Indel Molecular Marker Tightly Linked to the Shape of Radish Fleshy Root and Its Application

By developing Indel molecular markers and corresponding primer sets closely linked to the shape of the meaty roots of radish, the problem of difficult to quickly and accurately identify excellent root traits in the prior art is solved, and the efficiency of radish breeding and market response capabilities are improved.

CN119506467BActive Publication Date: 2025-07-25BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411916996.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-24
Publication Date
2025-07-25
Estimated Expiration
2044-12-24

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and accurately identify and select radish materials with excellent root shape traits, resulting in inefficient radish breeding process and unable to respond quickly to market demand.

Method used

Indel molecular markers closely linked to the shape of the fleshy root of the carrot were developed, including the first Indel marker (RLin41) and the second Indel marker (RLin92), and corresponding primer sets and kits were designed to identify the fleshy root of the carrot by PCR amplification and electrophoresis analysis.

Benefits of technology

It realizes faster and more accurate identification and selection of radish materials with excellent root traits, improves breeding efficiency, enhances market competitiveness, and simplifies the identification operation process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119506467B_ABST
    Figure CN119506467B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to an Indel molecular marker closely linked to the shape of radish fleshy roots, primers, kits, methods and applications for amplifying the Indel molecular marker. Both the first Indel marker and the second Indel marker are located within the 19.6-20.1 Mb interval of chromosome 7 of the radish genome. The nucleotide sequence of the first Indel marker lacks 4 bp in extremely long-shaped radishes compared to extremely round radishes; the nucleotide sequence of the second Indel marker lacks 25 bp in extremely long-shaped radishes compared to extremely round radishes. The present invention has discovered quantitative trait loci controlling the shape of radish fleshy roots and developed molecular markers closely related to root shape, which can more quickly and accurately identify and select materials with excellent root shape traits, thereby accelerating the breeding process and improving breeding efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to an Indel molecular marker closely linked to the shape of radish fleshy roots, primers, kits, methods and applications for amplifying the Indel molecular marker. Background Art

[0002] Radish (Raphanus sativus L.) is an important vegetable crop native to China, with an average annual sown area of 16 million mu. For a long time, it has not only been the main vegetable to ensure the supply of autumn and winter vegetables in China and increase farmers' income, but also become a new type of vegetable to meet people's needs for a better life and physical health. The edible organ of radish is the fleshy root, and the root shape is an important trait affecting the commercial quality of radish. It not only determines the sensory quality of the product, but also affects consumers' preferences and the efficiency of transportation and processing, etc., and ultimately determines the market price of radish. Taking Changbai radish as an example, a straight and well-ended long cylindrical root shape is one of the characteristics that an excellent variety must possess. Therefore, it is necessary to establish an efficient molecular-assisted breeding technology system for the shape of radish fleshy roots. Since the radish root shape is a quantitative trait and is easily affected by environmental conditions, it is relatively difficult to evaluate its phenotype and conduct related genetic research, which seriously hinders the development of molecular markers closely related to the root shape and the rapid identification and screening of the root shape during the breeding process. Summary of the Invention

[0003] In order to solve the above problems existing in the prior art, the present invention provides an Indel molecular marker closely linked to the shape of radish fleshy roots, primers, kits, methods and applications for amplifying the Indel molecular marker.

[0004] In the first aspect of the present invention, an Indel marker closely linked to the shape of radish fleshy roots is provided, including a first Indel marker and / or a second Indel marker; the nucleotide sequence of the first Indel marker is without deletion and / or deletion of TAAA, and the nucleotide sequence of the second Indel marker is without deletion and / or deletion of CGCTTTTGCACCCTACCACCGTCGC.

[0005] In the second aspect of the present invention, a primer set for identifying / assisting in identifying the shape of radish fleshy roots is provided, for identifying the first Indel marker and / or the second Indel marker provided in the first aspect of the present invention.

[0006] In the third aspect of the present invention, a kit for identifying / assisting in identifying the shape of radish fleshy roots is provided, including the primer set provided in the second aspect of the present invention.

[0007] The fourth aspect of the present invention provides a method for identifying / assisting in identifying the shape of radish fleshy roots, including using the Indel markers closely linked to the shape of radish fleshy roots provided in the first aspect of the present invention, and / or the primer sets for identifying / assisting in identifying the shape of radish fleshy roots provided in the second aspect of the invention, and / or the operation of the kit for identifying / assisting in identifying the shape of radish fleshy roots provided in the third aspect of the present invention.

[0008] The fifth aspect of the present invention provides an application of the first Indel marker and / or the second Indel marker provided in the first aspect of the present invention, and / or the primer sets for identifying the first Indel marker (RLin41) and / or the second Indel marker (RLin92) provided in the second aspect of the present invention, and / or the kit for identifying / assisting in identifying the shape of radish fleshy roots provided in the third aspect of the present invention, and / or the method for identifying / assisting in identifying the shape of radish fleshy roots provided in the fourth aspect of the present invention, in the identification / assistance in identifying the shape of radish fleshy roots, and in radish breeding / assistant breeding.

[0009] Compared with the prior art, the present invention has the following beneficial effects:

[0010] 1. The present invention has discovered the quantitative trait loci controlling the shape of radish fleshy roots and developed molecular markers closely related to root shape, which can more quickly and accurately identify and select materials with excellent root shape traits, thereby accelerating the breeding process and improving breeding efficiency.

[0011] 2. With the increasing attention of consumers to the shape of radish fleshy roots, the molecular markers of the present invention can help breeders quickly respond to market demands, improve the production efficiency of radishes with specific root shapes, and thus enhance market competitiveness.

[0012] 3. The identification method of the present invention is simple to operate and saves resources; the various operation steps of this identification method cooperate with each other to achieve excellent results. Description of the Drawings

[0013] Figure 1 Photographs of representative individuals of the parental lines, F1, and F2 populations in Example 1, and bar graphs of the root shape index, root length, and root width of the radishes in the F2 population.

[0014] Figure 2 Result diagram of root shape BSA-seq in Example 1.

[0015] Figure 3 QTL linkage map of root shape index in Example 1.

[0016] Figure 4This is the electrophoresis diagram of the PCR amplification product of the RLin41 marker in Example 2 of the present invention, which reflects the genotyping of the RLin41 marker on the parents (G27, G28) and F2 individuals with different fleshy root shapes.

[0017] Figure 5 This is the electrophoresis diagram of the PCR amplification product of the RLin92 primer in Example 2 of the present invention, which reflects the genotyping of the RLin92 marker on the parents (G27, G28) and F2 individuals with different fleshy root shapes. Detailed implementation manners

[0018] To make the technical solutions, objectives and advantages of the present invention clearer, the present invention will be further described in detail below through specific examples. It should be understood that the specific implementation manners described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0019] In the first aspect of the present invention, an Indel molecular marker closely linked to the fleshy root shape of radish is provided, including a first Indel marker (RLin41) and / or a second Indel marker (RLin92).

[0020] The nucleotide sequence of the first Indel marker (RLin41) is without deletion and / or deletion of TAAA, and the nucleotide sequence of the second Indel marker (RLin92) is without deletion and / or deletion of CGCTTTTGCACCCTACCACCGTCGC.

[0021] As a preferred implementation manner, both the first Indel marker and the second Indel marker are located in the interval of 19.6 - 20.1 Mb on chromosome 7 of the radish genome. The nucleotide sequence of the first Indel marker (RLin41) has a 4-bp deletion: TAAA in extremely long-shaped radishes compared to extremely round-shaped radishes; the nucleotide sequence of the second Indel marker (RLin92) has a 25-bp deletion: CGCTTTTGCACCCTACCACCGTCGC in extremely long-shaped radishes compared to extremely round-shaped radishes.

[0022] As a preferred implementation manner, the size of the first Indel marker (RLin41) in extremely round-shaped radishes is 187 bp, and its nucleotide sequence is as shown in Sequence 1:

[0023] TGAAAGTCACGTATCTCCGACCTAATGTCATTCATTATGTAAGTTACAAACTTCTATCAACAGTTTTTCTGTGCTTTCAACAATATTTTTCTGTGAATATCTTTTCATGGTAAG TAAATATTACCTCTGATCAGTAAATATTTATAATTATTTTTAAACTACAAAAGTGATTGGCTGGAGTGTAACA (Sequence 1).

[0024] The size of the first Indel marker (RLin41) in the extremely long radish is 183 bp, and its nucleotide sequence is as shown in Sequence 2:

[0025] TGAAAGTCACGTATCTCCGACCTAATGTCATTCATTATGTAAGTTACAAACTTCTATCAACAGTTTTTCTGTGCTTTCAACAATATTTTTCTGTGAATATCTTTTCATGGTAAGTATTACCTCTGATCAGTAAATATTTATAATTATTTTTAAACTACAAAAGTGATTGGCTGGAGTGTAACA (Sequence 2).

[0026] As a preferred embodiment, the size of the second Indel marker (RLin92) in the extremely round radish is 166 bp, and its nucleotide sequence is as shown in Sequence 3:

[0027] ACCAACGGCCCGTATATTCCGGCTACATAGACTCCTGGAGAAGACGAATATCCCGCCTTGAAGTGATCATCCT CGCTTTTGCACCCTACCACCGTCGC CAGCTTCCCGTTGACCGTTTTGGAGACAGCAGATACATCTCCGGAGATGAAGACGCCATTTGTCACCG (Sequence 3).

[0028] The size of the second Indel marker (RLin92) in the extremely long radish is 141 bp, and its nucleotide sequence is as shown in Sequence 4:

[0029] ACCAACGGCCCGTATATTCCGGCTACATAGACTCCTGGAGAAGACG AATATCCCGCCTTGAAGTGATCATCCTCAGCTTCCCGTTGACCGTTTTGG AGACAGCAGATACATCTCCGGAGATGAAGACGCCATTTGTCACCG (Sequence 4).

[0030] In the second aspect of the present invention, a primer set for identifying the first Indel marker (RLin41) and / or the second Indel marker (RLin92) is provided, and its nucleotide sequence is as shown in the following Sequences 5-8.

[0031] Primer set for identifying the first Indel marker (RLin41):

[0032] Forward primer: 5’-TGAAAGTCACGTATCTCCGACC-3’ (Sequence 5);

[0033] Reverse primer: 5’-TGTTACACTCCAGCCAATCACT-3’ (Sequence 6);

[0034] Primer set for identifying the second Indel marker (RLin92):

[0035] Forward primer: 5’-ACCAACGGCCCGTATATTCC-3’ (Sequence 7);

[0036] Reverse primer: 5’-CGGTGACAAATGGCGTCTTC-3’ (Sequence 8).

[0037] In the third aspect of the present invention, a kit for identifying / assisting in identifying the shape of radish fleshy roots is provided. The kit includes the primer sets for identifying the first Indel marker (RLin41) and / or the second Indel marker (RLin92) provided in the second aspect of the present invention.

[0038] According to the third aspect of the present invention, the kit may further include at least one of PCR amplification buffer, dNTP, and Taq enzyme.

[0039] In the fourth aspect of the present invention, a method for identifying / assisting in identifying the shape of radish fleshy roots is provided by using the first Indel marker and / or the second Indel marker provided in the first aspect of the present invention, and / or by using the primer sets for identifying the first Indel marker (RLin41) and / or the second Indel marker (RLin92) provided in the second aspect of the present invention, and / or by using the kit for identifying / assisting in identifying the shape of radish fleshy roots provided in the third aspect of the present invention.

[0040] According to the fourth aspect of the present invention, the method includes performing a PCR amplification reaction on the radish genome using the primer sets of the first Indel marker and / or the second Indel marker provided in the second aspect of the present invention, and then detecting and analyzing the PCR amplification products.

[0041] As a preferred embodiment, the operation of detecting and analyzing the PCR amplification products may be, for example: subjecting the PCR amplification products to electrophoresis (such as polyacrylamide gel electrophoresis), and then detecting and analyzing the electrophoresis bands; or sequencing the PCR amplification products.

[0042] As a preferred embodiment, the reaction system (10 μL) of the above PCR amplification reaction includes: 5 μL of Rapid Taq Master Mix, 0.5 μL of forward primer, 0.5 μL of reverse primer, 100 - 200 ng of radish genomic DNA, and supplemented with ddH2O to 10 μL.

[0043] As a preferred embodiment, the above PCR amplification program is: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 20 s, for a total of 35 cycles; extension at 72°C for 5 min; storage temperature at 4°C.

[0044] As a preferred embodiment, the operations for detecting and analyzing the PCR amplification product may include:

[0045] If the primer set for amplifying the first Indel marker (RLin41) amplifies a target band with a size of 187 bp, and / or the primer set for amplifying the second Indel marker (RLin92) amplifies a target band with a size of 166 bp, then the shape of the fleshy root of the radish is extremely round;

[0046] If the primer set for amplifying the first Indel marker (RLin41) amplifies a target band with a size of 183 bp, and / or the primer set for amplifying the second Indel marker (RLin92) amplifies a target band with a size of 141 bp, then the shape of the fleshy root of the radish is extremely long;

[0047] If the primer set for amplifying the first Indel marker (RLin41) amplifies two target bands with sizes of 187 bp and 183 bp, and / or the primer set for amplifying the second Indel marker (RLin92) amplifies two target bands with sizes of 166 bp and 141 bp, then the shape of the fleshy root of the radish is intermediate.

[0048] In the fifth aspect of the present invention, there is provided an application of using the first Indel marker and / or the second Indel marker provided in the first aspect of the present invention, and / or the primer set for identifying the first Indel marker (RLin41) and / or the second Indel marker (RLin92) provided in the second aspect of the present invention, and / or the kit for identifying / assisting in identifying the shape of the fleshy root of the radish provided in the third aspect of the present invention, and / or the method for identifying / assisting in identifying the shape of the fleshy root of the radish provided in the fourth aspect of the present invention, in the identification / assistance in identifying the shape of the fleshy root of the radish, and in the breeding / assistance in breeding of the radish.

[0049] For all kinds of reagents, materials, etc. used in the following embodiments, unless otherwise specified, they are all products that can be obtained from commercial channels; for all kinds of testing and detection methods used in the following embodiments, unless otherwise specified, they are all conventional testing and detection methods in the field and can be obtained from textbooks, reference books or academic journals.

[0050] Example 1

[0051] This example is used to describe the acquisition process of the first Indel marker and the second Indel marker.

[0052] I. Obtaining the root shape index

[0053] Using two high-generation inbred lines of radish, G27 (flat-round shape, female parent) and G28 (slender shape, male parent), as parental materials. G27 is the radish variety "Jinghong No. 6", and G28 is the radish variety "Jingyan Qiubai", both purchased from Jingyan Yinong (Beijing) Seed Industry Technology Co., Ltd. The websites showing these parents are as follows:

[0054] Jinghong No. 6: http: / / www.jyseeds.com / list_161 / 936.html;

[0055] Jingyan Qiubai: http: / / www.jyseeds.com / list_162 / 939.html.

[0056] Using G27 and G28 to construct the F1 and F2 segregation populations of the offspring (as Figure 1 shown), measuring the root length (distance from the head of the main root to the end) and root diameter (maximum diameter) of the parents, F1 and F2 segregating individuals of the offspring, and obtaining the root shape index (Root shape index, RSI) by calculating the ratio of root length / root diameter. The calculation formula of RSI is: RSI = root length / root diameter. According to the numerical range of RSI, the root shape of radish is divided into: extremely round (0.8 ≤ RSI ≤ 1.5), extremely long (RSI > 4), and intermediate (1.5 < RSI ≤ 4).

[0057] As Figure 1 shown in the column chart of the root shape index, root length, and root width of the radish in the F2 population, in the F2 population, the root shape index (RSI), root length, and root width all show a continuous normal distribution; and the normal distribution is a continuous and symmetric distribution pattern, which usually appears in natural populations. When a trait is controlled by multiple genes and each gene contributes less to this trait, then the cumulative effect of these genes may cause the trait to show continuous variation in the population, thus forming a normal distribution; therefore, the above indicates that the long and round root shapes of radish are quantitative traits controlled by multiple genes.

[0058] II. Obtaining the major QTL loci

[0059] 1. The DNA of the parents, extreme-round and extreme-long F2 single plants was extracted respectively by the CTAB method, and the DNA of the extreme single plants was mixed in equal amounts to construct a round R pool and a long L pool respectively.

[0060] 2. The parental materials and the extreme root shape pools of the F2 population were subjected to high-depth whole-genome resequencing using the Illumina Hiseq 2500 sequencing platform. Using the radish "XYB36-2" as the reference genome (http: / / brassicadb.cn / ), the obtained sequence data was aligned with the reference genome, and SNPs were identified through the alignment algorithm.

[0061] 3. According to the allele frequencies of each SNP locus in the two mixed pools, the SNP index was calculated. According to the formula △(SNP-index) = SNP-index (extreme trait L) - SNP-index (extreme trait R), the △(SNP-index) value was obtained. The 99% confidence level was selected as the screening threshold. According to the △(SNP-index) value, the major QTL loci related to the shape of radish fleshy roots were obtained. As Figure 2 shown, using the BSA seq technology, the QTLs significantly related to the shape of fleshy roots were initially mapped within the interval of 15.94 - 20.40 Mb on chromosome 7, named QTL7.1.

[0062] 4. Using the high-depth parental resequencing data and the reference genome information, molecular markers were developed within the above-mentioned preliminary mapping interval. After PCR amplification and genotyping verification of the parents and some offspring individuals, stable and repeatable markers were screened out, and then all the offspring individuals of F2 were genotyped to obtain the genetic information of the markers in the offspring.

[0063] 5. Then, the JoinMap 4.0 software was used for linkage mapping, and the Kosambi function was used to convert the recombination exchange rate into the genetic distance unit cM of genes on the chromosome map. Subsequently, the MapQTL 4.0 software was used for QTLs analysis. As Figure 3 shown, through these analyses, QTL7.1 was finely mapped within the interval of 19.6 - 20.1 Mb on chromosome 7, and this interval is located between the Indel markers RLin41 and RLin92.

[0064] III. Screening and obtaining Indel molecular markers and primers

[0065] The genomic DNA of young leaves of different radish genetic materials was extracted using the improved CTAB method (Aboul-Maaty, N. AF., Oraby, H. AS. Extraction of high-quality genomic DNA from different plant orders applying a modified CTAB-based method. Bull Natl Res Cent 43, 25 (2019). https: / / doi.org / 10.1186 / s42269-019-0066-1), and the genomic DNA was dissolved with ddH2O.

[0066] 1. Using the high-depth parental resequencing data and reference genome information, 22 pairs of primers were designed within the above-mentioned preliminary mapping interval to detect polymorphic Indel sites tightly linked to the shape of radish fleshy roots; 22 molecular markers based on these polymorphic sites were further developed, as shown in Table 1.

[0067] Table 1: Primers for 22 pairs of Indel markers

[0068] Marker Name Forward Primer (5'-3') Reverse Primer (5'-3') RLin-98 CTTTCATTCCACCTGCCAGC TATCACTGGTCAGTCCCCGA RLin-95 CCCCTGTGAACAAAACCACC ATACGATGAGCAGGCAGTGG RLin-92 ACCAACGGCCCGTATATTCC CGGTGACAAATGGCGTCTTC RLin-89 GAGAGAGAGAGAGCAACTGCA AGCAATAAGATCCCACAGTAGAAAGA RLin-153 GCTCTTGTTGCGATCTCTTCA CTTTCATTCGGCGGCTCATC RLin-41 TGAAAGTCACGTATCTCCGACC TGTTACACTCCAGCCAATCACT RLin-39 TGGTCAAGAAGTGGGCACT TGTCTGACTGCATAATATGAAACGG RLin-34 ACTGGTACAACACTGGCGTA CAACAGGTCTCACGGACTGT RLin-28 GCGGGCGTTTGAATACAGAT TGAAGTCAGCGTCAACGACT RLin-23 GATGGCCCATAATTGTGACCA CTCTGTTCCATAAAAACTATTTGACCA RLin-17 TGTAAGGAGGTTGTGTGTCGT TCTCTATGCACGCAGACACC RLin-14 ACCAATCGCCTTCCCTCTAG GGCCTGGGAGGTTTGATAGG RLin-101 CCCACGTTGAGGGTTATGGT ACGAACTCTCAACGTGGGTC RLin-137 AACAATCATCTTTGTTGGACAGAAAT TCCCCTCCCTCAAGTCAAAA RLin-124 TCCCAACTCTCGCAAACTCC AATCCAAACGTTTACATTGCTTCA RLin-7 CGCGAATGCTCATTTCCGTT CGTTTCTCCTTGCCTCTGGT RLin-121 AACCTTTGCCTTTGACTCGC TTGAAGGCTGCAAACAGGTG RLin-118 TCTGGTCAGGAGCTAACCTCT GCAAGTCTTCCGAGGCTTTG RLin-115 ATGGAGGCTACTTCTGTGGT GGTGAAATGAAGAAGCGAGCC RLin-5 CAGCAGTTTTAAGAATCTCAGCGA GCTGGTGACATTTGTCTCGG RLin-105 TCGTATCCAATGACTCACAAGCT AGGGCCAAATGACAGTTCGT RLin-1 GTCACAGGAGCAGAGCTTGA CAGTGAACGTTCGACTTGCC

[0069] 2. The genomic DNA of the above-mentioned parents and the F2 population of offspring was extracted, and PCR amplification reactions were carried out using the above 22 pairs of primers.

[0070] The system of the PCR amplification reaction (10 μL) includes: 5 μL of Rapid Taq Master Mix, 0.5 μL of forward primer, 0.5 μL of reverse primer, 100 - 200 ng of radish genomic DNA, and supplemented with ddH2O to 10 μL.

[0071] The procedure of the PCR amplification reaction is: pre-denaturation at 94 °C for 4 min; denaturation at 94 °C for 15 s, annealing at 55 °C for 15 s, extension at 72 °C for 20 s, 35 cycles; extension at 72 °C for 5 min; storage temperature 4 °C.

[0072] 3. Then, the PCR amplification products were subjected to 8% polyacrylamide gel electrophoresis, electrophoresed at a constant power of 160 V for 1.5 h, and the band patterns were counted under a film observation lamp after silver staining and color development; finally, RLin41 and RLin92 linked to the shape of radish fleshy roots were selected as the Indel molecular markers of the present invention.

[0073] Example 2

[0074] This example is used to illustrate the method for identifying / assisting in identifying the shape of radish fleshy roots using the first Indel marker and the second Indel marker.

[0075] S1: Select 23 extremely long and 23 extremely round F2 generation radish individual plants (with the same parents as in Example 1), and extract the genomic DNA of each radish individual plant according to the improved CTAB method of Example 1.

[0076] S2: Respectively use the above primer sets for amplifying the RLin41 marker and the RLin92 marker, use each radish genome as a template, and perform a PCR amplification reaction according to the PCR amplification reaction system and procedure of Example 1 to obtain the PCR amplification products of each individual plant.

[0077] S3: Perform 8% polyacrylamide gel electrophoresis on the above PCR amplification products, separate them by constant power electrophoresis at 160V for 1.5 h, and then perform silver staining and color development.

[0078] S4: Detect the electrophoresis bands under a film observation lamp, perform band pattern statistics, and analyze and determine the genotypes of each allelic locus.

[0079] The above band patterns are divided into:

[0080] Type a: The band pattern consistent with the round parent, that is, the primer set for amplifying the Rlin41 marker amplifies a target band of 187 bp, and the primer set for amplifying the Rlin92 marker amplifies a band of 166 bp;

[0081] Type b: The band pattern consistent with the long parent, that is, the primer set for amplifying the Rlin41 marker amplifies a target band of 183 bp, and the primer set for amplifying the Rlin92 marker amplifies a band of 141 bp;

[0082] Type h: The heterozygous band pattern, that is, the primer set for amplifying the Rlin41 marker amplifies two target bands of 187 bp and 183 bp, and / or the primer set for amplifying the Rlin92 marker amplifies two target bands of 166 bp and 141 bp.

[0083] The results show (see Table 2) that among the 23 extremely round pools, 19 are consistent with the round parent G27, and 4 are of the heterozygous band pattern; among the 23 extremely long pools, 20 are consistent with the long parent G28, and 3 are heterozygous plants; that is, the marker typing accuracy rate reaches (46 - 4 - 3) / 46 = 84.8%; by comparing the fleshy root shape and the indel marker typing test results, it is proved that this indel marker is closely related to the fleshy root shape, and this indel marker can be used to identify / assist in identifying the fleshy root shape of radishes.

[0084] Table 2: Genotype statistics of Indel markers RLin41 and RLin92 in extreme pools

[0085]

[0086]

[0087] In Table 2, the DNA electrophoresis bands of each individual plant in the extreme circular pool are sequentially presented in the order from top to bottom in Figure 4 columns 1 to 23 of the R pool marked with numbers in Figure 5 columns 1 to 23 of the R pool marked with numbers in; the DNA electrophoresis bands of each individual plant in the extreme long pool are sequentially presented in the order from top to bottom in Figure 4 columns 1 to 23 of the Lpool marked with numbers in Figure 5 columns 1 to 23 of the L pool marked with numbers in.

[0088] As Figure 4 shown, PCR amplification was performed using the primer set for amplifying the RLin41 marker. Only the target band of 187 bp was amplified from the parent G27, and only the band of 183 bp was amplified from the parent G28; the target bands of 187 bp and 183 bp (the two bands were too close and connected as one) were amplified from columns 2, 4, 12, and 17 of the extreme circular pool, and only the target band of 187 bp was amplified from other extreme circular pools; the target bands of 187 bp and 183 bp were amplified from columns 8, 11, and 18 of the extreme long pool, and only the target band of 183 bp was amplified from other extreme long pools.

[0089] As Figure 5 shown, PCR amplification was performed using the primer RLin92. Only the target band of 166 bp was amplified from the parent G27, and only the band of 141 bp was amplified from the parent G28; the target bands of 166 bp and 141 bp were amplified from columns 2, 4, 12, and 17 of the extreme circular pool, and only the target band of 166 bp was amplified from other extreme circular pools; the target bands of 166 bp and 141 bp were amplified from columns 8, 11, and 18 of the extreme long pool, and only the target band of 141 bp was amplified from other extreme long pools.

[0090] It can be seen that the root shapes of the radish individual plants that only yielded a target band of 187 bp through PCR amplification using the primer set for amplifying the RLin41 marker, and the root shapes of the radish individual plants that only yielded a target band of 166 bp through PCR amplification using the primer set for amplifying the RLin92 marker are both extremely round; the root shapes of the radish individual plants that only yielded a target band of 183 bp through PCR amplification using the primer set for amplifying the RLin41 marker, and the root shapes of the radish individual plants that only yielded a target band of 141 bp through PCR amplification using the primer set for amplifying the RLin92 marker are both extremely long; therefore, the RLin41 marker, the RLin92 marker, and the corresponding primer sets can all be used for the identification of extremely round and extremely long radish root shapes.

[0091] Example 3

[0092] This example is used to illustrate the practical application of the method for identifying / assisting in the identification of radish fleshy root shape using the first Indel marker and the second Indel marker in the process of radish backcross breeding.

[0093] Taking the polymerization of disease resistance (clubroot) and round root shape as an example (that is, cultivating a stable round root-shaped radish variety with clubroot resistance), using the extremely round clubroot-susceptible material R046 (RSI is 0.9) as the female parent and the extremely long clubroot-resistant material R055 (RSI is 7.5) as the male parent to hybridize to obtain F1, and then self-crossing to obtain F2.

[0094] S1: Select 100 radish seed samples of the F2 generation, sow them in a plug tray, collect the leaves of the radish seedlings respectively, and extract the genomic DNA of each radish individual plant according to the method of Example 1.

[0095] S2 - S4: Perform according to the operations of S2 - S4 in Example 2.

[0096] The results show that among the 100 samples, 25 have band type a, 25 have band type b, and 50 have band type h.

[0097] Plant the seedlings with band type a in the experimental field. After the radishes grow to maturity, collect the radish fleshy roots, and calculate the root shape index and count the number of various root shapes according to the method in Example 1. It is found that among the 25 radishes with band type a, 23 have extremely round fleshy roots (RSI are all within the range of 1.0 - 1.4), indicating that the method provided by the present invention can accurately identify the shape of radish fleshy roots, and this method can be applied to the molecular marker-assisted breeding of radish fleshy root shape.

[0098] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Indel markers closely linked to the shape of radish fleshy roots, including the first Indel marker and / or the second Indel marker, characterized in that: The nucleotide sequence of the first Indel marker is as shown in Sequence 1 and / or Sequence 2; The nucleotide sequence of the second Indel marker is as shown in Sequence 3 and / or Sequence 4; Determine the shape of radish fleshy roots according to the following numerical range of root shape index RSI: The extreme round shape is: 0.8 ≤ RSI ≤ 1.5; The extreme long shape is: RSI > 4; The intermediate shape is: 1.5 < RSI ≤ 4; The calculation formula of the RSI is: RSI = root length / root diameter; Wherein, the radish is "Jinghong No. 6" or "Jingyan Qiubai"; Or, the radish is the offspring of "Jinghong No. 6" and "Jingyan Qiubai".

2. A method for identifying / assisting in identifying the shape of radish fleshy roots, characterized in that: The method includes using the following primer sets with the radish genome as a template: The primer set for identifying the first Indel marker: Forward primer: 5’- TGAAAGTCACGTATCTCCGACC-3’; Reverse primer: 5’- TGTTACACTCCAGCCAATCACT-3’; The primer set for identifying the second Indel marker: Forward primer: 5’- ACCAACGGCCCGTATATTCC -3’; Reverse primer: 5’- CGGTGACAAATGGCGTCTTC -3’; Perform a PCR amplification reaction on the radish genome, then detect and analyze the PCR amplification product, and perform identification according to the following judgment method: If the primer set for amplifying the first Indel marker amplifies a target band with a size of 187 bp, and / or the primer set for amplifying the second Indel marker amplifies a target band with a size of 166 bp, then the shape of the radish fleshy root is extremely round; If the primer set for amplifying the first Indel marker amplifies a target band with a size of 183 bp, and / or the primer set for amplifying the second Indel marker amplifies a target band with a size of 141 bp, then the shape of the radish fleshy root is extremely long; If the primer set for amplifying the first Indel marker simultaneously amplifies two target bands with sizes of 187 bp and 183 bp, and / or the primer set for amplifying the second Indel marker simultaneously amplifies two target bands with sizes of 166 bp and 141 bp, then the shape of the radish fleshy root is intermediate; Determine the shape of radish fleshy roots according to the following numerical range of root shape index RSI: The extreme round shape is: 0.8 ≤ RSI ≤ 1.5; The extreme long shape is: RSI > 4; The intermediate shape is: 1.5 < RSI ≤ 4; The calculation formula of the RSI is: RSI = root length / root diameter; Wherein, the radish is "Jinghong No. 6" or "Jingyan Qiubai"; Or, the radish is the offspring of "Jinghong No. 6" and "Jingyan Qiubai".

3. The method according to claim 2, characterized in that: The procedure of the PCR amplification reaction is as follows: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 20 s, for a total of 35 cycles; extension at 72°C for 5 min; storage temperature 4°C.