Primer group for auxiliary selection of high-grain-weight rice variety and application of primer group

Abstract

The invention provides a primer group for auxiliary selection of a high-grain-weight rice variety and application of the primer group, and relates to the technical field of plant genetic engineering. The primer group comprises a primer F1, a primer R1, a primer F2, a primer R2, a primer F3 and a primer R3, wherein the nucleotide sequences of the primers F1, R1, F2, R2, F3 and R3 are respectively shown as SEQ IN NO.1-SEQ IN NO.6; the correlation between the OsMADS18 and the rice grain weight is found for the first time, the OsMADS18 has double copies in rice with high thousand grain weight, three pairs of PCR primers are developed accordingly, the thousand grain weight of sample rice is judged according to the number of bands of PCR amplification products, and the method is easy and convenient to operate, visual in detection result, short in time consumption and capable of remarkably accelerating the rice breeding process.

Description

Technical Field

[0001] The invention relates to the technical field of plant gene engineering, in particular to a primer set for assisting in selecting high-grain-weight rice varieties and an application thereof. Background Art

[0002] Grain weight is an important yield component of rice and also one of the important factors affecting rice quality. As a typical quantitative trait regulated by multiple genes, rice grain weight is manipulated by a series of molecular regulatory mechanisms, and the network formed by the genes involved is very large and complex. At present, more than 30 grain weight-related genes have been cloned, and they all ultimately affect cell proliferation or expansion. According to the functional pathways involved in the cloned genes, they can be divided into G protein signaling, proteasome degradation pathways, transcriptional regulatory factors, and plant hormone biosynthesis or signal transduction pathways. Therefore, it is urgent to explore new grain weight regulatory genes with breeding value and clarify the grain weight regulation mechanism.

[0003] The applicant team previously identified a rice grain weight locus qGW7 (CN116411109 A) and located it within the range of approximately 333.3kb between 24,181,760..24,515,093 on rice chromosome 7. The patent found a SNP site (C / T) at position 24,259,747, but the qGW7 gene was not precisely located and its function was not verified, thus limiting the precise application of the gene.

[0004] Studies have found that overexpression of OsMADS18 in rice can induce early flowering and accelerate the formation of axillary bud meristem (“The strength and pattern of natural selection on gene expression in rice”, Michael D. Purugganan, Nature, 2020). The involvement of the OsMADS18 gene in the regulation of rice grain weight has not been reported. Summary of the invention

[0005] In response to the above problems, this application discovered for the first time the correlation between the copy number of the OsMADS18 gene and the grain weight of rice, and developed primers based on this for the creation and identification of rice seed resources.

[0006] Specifically, this application is implemented through the following technical solutions:

[0007] First, the present application provides a primer set for assisting in the selection of high-grain weight rice varieties, including an upstream primer F1 and a downstream primer R1 whose nucleotide sequences are shown in SEQ IN NO.1 and SEQ IN NO.2, respectively; an upstream primer F2 and a downstream primer R2 whose nucleotide sequences are shown in SEQ IN NO.3 and SEQ IN NO.4, respectively; and an upstream primer F3 and a downstream primer R3 whose nucleotide sequences are shown in SEQ IN NO.5 and SEQ IN NO.6, respectively.

[0008] Secondly, the present application provides the application of the above primer set in assisting the selection of high-grain-weight rice varieties. That is, using rice sample leaves as templates, using the above primer set as primers, PCR amplification is performed respectively, and the amplified products are detected by electrophoresis. The thousand-grain weight of the rice sample with two electrophoresis bands is significantly higher than that of the rice sample with only one band.

[0009] PCR amplification system: 50 μg / μL DNA template 2 μL, 2 pmol / μl upstream primer 2 μL, 2 pmol / μl downstream primer 2 μL, 2×Phanta Max Master Mix 25 μl, ddH2O 19 μL, a total of 50 μL;

[0010] PCR amplification program: denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min, and storage at 4°C.

[0011] This application discovered for the first time the correlation between the copy number of the OsMADS18 gene and the grain weight of rice, and based on this, developed three pairs of PCR primers to judge the thousand-grain weight of the sample rice by the number of bands of the PCR amplification product. This method is easy to operate, has intuitive test results, and is time-saving, which can significantly accelerate the rice breeding process. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Schematic representation of the fine positioning results of qGW7;

[0013] Among them, A is the GWAS analysis of qGW7 in the F2 segregation population constructed by the high-grain reintroduction line NIL7 and the low-grain reintroduction line NIL2, and B is the fine positioning of the qGW7 locus.

[0014] Figure 2 Verification of the copy number of the 20kb repeat fragment within the localization interval and analysis of the target gene expression level;

[0015] Among them, A is the sequence structure of the target interval of 50.8kb of the high-grain weight introduction line NIL7, the low-grain weight introduction line NIL2 and the control W030; B is a schematic diagram of the genome and amino acid structure of the candidate gene (LOC_Os07g41370) in the 20kb sequence; C is the expression level analysis of the candidate gene of the high-grain weight introduction line NIL7, the low-grain weight introduction line NIL2 and the control W030; D is that the individuals carrying two copies in the population are high-grain weight materials, while the individuals carrying a single copy are low-grain weight materials.

[0016] Figure 3 Mutation types and grain weight performance of OsMADS18 editing mutants;

[0017] Among them, A is the genomic structure, target site and mutation type of OsMADS18 in the mutant family; B is the protein structure of OsMADS18 in the mutant family; C is the grain weight analysis of the mutant family.

[0018] Figure 4 The results of the thousand-grain weight test of the BC3F2 strain carrying two copies of qGW7;

[0019] Among them, A is the grain weight performance of the qGW7 double copy line of CK1 (Nanjing 46 background); B is the grain weight performance of the qGW7 double copy line of CK2 (Yangxiangyu 200 background); C is the grain weight performance of the qGW7 double copy line of CK3 (Huruan 1212 background). DETAILED DESCRIPTION

[0020] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are conventional commercial products unless otherwise specified.

[0021] The abbreviations and terms involved in the embodiments are defined as follows:

[0022] KASP: competitive allele-specific PCR.

[0023] CDS: coding sequence.

[0024] NIL: Near-isogenic line.

[0025] GWAS: genome-wide association study.

[0026] Nanjing 46, Huruan 1212, Ningjing 7 (W030), Gumei 4, and Nipponbare involved in the examples are all conventional rice varieties, collected and preserved by the applicant's laboratory.

[0027] The high-grain reintroduction line NIL7 and the low-grain reintroduction line NIL2 used in the examples are disclosed in Chinese patent CN116411109A, and are constructed from Gumei No. 4 (Pigm) as a donor, with 10 japonica rices, including Huajing No. 5, Yangjing 687, Huaidao No. 5, Xudao No. 9, Xudao No. 12, Wuyunjing 24, Nanjing 9108, Hongguangjing No. 1, Sidao 1167, and Yangjing 5118, included in the National Rice Data Center, as recurrent parents. The agronomic traits are similar to those of the recurrent parents and are homozygous for the Pigm gene. NILs.

[0028] Example 1 Fine Mapping of the Grain Recombinant Gene qGW7

[0029] 1.1 Fine positioning of qGW7

[0030] In order to verify and isolate the qGW7 regulatory site, this example hybridized the high-grain-weight introgression line NIL7 with the low-grain-weight introgression line NIL2 to obtain an F2 segregating population. GWAS was performed on the grain weight of each plant in the F2 population, and the presence of a new site qGW7 was detected on chromosome 7 of rice ( Figure 1 A), confirming the authenticity of the grain weight locus. Subsequently, the third-generation HiFi sequencing was used to complete the assembly of high-quality genomes of high- and low-grain weight introduction lines and the control W030. Based on the constructed fine physical map of the third-generation high-grain weight genome, individual plants with heterozygous genotypes in the positioning interval were screened and then mixed, and the F3 and F4 generations were obtained in turn. Subsequently, 4212 F3 and 5021 F4 segregating populations were screened for exchange of individual plants and investigated for individual plant grain weight. By constructing a fragment iteration group, qGW7 was finally located within 50.8kb, as shown in Figure 1. Figure 1 As shown in B.

[0031] 1.2 Identification of candidate genes for qGW7

[0032] Comparing the sequence differences in the 50.8 kb interval between the high-grain weight material NIL7, the low-grain weight material NIL2, and the three-generation genome of W030 and the reference genome of Nipponbare, it was found that there were two duplications of sequence fragments of about 20 kb in NIL7, while there was only one copy in NIL2, W030 and Nipponbare ( Figure 2 (shown in A).

[0033] Gene function annotation analysis revealed that the single copy sequences in NIL2, W030, and Nipponbare contained only one MADS-box transcription factor OsMADS18 (LOC_Os07g41370), while NIL7 contained two repeats of the OsMADS18 gene ( Figure 2The full length of OsMADS18 gene is 5409 bp (as shown in SEQ ID NO.9), the CDS coding region sequence is 750 bp long, and the nucleotide sequence is shown in SEQ ID NO.10.

[0034] Further expression level analysis revealed that the expression level of OsMADS18 gene was comparable in W030 and low-grain weight material NIL2, but significantly increased in high-grain weight material NIL7 ( Figure 2 (shown in C). It was further inferred that the MADS-box transcription factor OsMADS18 was a candidate gene for qGW7.

[0035] According to the third-generation genome sequences of NIL7 and NIL2, this embodiment developed three pairs of specific amplification primers (upstream primer F1 / downstream primer R1, upstream primer F2 / downstream primer R2, upstream primer F3 / downstream primer R3, whose nucleotide sequences are shown in Table 1), extracted rice leaf DNA as a template, and performed PCR detection respectively.

[0036] PCR amplification system: 50 μg / μL DNA template 2 μL, 2 pmol / μl upstream primer 2 μL, 2 pmol / μl downstream primer 2 μL, 2×Phanta Max Master Mix 25 μl, ddH2O 19 μL, a total of 50 μL;

[0037] PCR amplification procedure: 95℃ denaturation for 3min; 95℃ denaturation for 15s, 58℃ annealing for 15s, 72℃ extension for 1min, 35 cycles; 72℃ extension for 10min, 4℃ storage. The amplified product was detected by gel electrophoresis. The electrophoresis results are as follows: Figure 2 As shown in D.

[0038] Combining the PCR detection and product sequencing of the above three sets of primers, it was further confirmed that there was only one copy in W030, Nipponbare, Gumei No. 4 and low-grain weight materials, while there were 2 copies in high-grain weight materials. Combined with the copy number analysis under the above different backgrounds, this double-copy fragment (hereinafter referred to as qGW7 double copy) is a rare grain weight-related material with important breeding value.

[0039] In addition, this example uses fluorescent quantitative primers of the OsMADS18 gene (OsMADS18-F1 / OsMADS18-R1, the specific nucleotide sequence is shown in Table 1), and it is found that the expression level of OsMADS18 in W030 and low-grain weight materials is similar, while the expression level of OsMADS18 in high-grain weight materials is significantly increased ( Figure 2 (as shown in C).

[0040] Table 1 Primer sequences used for copy number verification and fluorescence quantification

[0041]

[0042]

[0043] Example 2 Construction of CRISPR / Cas9 vector for rice OsMADS18 gene and identification of transgenic plants and investigation of grain weight

[0044] 1. Construction of gene editing vector

[0045] According to the OsMADS18 genome sequence (SEQ IN NO.9), this example combines CRISPR-P2.0 (http: / / crispr.hzau.edu.cn / CRISPR2 / ) of Huazhong Agricultural University to design and synthesize specific sgRNA to ensure that it can specifically recognize and guide the Cas9 enzyme to the target sequence of the OsMADS18 gene. The sgRNA target sequence is GCAACTCTTAGGTGAACAAT (SEQ IN NO.11), targeting the third exon of the OsMADS18 gene, and the PAM sequence TGG is located at the 3' end of the target sequence.

[0046] The sgRNA designed in this example consists of sgRNA-F and sgRNA-R; the nucleotide sequence of sgRNA-F (SEQ IN NO. 12): 5'-GGCAGCAACTCTTAGGTGAACAAT-3'; the nucleotide sequence of sgRNA-R (SEQ IN NO. 13): 5'-AAACATTGTTCACCTAAGAGTTGC-3'. The synthesized sgRNA forward and reverse primers were annealed into double-stranded sgRNA containing sticky end adapters using a PCR instrument, and then ligated with the pRGEB32 vector fragment that had been digested with BsaⅠ using T4 ligase at 16°C overnight. The recombinant expression vector was heat-shock transformed into DH5α Escherichia coli competent cells. After overnight culture at 37°C in LB solid medium containing kanamycin, single clone colonies were picked and PCR was performed to verify and identify positive clones (sequencing primers were UBI-2 (SEQ IN NO. 14): 5'-CTTGGATGATGGCATATGC-3'; NOS-R (SEQ IN NO. 15): 5'-GATAATCATCGCAAGACCGG-3'). The positive plasmid with correct sequencing was selected (commissioned by Wuhan Transduction Biological Laboratory), indicating that the CRISPR / Cas9-OsMADS18 gene editing vector was successfully constructed.

[0047] 2. Genetically modified plants

[0048] The positive plasmid sequenced correctly in step 1 was electroporated into EHA105 Agrobacterium competent cells, and then the CRISPR / Cas9-OsMADS18 gene editing vector was transformed into the callus tissue of the japonica rice recipient variety W030 through Agrobacterium-mediated transformation. After 4 months of genetic transformation, a total of 13 T0 generation transgenic seedlings were obtained.

[0049] After one week of hardening at room temperature, the seedlings were transplanted into the field. When the plants were strong, PCR amplification of the transgenic plants was performed using hygromycin primers Hyg-F (SEQ IN NO. 16): 5'-TATTGCATCTCCCGCCGTGC-3'; Hyg-R (SEQ IN NO. 17): 5'-AGCGCGTCTGCTGCTCCATA-3' to screen the positive strains with successful transformation.

[0050] Subsequently, in order to identify the editing of the gene target of the positive transgenic plants, the specific detection primer set OsMADS18-F2 / OsMADS18-R2 was designed on both sides of the target sequence in this example, OsMADS18-F (SEQ IN NO. 18): 5'-ACGAAGGGAGTAATGTGGA-3; OsMADS18-R (SEQ IN NO. 19): 5'-GTGGCTTCTCGTTAGTTCC-3'. The genomic DNA of the control and transgenic positive seedlings was extracted, and PCR amplification and sequencing were performed using the target gene detection primers.

[0051] The sequencing results showed that among the 13 positive seedlings, 7 had homozygous mutations. The types of mutations included base insertion, deletion and substitution, which led to protein translation frameshift and premature termination of transcription. The specific mutations are shown in Figure 3 As shown in A and B.

[0052] The 7 homozygous plants were further grown to the T2 generation to obtain homozygous strains. After the rice matured, the grains of the wild type and Cas mutant strains were collected and placed in a 60°C drying oven to a constant weight. The thousand-grain weight was measured. The test results were as follows: Figure 3 As shown in C, under the W030 background, the grain weight of the seven families with different mutation types decreased significantly. The above experiments show that the targeted mutation of the OsMADS18 gene can significantly affect the grain weight of rice.

[0053] Example 3 Creation of qGW7 double copy introduction lines in different backgrounds

[0054] In this example, high-quality japonica rice varieties (Nanjing 46, Yangxiangyu 200, Huruan 1212) from different ecological zones in Jiangsu were used as recipients, and backcrossed with high-grain weight NIL7 three times in Hainan and Yangzhou, respectively. The three sets of primers developed in Example 1 were used for PCR detection to screen the progeny with double copies, and BC3F2 strains carrying double copies of qGW7 under the background of Nanjing 46, Yangxiangyu 200, and Huruan 1212 were obtained. The thousand-grain weight test was performed on them, and the results are as follows: Figure 4 It can be seen that the introduction of two copies of qGW7 can significantly increase the grain weight in different backgrounds.

[0055] The above embodiments are the best implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. A primer set for assisting selection of high-grain-weight rice varieties, characterized in that: The primer set consists of an upstream primer F1 and a downstream primer R1 whose nucleotide sequences are shown in SEQ IN NO.1 and SEQ IN NO.2 respectively; an upstream primer F2 and a downstream primer R2 whose nucleotide sequences are shown in SEQ IN NO.3 and SEQ IN NO.4 respectively; and an upstream primer F3 and a downstream primer R3 whose nucleotide sequences are shown in SEQ IN NO.5 and SEQ IN NO.6 respectively.

2. Use of the primer set as claimed in claim 1 in assisting the selection of high-grain weight rice varieties.

3. The use according to claim 2, characterized in that The application refers to using sample rice leaves as templates, performing PCR amplification using upstream primer F1 / downstream primer R1, upstream primer F2 / downstream primer R2, and upstream primer F3 / downstream primer R3 as primers, respectively, and performing electrophoresis detection on the amplified products. The thousand-grain weight of the rice sample with two electrophoresis bands is significantly higher than that of the rice sample with only one band.

4. The use according to claim 3, characterized in that: The PCR amplification refers to: PCR amplification system: 50 µg / µL DNA template 2 µL, 2 pmol / µl upstream primer 2 µL, 2 pmol / µl downstream primer 2 µL, 2 × Phanta Max Master Mix 25 μl, ddH2O 19 µL, a total of 50 µL; PCR amplification program: denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 1 min, 35 cycles; extension at 72°C for 10 min, and storage at 4°C.

Images