the Annexin V and PI double-stained group Add 5 μL of 5% paraformaldehyde and 5 μL of PI, and mix gently with a pipette; incubate at room temperature in the dark for 15 minutes, add 300 μL of 1× binding buffer and mix, then transfer the cell suspension to a 5 mL flow tube in the dark, and detect on a flow cytometer within 1 hour.

[0104] Cell apoptosis detection results: After the cells were infected with the second optimized conditions, cell apoptosis was detected. The results are as follows Fig.10As shown, the upper left quadrant (UL) is (Annexin V- / PI+), which may be cell fragments without cell membrane, or dead cells caused by other reasons; Q2: the lower left quadrant (LL) is normal (live) cells (Annexin V- / PI-); Q3: the upper right quadrant (UR) is late apoptotic cells (Annexin V+ / PI+); Q4: the lower right quadrant (LR) is early apoptotic cells (Annexin V+ / PI-). According to the results of cell apoptosis, it can be determined that the CD34 + Most of the cells were in a living cell state and there was no apoptosis, indicating that the CD34 + The cells are in good condition. The subsequent molecular phenotype is caused by gene editing. CD34 cells were infected using the second optimized infection conditions. Puromycin selection was performed 2 days later (concentration was 1ug / mL) and the medium was changed after 12 hours. Flow sorting was performed 5 days later to obtain GFP + The results of single-cell sequencing are shown in Figure 2. Fig.11 As shown, the detection effect of gRNA in the cells of the gene-edited group on the 4th and 8th days (two control groups) and the gene-edited group on the 8th day was statistically analyzed. The U6-scaffold sequence of the second gRNA expression cassette was amplified and sequenced again by PCR to further detect the gRNA sequence in the cells. The results showed that gRNA was detected in most cells, indicating that the gRNA lentiviral library can be stably integrated into human hematopoietic stem cells after multiple optimizations. At the same time, it was determined that only one pair of gRNA entered most cells (since only gRNA2 can be detected by sequencing, only the corresponding gRNA2 is detected for each pair of gRNAs), indicating that most cell phenotypes are caused by the deletion of a fragment of ncRNA (pseudogene); Fig.12 This is a quality control chart of the knockout effect of the dual gRNA single-cell CRISPR library. By detecting the positive control group in the cells (the library contains 78 protein-coding genes, and the levels can be directly detected by transcriptome sequencing), the RNA expression of this part of protein-coding genes in the experimental group (+DOX / doxycycline group, induced cas9 expression for knockout) on the 8th day was significantly lower than the expression level of this part of ncRNA in the control group (-DOX / doxycycline not added group, cas9 is not expressed and cannot be knocked out); Fig.13This is a result chart of candidate pseudogenes related to hematopoietic stem / progenitor cell proliferation and apoptosis. The X-axis is the ratio of the frequency of cells in the knockout group on day 8 to the frequency of cells in the non-knockout group on day 4 for the same pair of gRNAs, and the Y-axis is the ratio of the frequency of cells in the non-knockout group on day 8 to the non-knockout group on day 4 for the same pair of gRNAs. Therefore, the first quadrant shows the enhanced cell proliferation ability after knocking out the ncRNA, and the third quadrant shows the cell apoptosis after knocking out the ncRNA. This screening yielded approximately 12 pseudogenes related to hematopoietic stem cell proliferation ability and 12 pseudogenes related to hematopoietic stem cell apoptosis.

[0105] In summary, we found that the vector system constructed using the dual gRNA expression cassette can achieve gene knockout, which proves that the system can work normally and can also be used for ncRNA screening at the single-cell level.

[0106] The above specific embodiments are merely explanations of the present invention and are not limitations of the present invention. After reading this specification, those skilled in the art may make modifications to the embodiments without any creative contribution as needed. However, such modifications are protected by the patent law as long as they are within the scope of the claims of the present invention.

Claims

1. A dual gRNA expression cassette, characterized in that: The dual gRNA expression cassette includes a first gRNA expression cassette and a second gRNA expression cassette; The first gRNA expression cassette comprises a macU6 promoter, a gRNA1 placeholder sequence, a newscaffold and a Terminator in sequence from 5' to 3' direction; The second gRNA expression cassette includes a U6 promoter, a gRNA2 placeholder sequence, a second scaffold and a Terminator in sequence from 5' to 3' direction.

2. The dual gRNA expression cassette according to claim 1, characterized in that The sequence of the macU6 promoter is shown in SEQ ID No: 1; the sequence of the new scaffold is shown in SEQ ID No: 2; the sequence of the Terminator is tttttt; The sequence of the U6 promoter is shown in SEQ ID No: 3; the sequence of the second scaffold is shown in SEQ ID No: 4; The promoter sequences of the first gRNA expression cassette and the second gRNA expression cassette are in operable connection with the gRNA placeholder sequence.

3. A dual gRNA expression cassette vector for single-cell CRISPR screening, characterized in that: The vector comprises the dual gRNA expression cassette according to any one of claims 1 to 2.

4. The dual gRNA expression cassette vector according to claim 3, characterized in that The vector also includes a lentiviral CROP-seq vector backbone carrying PuroR-P2A-GFP; The first gRNA expression cassette is located at the front end of the EF1A sequence of the lentiviral CROP-seq vector backbone; the second gRNA expression cassette is located at 155 bp of the rear end of the WPRE sequence of the lentiviral CROP-seq vector backbone; The backbone of the lentiviral CROP-seq vector carrying PuroR-P2A-GFP is a LentiCROP-PuroR-P2A-GFP-U6 plasmid.

5. A cell, characterized in that The cell comprises the dual gRNA expression cassette of any one of claims 1-2 or the dual gRNA expression cassette vector of any one of claims 3-4.

6. A method for constructing a single-cell CRISPR screening library, characterized in that: The method comprises: packaging the dual gRNA expression cassette vector according to any one of claims 3 to 4 with a lentivirus and infecting target cells.

7. The method according to claim 6, characterized in that The method comprises: firstly, splicing the designed and synthesized n pairs of gRNAs into the first gRNA expression cassette and the second gRNA expression cassette according to claim 1, respectively, wherein n is an integer greater than or equal to 1; then, assembling the spliced ​​first gRNA expression cassette into the front end of the EF1A sequence of the LentiCROP-seq vector backbone LentiCROP-PuroR-P2A-GFP-U6 plasmid, and assembling the spliced ​​second gRNA expression cassette into the 155 bp of the rear end of the WPRE sequence of the LentiCROP-seq vector backbone LentiCROP-PuroR-P2A-GFP-U6 plasmid.

8. The method according to claim 6, characterized in that The MOI of the infected target cells is 250-300.

9. A library for single-cell sequencing, characterized in that: The library is constructed from a cell population obtained by the method according to any one of claims 6 to 8.

10. Any of the following applications, characterized in that: The applications include: 1) Use of the dual gRNA expression cassette vector according to any one of claims 3 to 4 in gene knockout; 2) Application of the single-cell CRISPR screening library constructed by the method according to any one of claims 6 to 8 in studying gene function; The gene is ncRNA.

Images