A KASP molecular marker method related to peanut aflatoxin infection resistance and its application

Abstract

The present invention belongs to the field of molecular genetic breeding, specifically relating to a KASP molecular marker method and its application related to peanut kernel resistance to Aspergillus flavus infection. Through genome-wide association analysis, the present invention located a single nucleotide polymorphism (SNP) site significantly associated with peanut kernel resistance to Aspergillus flavus. This site is located at bp 133198521 on peanut chromosome B06 (the reference genome is Arachis nucifera), with a nucleotide sequence polymorphism of C / A (the antisense strand is G / T), and is named qARI_B06. Based on this SNP site, the present invention designed and developed KASP molecular marker primer sequences (SEQ ID NO. 1, SEQ ID NO. 2, and SEQ ID NO. 3) for rapid and accurate identification of peanut sample genotypes.

Description

Technical Field

[0001] The present invention relates to the field of molecular genetic breeding, and in particular to a KASP molecular marker method related to peanut aflatoxin infection resistance and an application thereof. Background Art

[0002] Aflatoxin (AFTs), highly toxic biotoxins produced by Aspergillus flavus and Aspergillus parasiticus, pose a significant threat. AFB1, one of the AFTs, is the most potent carcinogenic mycotoxin known, posing a serious threat to animal performance and human health. With rising global temperatures and increasing droughts, aflatoxin contamination is becoming an increasingly serious issue, a significant factor impacting food safety. As a globally important oilseed cash crop, the safe production of peanuts is crucial for ensuring a secure supply of edible oil. However, peanuts are susceptible to aflatoxin contamination, making the development of aflatoxin-resistant varieties a key challenge.

[0003] Traditional breeding methods rely primarily on phenotypic selection, which is time-consuming, inefficient, and difficult to accurately screen for peanut varieties with resistance to Aflatoxin. With the development of peanut genome analysis and sequencing technology, genome-wide association studies (GWAS) have become an effective means of identifying key crop genes and related genetic mechanisms. GWAS can analyze associations across the entire genome, revealing the genetic basis of important agronomic traits. However, there are few reports on loci associated with resistance to Aflatoxin infection in peanuts, which limits the application of molecular marker-assisted breeding.

[0004] In order to solve the above problems, the applicant proposed a KASP molecular marker method related to peanut aflatoxin infection resistance and its application. Summary of the Invention

[0005] The purpose of the present invention is to provide a KASP molecular marker method related to peanut aflatoxin infection resistance and its application, so as to solve the problems in the prior art.

[0006] To achieve the above objectives, the present invention provides the following technical solution: a KASP molecular marker method related to peanut aflatoxin infection resistance, characterized in that the molecular marker is based on a significant SNP site (named qARI_B06) at 133198521bp on peanut chromosome B06, whose nucleotide sequence polymorphism is C / A (antisense strand is G / T), located in the first exon of the candidate key gene AhZIP1, and KASP molecular marker primer sequences are developed, specifically shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.

[0007] Optionally, SEQ ID NO.1 is a forward primer, and its sequence is: AGGAGGTTTGAATTCATTGGCGT; SEQ ID NO.2 is a specific sequence reverse primer that binds to FAM fluorescence, and its sequence is: ACTCTCATTCTCTCACTTACAATCATGG; SEQ ID NO.3 is a specific sequence reverse primer that binds to HEX fluorescence, and its sequence is: ACTCTCATTCTCTCACTTACAATCATGT.

[0008] Optionally, the method includes the following steps:

[0009] Extract genomic DNA from peanut leaves;

[0010] The extracted genomic DNA was amplified by PCR using the KASP molecular marker primer sequences shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3;

[0011] Prepare PCR reaction system, where the total PCR reaction system is 5 μl, including 2.43 μl of genomic DNA, 2.5 μl of 2× KASP Master Mix, and 0.07 μl of KASP Assay Mix (primer mixed working solution);

[0012] Amplification was performed according to a specific PCR reaction program, and the PCR results were scanned and analyzed by a KASP fluorescence analyzer to determine the genotype of the peanut sample.

[0013] Optionally, the PCR reaction program is: step 1, 94°C, 15 min; step 2, 94°C, 20 s, 61~55°C gradient PCR, 1 min, decreasing 0.6°C each cycle, for 10 cycles; step 3, 94°C, 20 s, 55°C, 1 min, for 26 cycles; step 4, storage at 10°C.

[0014] Optional, including:

[0015] Using the KASP molecular marker to identify the genetic haplotype of the hybrid offspring individual plants;

[0016] According to the haplotype identified by amplification, the resistance type of the offspring individual plants is determined:

[0017] If the haplotype is AA, it indicates that the locus carried by the individual plant is the resistant type;

[0018] If the haplotype is CA, it indicates that the single plant carries a heterozygous locus, which can be screened and retained and haplotype screening can be performed again in the self-pollinated progeny;

[0019] If the haplotype is CC, it indicates that the locus carried by the single plant is aflatoxin susceptible type, and whether to retain the single plant can be selected according to breeding needs.

[0020] An application of a SNP site associated with resistance to aflatoxin infection in peanut kernels, characterized in that the method uses the KASP molecular marker described in claim 1 to detect the SNP site at 133198521bp on chromosome B06 in peanut samples through PCR amplification and fluorescence analysis. Beneficial effects

[0021] The purpose of this invention is to locate significant SNPs associated with aflatoxin resistance in peanut kernels through GWAS and develop KASP molecular markers based on these sites to enable rapid and accurate genotyping and improve the efficiency of breeding peanut varieties resistant to aflatoxin. The highlights of this invention are:

[0022] Precise positioning: GWAS was used to precisely locate SNP sites associated with peanut aflatoxin resistance across the entire genome.

[0023] Efficient markers: Design KASP primers based on the located SNP sites to develop efficient and economical KASP molecular markers.

[0024] Rapid identification: Use KASP typing technology to quickly and accurately identify the genotype of the peanut sample to be tested.

[0025] Breeding acceleration: Provide powerful tools for molecular marker-assisted selection to accelerate the breeding process of aflatoxin-resistant peanut varieties.

[0026] This study aims to identify significant single nucleotide polymorphism (SNP) sites associated with aflatoxin resistance in peanut kernels through GWAS and to develop KASP molecular markers based on these sites. KASP molecular markers are a molecular marker method based on competitive allele-specific PCR (Kompetitive Allele-Specific PCR) technology, offering advantages such as high throughput, low cost, and ease of use. Using KASP molecular markers, rapid and accurate identification of aflatoxin resistance in peanuts can be achieved, thereby improving the efficiency of peanut breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 A genome-wide association analysis of peanut kernel resistance to Aspergillus flavus infection;

[0028] Figure 2 Analysis of different haplotypes of SNP site B06_133198521 and the resistance index of peanut kernel to aflatoxin infection;

[0029] Figure 3 The KASP marker typing results in 43 peanut cultivars are shown. DETAILED DESCRIPTION

[0030] The following describes preferred embodiments of the present invention with reference to the accompanying drawings to make its technical content clearer and easier to understand. The present invention can be embodied in many different forms, and the scope of protection of the present invention is not limited to the embodiments mentioned herein.

[0031] In the drawings, components with identical structures are denoted by the same reference numerals, and components with similar structures or functions are denoted by similar reference numerals. The size and thickness of each component shown in the drawings are arbitrary and are not limited by the present invention. For clarity, the thickness of components in some places in the drawings is appropriately exaggerated. Example

[0032] This invention, through genome-wide association analysis of peanuts, has discovered a new significant SNP locus associated with peanut kernel resistance to Aspergillus flavus infection and developed and provided related KASP molecular markers and their applications. The technical solution is as follows:

[0033] In its first aspect, the present invention provides a significant single nucleotide polymorphism (SNP) site closely associated with peanut kernel resistance to Aspergillus flavus and its candidate gene. This key discovery was based on in-depth analysis and research of the peanut genome. The SNP site was precisely mapped at position 133198521 bp on chromosome B06 (the reference genome is Arachis nucifera). Its nucleotide sequence polymorphism is C / A (the antisense strand is G / T), and it has been named qARI_B06. This site is located within a critical 100 kb region, from 133148521 bp to 133248521 bp on chromosome B06. More specifically, this significant SNP site, B06_133198521, is located in the first exon of the candidate key gene AhZIP1 and contains a single nucleotide mutation, G->T, which converts the second amino acid of the AhZIP1 gene from alanine (A) to serine (S). This discovery provides important insights into the genetic mechanism of peanut kernel resistance to Aspergillus flavus.

[0034] Based on this critical SNP, the present invention further develops and provides practical KASP molecular marker primers. The specific sequences of these primers are listed in Table 1. They include the universal forward primer (SEQ ID NO. 1), the FAM fluorescence-binding sequence-specific reverse primer R1 (SEQ ID NO. 2), and the HEX fluorescence-binding sequence-specific reverse primer R2 (SEQ ID NO. 3). These carefully designed primers will play a crucial role in subsequent PCR amplification and genotyping processes.

[0035] Table 1 KASP molecular marker primers developed based on the peanut kernel aflatoxin infection resistance locus

[0036] ;

[0037] Secondly, the present invention proposes an efficient and accurate method for genotyping peanut kernel resistance to Aspergillus flavus infection. This method first requires the extraction of high-quality genomic DNA from peanut leaves. The extracted genomic DNA is then amplified by PCR using the carefully designed KASP-labeled primer sequences described above. The PCR amplification reaction system is meticulously prepared, with a total volume of 5 μl, including 2.43 μl of genomic DNA, 2.5 μl of 2× KASP Master Mix, and 0.07 μl of KASP Assay Mix (primer mix working solution). The primer mix working solution consists of a universal forward primer (F), a FAM-conjugated sequence-specific reverse primer (R1), a HEX-conjugated sequence-specific reverse primer (R2), and purified water. The PCR reaction program is crucial, including a pre-denaturation step (94°C, 15 minutes), a denaturation and annealing step (94°C, 20 seconds; gradient PCR from 61 to 55°C, 1 minute, for 10 cycles, decreasing the temperature by 0.6°C each cycle), a second denaturation and extension step (94°C, 20 seconds; 55°C, 1 minute, for 26 cycles), and finally storage at 10°C. After amplification, the PCR results are scanned and analyzed using the advanced KASP Pherastar fluorescence analyzer, providing accurate genotyping results.

[0038] Thirdly, the present invention further details the practical application value of the aforementioned KASP molecular marker in peanut breeding. When using the aforementioned KASP marker to identify genetic haplotypes in individual hybrid offspring, the aflatoxin resistance of the offspring can be determined based on the amplified haplotype. If the amplified haplotype of the offspring is AA (consistent with the aflatoxin-resistant parent and corresponding to the signal from reverse primer R2), it indicates that the locus carried by the offspring is resistant and has potential resistance to aflatoxin infection. If the amplified haplotype of the offspring is CA, it indicates that the offspring carries the heterozygous locus. Such offspring can be selected and retained, and subsequent haplotype screening can be performed again in self-pollinated offspring until homozygous offspring are obtained. If the amplified haplotype of the offspring is CC (consistent with the aflatoxin-susceptible parent and corresponding to the signal from reverse primer R1), it indicates that the offspring carries the aflatoxin-susceptible locus. During the breeding process, the selection of whether to retain the offspring can be based on actual needs. This application not only greatly improved the efficiency of breeding peanut varieties resistant to aflatoxin, but also brought a revolutionary breakthrough in the field of peanut breeding.

[0039] The successful completion of this invention benefited from the strong support and funding of the National Key R&D Program of China (2023YFD1202800).

[0040] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It is obvious to those skilled in the art that the present invention is not limited to the details of the above exemplary embodiments, and that the present invention can be implemented in other specific forms without departing from the spirit or essential characteristics of the present invention. Therefore, from all points of view, the embodiments should be regarded as illustrative and non-restrictive. The scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes that fall within the meaning and range of equivalents of the claims are included in the present invention. Any reference signs in the claims should not be construed as limiting the claim to which they relate.

[0041] In addition, it should be understood that although this specification is described in terms of implementation methods, not every implementation method contains only one independent technical solution. This narrative method of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment can also be appropriately combined to form other implementation methods that can be understood by those skilled in the art.

Claims

1. A KASP molecular marker primer set for identifying peanut kernel infection resistance by Aspergillus flavus, characterized in that: SEQ ID NO.1 is a forward primer, and its sequence is: AGGAGGTTTGAATTCATTGGCGT; SEQ ID NO.2 is a specific sequence reverse primer that binds to FAM fluorescence, and its sequence is: ACTCTCATTCTCTCACTTACAATCATGG; SEQ ID NO.3 is a specific sequence reverse primer that binds to HEX fluorescence, and its sequence is: ACTCTCATTCTCTCACTTACAATCATGT.

2. A method for identifying peanut kernel resistance to infection by Aspergillus flavus, comprising the following steps: Genomic DNA was extracted from peanut leaves; the extracted genomic DNA was amplified by PCR using KASP molecular marker primer sequences shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3; a PCR reaction system was prepared; amplification was performed according to a specific PCR reaction procedure, and the PCR results were scanned and analyzed using a KASP fluorescence analyzer to determine the genotype of the peanut sample.

3. A method for identifying the infection resistance of peanut kernels to Aspergillus flavus according to claim 2, wherein the PCR reaction procedure includes the steps of pre-denaturation, denaturation and annealing, re-denaturation and extension, and storage.

4. The method for identifying peanut kernel resistance to aflatoxin infection according to claim 2, further comprising using the KASP molecular marker to identify the genetic haplotype of hybrid offspring individual plants, and determining the type of aflatoxin infection resistance of the offspring individual plants based on the haplotype type.

Images