Microfluidic electrochemical sensor capable of simultaneously detecting cortisol and BDNF
By designing a microfluidic electrochemical sensor, using COF-Bta-NSs probe material modified with PtPd nanoenzyme, simultaneous quantitative detection of cortisol and BDNF is achieved, and the problems of insufficient diagnosis and false positive phenomena in the prior art are solved. Improves the diagnostic accuracy of depression.
Patent Information
- Application Number
- CN202411449814.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-17
- Publication Date
- 2025-02-25
AI Technical Summary
It is difficult to conduct quantitative detection of cortisol and BDNF at the same time in the prior art, resulting in insufficient objective diagnosis of depression and prone to false positives.
A microfluidic electrochemical sensor was designed, including a cortisol detection chamber and a BDNF detection chamber. The COF-Bta-NSs modified with PtPd nanoenzymes were used as probe materials, and the electrode modification and aptamer binding was achieved. Simultaneous detection of cortisol and BDNF.
Simultaneous quantitative detection of cortisol and BDNF is achieved, which improves the diagnostic accuracy of depression and reduces the occurrence of false positive phenomena.
Smart Images
Figure CN119510522A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of electrochemical analysis, and in particular relates to a microfluidic electrochemical sensor capable of simultaneously detecting cortisol and BDNF. Background Art
[0002] Depression is a highly heterogeneous and complex disease with a complex mechanism of occurrence and development. It is accompanied by changes in multiple index components. A variety of disease markers have been revealed to be closely related to the occurrence and development of depression, such as cortisol, brain-derived neurotrophic factor (BDNF), apolipoprotein A4 (Apo-A4), heat shock protein 70 (HSP-70), etc. Based on these depression markers, a series of electrochemical sensors have been constructed for their sensitive detection, but most of them only focus on a single marker, which is still insufficient for the objective and accurate diagnosis of the disease and prone to false positives. The selection of multiple depression markers for simultaneous detection and mutual complementation is of great benefit to the objective diagnosis of depression.
[0003] Patients with depression are usually accompanied by elevated cortisol levels and decreased BDNF levels. Studies have found that the two are closely linked in the development of the disease. Long-term exposure to glucocorticoids can reduce BDNF mRNA, BDNF, receptor TrkB and downstream proteins. In addition, studies have also reported that BDNF and Cortisol are used as detection indicators for the diagnosis of depression and the evaluation of the efficacy of antidepressant drugs. The diagnostic efficacy (AUC) of the combination of the two serum proteins is significantly improved compared with that of a single serum protein, from 0.76 to 0.841, with good diagnostic performance. However, there is currently no analytical method that can achieve simultaneous quantitative detection of BDNF and Cortisol.
[0004] Existing technology: 1. Wei W, Zhou S, Ma DD, et al. Ultrathin Conductive Bithiazole‐BasedCovalentOrganic Framework Nanosheets for Highly Efficient ElectrochemicalBiosensing [J]. Advanced Functional Materials, 2023,33(2302917). 2. Gao S, Li Q, Zhang S, et al. One-step High-throughput Detection ofLow-abundance Biomarker BDNF Using a BiolayerInterferometry-based 3DAptasensor [J]. Biosensors and Bioelectronics, 2022,215(114566). 3. Zeng Summary of the invention
[0005] Based on the above prior art, the object of the present invention is to provide a microfluidic electrochemical sensor that can simultaneously detect cortisol and BDNF.
[0006] In order to achieve the above object, the present invention adopts the following technical scheme: A microfluidic electrochemical sensor capable of simultaneously detecting cortisol and BDNF, the microfluidic electrochemical sensor comprising: A microfluidic chip, the microfluidic chip comprising a cortisol detection chamber connected to the inlet via a first microchannel and a BDNF detection chamber connected to the inlet via a second microchannel; A cortisol electrochemical sensor, comprising an electrode and a probe material modified on the surface of the electrode and consisting of a COF-Bta-NSs-loaded PtPd nanozyme, a cortisol aptamer and ferrocene; and a BDNF electrochemical sensor, wherein the BDNF electrochemical sensor comprises an electrode and a probe material modified on the surface of the electrode and consisting of a COF-Bta-NSs-loaded PtPd nanozyme, a BDNF aptamer and toluidine blue.
[0007] Ferrocene and toluidine blue were used as redox probes.
[0008] Preferably, the COF-Bta-NSs-loaded PtPd nanozyme is prepared by COF-Bta-NSs, PdCl 2 , H2 PtCl 4 and a reducing agent in a solvent to obtain a mixed reaction.
[0009] More preferably, COF-Bta-NSs, PdCl 2 and H 2 PtCl 4 The mass ratio is 1:0.5~2:1~4, and most preferably, the mass ratio is 1:1:2.
[0010] More preferably, the reducing agent is hydrazine hydrate.
[0011] Preferably, the mass ratio of COF-Bta-NSs-loaded PtPd nanozyme, cortisol aptamer and ferrocene is 1:0.1:0.5~2.5, and more preferably, the mass ratio is 1:0.1:2.
[0012] Preferably, the mass ratio of COF-Bta-NSs-loaded PtPd nanozyme, BDNF aptamer and toluidine blue is 1:0.1:1-3, and more preferably, the mass ratio is 1:0.1:2.5.
[0013] Preferably, the sequence of the cortisol aptamer is: 5′-SH-ATGGGCAATGCGGGGTGGAGAATGGTTGCCGCACTTCGGC.
[0014] Preferably, the sequence of the BDNF aptamer is: 5′-SH-TCACGACTACAGGTTGGGATAGGTTGGGATAAGTAGTTTA.
[0015] Preferably, the electrode is a carbon electrode.
[0016] More preferably, the electrode is a screen-printed carbon electrode.
[0017] The working electrode of the screen-printed carbon electrode is a carbon electrode, the counter electrode is a carbon electrode, the reference electrode is a silver / silver chloride electrode, and the probe material is modified on the surface of the working electrode.
[0018] Preferably, the modified amount of the probe material is 24-40 μg.
[0019] A method for detecting cortisol and BDNF, comprising: (1) injecting the sample solution to be tested into the microfluidic electrochemical sensor as described above and incubating for a certain period of time; (2) After washing with PBS buffer, the current response of the cortisol electrochemical sensor and the BDNF electrochemical sensor was measured by square wave voltammetry.
[0020] An electrochemical sensor for detecting cortisol, wherein the electrochemical sensor is the cortisol electrochemical sensor as described above.
[0021] An electrochemical sensor for detecting BDNF, wherein the electrochemical sensor is the BDNF electrochemical sensor described above. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 It is a schematic diagram of the structure of the microfluidic chip, wherein 1-inlet, 20-cortisol detection chamber, 21-first microchannel, 22-cortisol electrochemical sensor insertion port, 23-first outlet, 30-BDNF detection chamber, 31-second microchannel, 32-BDNF electrochemical sensor insertion port, 33-second outlet.
[0023] Figure 2 XRD pattern (A) and FTIR spectrum (B) of COF-Bta-NSs.
[0024] Figure 3 XPS spectra of COF-Bta-NSs before and after loading PtPd nanozyme.
[0025] Figure 4 SEM images of COF-Bta-NSs before and after loading PtPd nanozyme.
[0026] Figure 5 Upright fluorescence microscopy images of PtPd@COF-Bta-NSs before and after loading the aptamer.
[0027] Figure 6 This is a real photo of the microfluidic electrochemical sensor, where 4 is cortisol electrochemical sensor, 5 is BDNF electrochemical sensor, 40 is working electrode, 41 is counter electrode, and 42 is reference electrode.
[0028] Figure 7 The SWV response curves and fitted linear relationship diagrams of the cortisol electrochemical sensor and BDNF electrochemical sensor after incubation with different concentrations of cortisol and BDNF.
[0029] Figure 8 The selectivity of the cortisol electrochemical sensor and the BDNF electrochemical sensor to cortisol, BDNF and different interferents.
[0030] Fig. 9 The reproducibility and stability of the cortisol electrochemical sensor and the BDNF electrochemical sensor.
[0031] Fig.10 SWV current responses of different modified electrodes. DETAILED DESCRIPTION
[0032] The technical solution of the present invention is further described in detail below in conjunction with embodiments.
[0033] 1. Microfluidic Chip like Figure 1 As shown in (I), the microfluidic chip includes an inlet, a cortisol detection chamber, a BDNF detection chamber, a first microchannel and a second microchannel. The cortisol detection chamber is connected to the inlet through the first microchannel, and a first outlet and a cortisol electrochemical sensor insertion port are respectively provided on the side wall of the cortisol detection chamber. Figure 1 (II) is the AA cross-sectional view. The BDNF detection chamber is connected to the inlet through the second microchannel, and the second outlet and the BDNF electrochemical sensor insertion port are respectively provided on the side wall of the BDNF detection chamber. The chip is 50 mm long, 14 mm wide, and 1 mm thick. It is made of polydimethylsiloxane (PDMS), the internal detection chamber has a diameter of 10 mm, and the microchannel width is 0.5 mm.
[0034] 2. The preparation of COF-Bta-NSs refers to the above-mentioned prior art 1, which is as follows: First, add 6 mmol thiourea and 3 mmol 1,4-dibromobutane-2,3-dione to a 100 mL flask, use 50 mL methanol as solvent, and reflux at 60-70 ° C for 12 h. After cooling to room temperature, centrifuge the precipitate and wash with ethanol. The resulting precipitate is dissolved in deionized water and the pH value of the solution is adjusted with potassium bicarbonate until a white crystalline solid precipitates, which is filtered and dried to obtain 2,2'-diamine-4,4'-bithiazole (Bta).
[0035] Then, 3 mL of 1,4-dioxane, 2.4 mL of mesitylene solution, and 0.6 mL of acetic acid aqueous solution were added to the Pyrex tube. The reaction monomer 1,3,5-triformylphloroglucinol (Tp, 0.24 mmol) and the Bta obtained above (0.36 mmol) were added, and the tube was sealed by vacuum after ultrasonication for 10 min. The tube was immersed in a 120℃ oil bath and heated at 400 rpm for 72 h. The final precipitate was washed with acetone, dichloromethane, THF and ethanol in turn, and purified by Soxhlet extraction and reflux method with ethanol as solvent for 24 h. Finally, the precipitate was vacuum dried at 80℃ for 12 h to obtain brown solid powder COF-Bta-NSs.
[0036] The XRD spectrum of COF-Bta-NSs is shown in Figure 2 (A) shows that the sharp peak at 3.8° indicates that the prepared COF material has good crystallinity. In addition, the broad peak at around 26° belongs to the (001) plane of COF-Bta-NSs, corresponding to the π-π stacking of COF layers.
[0037] like Figure 2 (B) shows the FTIR spectrum of the Bta sample at 3444 cm -1 and 3289 cm -1 The absorption peak is due to the stretching vibration of NH, 1596 cm -1 The stretching vibration of C=N is the cause. The 3423 cm-1 generated by the -OH stretching vibration can be observed in COF-Bta-NSs. -1 , and 1602 cm -1 and 1236 cm -1 The corresponding C=N and CN vibrations prove the successful preparation of COF-Bta-NSs and pre-monomer Bta.
[0038] 3. The aptamer sequence is as follows: SEQ ID No.1 (disclosed in the above-mentioned prior art 2): ATGGGCAATGCGGGGTGGAGAATGGTTGCCGCACTTCGGC, SEQ ID No.2 (disclosed in the above-mentioned prior art 3): TCACGACTACAGGTTGGGATAGGTTGGGATAAGTAGTTTA.
[0039] In order to couple the aptamer with the PtPd nanozyme and thus efficiently immobilize it on COF-Bta-NSs, the 5' end of the aptamer was modified with a thiol group.
[0040] In order to verify whether the aptamer was successfully immobilized on COF-Bta-NSs by fluorescence, the 3' end of the aptamer was labeled with hydroxyfluorescein FAM.
[0041] The cortisol aptamer modified with thiol and FAM fluorescent group (Apt Cor )as follows: 5′-SH-ATGGGCAATGCGGGGTGGAGAATGGTTGCCGCACTTCGGC-FAM-3′.
[0042] BDNF aptamer modified with thiol and FAM fluorescent group (Apt BDNF )as follows: 5′-SH-TCACGACTACAGGTTGGGATAGGTTGGGATAAGTAGTTTA-FAM-3′.
[0043] The above-mentioned cortisol aptamer and BDNF aptamer modified with thiol and FAM fluorescent group were provided by Qingke Biotechnology Company.
[0044] 4. Unless otherwise specified, the conditions for the electrochemical detection of the present invention are as follows: AUTOLAB PGSTAT302N electrochemical workstation (Metrohm China Ltd., Switzerland); Screen printed carbon electrode (SPCE): the substrate is polyethylene terephthalate (PET), the working electrode is a carbon electrode, the counter electrode is a carbon electrode, and the reference electrode is a silver / silver chloride electrode; Electrolyte: 0.01 M pH=7.4 PBS buffer solution; Electrochemical impedance spectroscopy (EIS): Frequency: 0.1 Hz~10 5 Hz, amplitude: 5 mV, potential: 0.2 V; Cyclic voltammetry (CV): potential range: -0.3 V~0.5 V, scan rate: 20 mV / s; Differential pulse voltammetry (DPV): potential range: -0.3 V~0.6 V, modulation amplitude: 25 mV, modulation time: 50 ms, interval time: 0.5 s, step size: 5 mV; Square wave voltammetry (SWV): pulse amplitude: 60 mV, square wave frequency: 25 Hz, potential increment: 5 mV, when the target is BDNF, the potential range is: -0.6 V~0 V, when the target is cortisol, the potential range is: 0 V~0.35 V.
[0045] Example 1 1) Preparation of PtPd nanozyme loaded on COF-Bta-NSs (PtPd@COF-Bta-NSs) Weigh 4 mg of the COF-Bta-NSs prepared above and disperse it in 2 mL of water by ultrasonication. Transfer it to a 5 mL flask and then add PdCl 2 Powder 4 mg, H 2 PtCl 4 800 μL of solution (10 mg / mL) was magnetically stirred for 4 h. Then 250 μL of hydrazine hydrate was quickly added to it to promote the redox reaction. The color of the solution can be clearly observed to change from yellow to black. The magnetic stirring was continued for 5 h to ensure the full progress of the reaction. After the reaction, the obtained black product was centrifuged at 15000 rpm for 10 min, washed with water several times, and then vacuum dried at 60 ° C for 5 h to obtain PtPd@COF-Bta-NSs, which was finally resuspended with ultrapure water.
[0046] The elemental analysis results of COF-Bta-NSs before and after loading PtPd nanozymes are shown in Figure 2. Figure 3As shown in XPS, in addition to the characteristic peaks of S 2p, S 2s, C 1s, N 1s, and O 1s, the characteristic peaks of Pt and Pd were further observed in PtPd@COF-Bta-NSs, which proves that Pt and Pd nanoparticles have been successfully loaded on COF-Bta-NSs.
[0047] from Figure 4 (A) It can be observed that the COF-Bta-NSs material exhibits rod-like and flake-like morphologies, and a certain amount of stacking occurs, which is most likely due to the relatively rich conjugated electron system in the structure. Figure 4 As shown in (B), when Pt and Pd nanoparticles are in situ loaded into COF-Bta-NSs, it can be clearly seen that the morphology and structure of the original COF material are wrapped by abundant fine particles and are distributed relatively evenly, which proves the successful preparation of PtPd@COF-Bta-NSs.
[0048] 2) Preparation of probe materials 100 μL of 1.0 mg mL -1 Apt Cor PtPd@COF-Bta-NSs (1.0 mL, 1.0 mg / mL) resuspension was added and stirred overnight, followed by the addition of ferrocene (Fc) solution (1.0 mL, 2.0 mg / mL) and mechanical stirring for 12 h. The mixture was washed several times with PBS buffer solution, and finally mixed with an appropriate amount of BSA (1%) solution and stirred for 1 h to block nonspecific binding sites. After washing, the probe material Fc / Apt was obtained. Cor / PtPd@COF-Bta-NSs and resuspended in ultrapure water.
[0049] 100 μL of 1.0 mg mL -1 Apt BDNF PtPd@COF-Bta-NSs (1.0 mL, 1.0 mg / mL) resuspension was added and stirred overnight, followed by addition of toluidine blue (TB) solution (1.0 mL, 2.5 mg / mL) and mechanical stirring for 12 h. The mixture was washed several times with PBS buffer solution, and finally mixed with an appropriate amount of BSA (1%) solution and stirred for 1 h to block nonspecific binding sites. After washing, the probe material TB / Apt was obtained. BDNF / PtPd@COF-Bta-NSs and resuspended in ultrapure water.
[0050] In order to verify whether the SH-modified aptamer was successfully immobilized on the surface of the PtPd@COF-Bta-NSs material, the Apt without adding TB (to avoid its interference with the fluorescence effect) was prepared according to the above method. BDNF / PtPd@COF-Bta-NSs. Figure 5(A) As shown, Apt BDNF / PtPd@COF-Bta-NSs can be observed with obvious fluorescent bright spots, while PtPd@COF-Bta-NSs has no fluorescent bright spots (such as Figure 5 (B) ), demonstrating the successful loading of the aptamer.
[0051] 3) Construction of microfluidic electrochemical sensor 18 μL of 2 mg mL -1 Fc / Apt Cor The / PtPd@COF-Bta-NSs suspension was drop-coated on the working electrode of SPCE and dried under an infrared lamp to obtain a cortisol electrochemical sensor.
[0052] 18 μL of 2 mg mL -1 TB / Apt BDNF The / PtPd@COF-Bta-NSs suspension was drop-coated on the working electrode of SPCE and dried under an infrared lamp to obtain the BDNF electrochemical sensor.
[0053] The cortisol electrochemical sensor and the BDNF electrochemical sensor are respectively inserted into the cortisol detection cavity and the BDNF detection cavity of the microfluidic chip, and then packaged for use. Figure 6 shown.
[0054] 4) Detection of cortisol and BDNF Testing process: A) Sample solutions containing different concentrations of cortisol (0-80 ng / mL) and BDNF (0-2000 pg / mL) were injected into the microfluidic electrochemical sensor. After incubation for 30 min, the electrolyte was injected for flushing. B) The current responses of the cortisol electrochemical sensor and the BDNF electrochemical sensor were measured using the SWV method.
[0055] The SWV curves of the cortisol electrochemical sensor at different cortisol concentrations are shown in Figure 2. Figure 7 As shown in (A), it can be seen that its concentration (C Cor ) is negatively correlated with the peak current response (I), and the fitted linear relationship diagram is shown in Figure 7 As shown in (B), the correction linear equation of cortisol concentration and current response peak in the range of 0.1 ~ 80 ng / mL is: I (μA) = -18.71×lgC Cor +43.32, R 2 =0.9904, and the detection limit was 0.07 ng / mL (S / N=3).
[0056] The SWV curves of BDNF electrochemical sensor at different BDNF concentrations are shown in Figure 2. Figure 7 As shown in (C), it can be seen that its concentration (C BDNF ) is negatively correlated with the peak current response (I), and the fitted linear relationship diagram is shown in Figure 7 As shown in (D), the calibration linear equation of BDNF concentration and current response peak in the range of 7.81~2000 pg / mL is: I (μA) = -17.87×l gC BDNF +73.21, R 2 =0.9936, detection limit is 4.24 pg mL -1 (S / N=3).
[0057] 5) Selectivity, reproducibility and stability investigation Apo-A4 and HSP70, macromolecular depression markers coexisting in the blood, and adrenaline, diethylstilbestrol and thyroxine, hormone disruptors, were selected as interferors, and the SWV electrochemical response was investigated when only the interferors were present and when both the interferors and the analytes were present. Figure 8 As shown, whether it is cortisol or BDNF, when only high concentrations of interfering substances exist, the current peak is close to that of the blank sample, which proves that the sensor has good specific recognition ability and the modified specific aptamer does not adsorb and capture interfering substances; when the analyte and high concentrations of interfering substances coexist, no significant interference is caused, and the signal intensity is similar to that of only the analyte, which proves that the constructed electrochemical sensor has good anti-interference ability.
[0058] Five microfluidic electrochemical sensors were prepared in parallel and incubated with sample solutions containing 5 ng / mL cortisol and 125 pg / mL BDNF. The current response peak of the sensor was measured by the SWV method. The results are shown in Fig. 9 As shown in (A, B), the relative standard deviation of cortisol detection is 4.66%, and the relative standard deviation of BDNF is 2.71%, indicating that the constructed microfluidic sensor has good reproducibility.
[0059] like Fig. 9 As shown in (C, D), the microfluidic electrochemical sensor can retain 96.57% of the initial response to cortisol (5 ng / mL) and 97.03% of the initial response to BDNF (125 pg / mL) after 7 days of storage. After 14 days of storage, it can retain 95.08% of the initial response to cortisol and 92.74% of the initial response to BDNF. This shows that the constructed microfluidic sensor has good stability.
[0060] 6) Serum sample spike recovery experiment Serum from depression model rats was collected as actual samples for cortisol and BDNF detection: first, the rats were anesthetized with chloral hydrate solution, and blood samples were quickly taken out. The blood samples were then stored at room temperature for 1 hour or at 2-8°C overnight, centrifuged at 2-8°C and 1000×g for 15 minutes, and the supernatant was taken.
[0061] The collected serum samples were diluted 10 and 50 times with PBS buffer solution, respectively, and used for spike recovery experiments of Cortisol and BDNF, respectively, so that the concentration of the analyte was in the middle of the detection linear range of the sensor to ensure relatively good and accurate analysis results. The standard addition method was used for three parallel tests, and the test operation was the same as above 4), and the results are shown in Table 1. The detection recovery rate of the constructed microfluidic sensor for cortisol was between 96.29% and 104.67%, and the RSD was less than 3.34%; the detection recovery rate of BDNF was between 93.49% and 105.76%, and the RSD was less than 2.65%. In addition, the content of cortisol in the serum of depressed rats was calculated to be 46.9 ng / mL, and the content of BDNF was 708.5 pg / mL. Overall, it shows that the constructed sensor has good analytical performance in serum samples and can be used for the detection of actual samples.
[0062] Table 1 a The average value of three consecutive measurements Example 2 The preparation of PtPd@COF-Bta-NSs was the same as in Example 1, except that the amount of COF-Bta-NSs was 4 mg. 2 and H 2 PtCl 4 The mass ratios of PdCl were 1:1:4, 1:1:2, 1:1:1, 1:2:1, and 1:0.5:1, respectively. 2 Powder, H 2 PtCl 4 The amount of solution was adjusted to prepare PtPd@COF-Bta-NSs with different mass ratios and resuspended in ultrapure water.
[0063] Add Fc solution (1.0 mL, 2.5 mg / mL) into PtPd@COF-Bta-NSs (1.0 mL, 1.0 mg mL -1 ) resuspension, mechanically stirred for 12 h to obtain Fc / PtPd@COF-Bta-NSs, which was resuspended in ultrapure water.
[0064] 18 μL of 2 mg / mL Fc / PtPd@COF-Bta-NSs resuspension droplet was applied on the glassy carbon electrode (GCE). After drying under an infrared lamp, the current response peak of GCE in 0.01 M pH=7.4 PBS buffer solution was tested by SWV method. The results are shown in Fig.10 (A) As shown. When preparing PtPd@COF-Bta-NSs, COF-Bta-NSs, PdCl 2 and H 2 PtCl 4 The optimal mass ratio is 1:1:2.
[0065] Example 3 The preparation of PtPd@COF-Bta-NS was the same as in Example 1 and resuspended in ultrapure water.
[0066] Fc solutions with different concentrations (1.0 mL, 0.5, 1, 1.5, 2.0, and 2.5 mg / mL) were added to the PtPd@COF-Bta-NSs (1.0 mL 1.0 mg / mL) resuspension and mechanically stirred for 12 h to obtain Fc / PtPd@COF-Bta-NSs with different dosage ratios, which were resuspended in ultrapure water.
[0067] 18 μL of 2 mg / mL Fc / PtPd@COF-Bta-NSs resuspension was droplet coated on the working electrode of SPCE. After drying under infrared light, the current response peak of SPCE in 0.01 M pH=7.4 PBS buffer solution was tested by SWV method. The results are shown in Fig.10 (B) shown.
[0068] According to the above experimental results, when preparing the probe material Fc / Apt Cor / PtPd@COF-Bta-NSs, the mass ratio of PtPd@COF-Bta-NSs to Fc is in the range of 1:0.5~1:2.5, and the optimal mass ratio is 1:2.
[0069] Example 4 The preparation of PtPd@COF-Bta-NS was the same as in Example 1 and resuspended in ultrapure water.
[0070] TB solutions with different concentrations (1.0 mL, 1, 1.5, 2, 2.5, and 3.0 mg / mL) were added to the PtPd@COF-Bta-NSs (1.0 mL 1.0 mg / mL) resuspension and mechanically stirred for 12 h to obtain TB / PtPd@COF-Bta-NSs with different dosage ratios, which were resuspended in ultrapure water.
[0071] 18 μL of 2 mg / mL TB / PtPd@COF-Bta-NSs resuspension was droplet coated on the working electrode of SPCE. After drying under infrared light, the current response peak of SPCE in 0.01 M pH=7.4 PBS buffer solution was tested by SWV method. The results are shown in Fig.10 (C) shown.
[0072] According to the above experimental results, when preparing the probe material TB / Apt BDNF / PtPd@COF-Bta-NSs, the mass ratio of PtPd@COF-Bta-NSs to TB is in the range of 1:1~1:3, and the optimal mass ratio is 1:2.5.
[0073] Example 5 The preparation of Fc / PtPd@COF-Bta-NSs was the same as in Example 3, wherein Fc solution (1.0 mL, 2 mg / mL) and PtPd@COF-Bta-NSs (1.0 mL 1.0 mg / mL).
[0074] Fc / PtPd@COF-Bta-NSs was resuspended in ultrapure water (2.0 mg / mL), and 12, 14, 16, 18, and 20 μL of the resuspended solution were applied to the working electrode of SPCE. After drying under an infrared lamp, the current response peak of SPCE in 0.01 M pH=7.4 PBS buffer solution was tested by SWV method. The results are shown in Fig.10 As shown in (D), the best current response can be obtained when the drop volume is 18 μL.
[0075] According to the above experimental results, when the electrode surface probe material Fc / Apt Cor / PtPd@COF-Bta-NSs、TB / Apt BDNF / PtPd@COF-Bta-NSs, 36 μg was selected as the optimal modification amount within the range of 24~40 μg.
[0076] Example 6 Probe material Fc / Apt Cor / PtPd@COF-Bta-NSs、TB / Apt BDNF The preparation of / PtPd@COF-Bta-NSs was the same as in Example 1 and they were resuspended in ultrapure water.
[0077] Take 18 μL of 2 mg / mL TB / Apt BDNFThe / PtPd@COF-Bta-NSs resuspension was drop-coated on the working electrode of SPCE. After drying under an infrared lamp, an appropriate volume of 100 pg / mL BDNF solution was added and incubated for 0, 10, 15, 20, 25, and 30 min, respectively. After rinsing and drying, the current response peak of SPCE in 0.01 M pH=7.4 PBS buffer solution was tested by SWV method. The results are shown in Fig.10 (E) shown.
[0078] Take 18 μL of 2 mg / mL Fc / Apt Cor The / PtPd@COF-Bta-NSs resuspension was drop-coated on the working electrode of SPCE. After drying under an infrared lamp, an appropriate volume of 5 ng / mL cortisol solution was added and incubated for 0, 10, 15, 20, 25, and 30 min, respectively. After rinsing and drying, the current response peak of SPCE in 0.01 M pH=7.4 PBS buffer solution was tested by SWV method. The results are shown in Fig.10 (F) shown.
[0079] According to the above experimental results, when the microfluidic chip sensor of the present invention detects Cortisol and BDNF simultaneously, the binding efficiency and time cost of the two are comprehensively considered, and 30 min is selected as the optimal incubation time.
[0080] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art can still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein by equivalents. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.
Claims
1. A microfluidic electrochemical sensor for simultaneous detection of cortisol and BDNF, characterized in that: The microfluidic electrochemical sensor comprises: A microfluidic chip, the microfluidic chip comprising a cortisol detection chamber connected to the inlet via a first microchannel and a BDNF detection chamber connected to the inlet via a second microchannel; A cortisol electrochemical sensor, comprising an electrode and a probe material modified on the surface of the electrode and consisting of a COF-Bta-NSs-loaded PtPd nanozyme, a cortisol aptamer and ferrocene; and a BDNF electrochemical sensor, wherein the BDNF electrochemical sensor comprises an electrode and a probe material modified on the surface of the electrode and consisting of a COF-Bta-NSs-loaded PtPd nanozyme, a BDNF aptamer and toluidine blue.
2. The microfluidic electrochemical sensor according to claim 1, characterized in that: The COF-Bta-NSs-loaded PtPd nanozyme is obtained by mixing COF-Bta-NSs, PdCl2, H2PtCl4 and a reducing agent in a solvent; Preferably, the mass ratio of COF-Bta-NSs, PdCl2 and H2PtCl4 is 1:0.5~2:1~4, more preferably, the mass ratio is 1:1:2; Preferably, the reducing agent is hydrazine hydrate.
3. The microfluidic electrochemical sensor according to claim 1, characterized in that: The mass ratio of COF-Bta-NSs loaded PtPd nanozyme, cortisol aptamer and ferrocene is 1:0.1:0.5-2.5, preferably, the mass ratio is 1:0.1:
2.
4. The microfluidic electrochemical sensor according to claim 1, characterized in that: The mass ratio of COF-Bta-NSs loaded PtPd nanozyme, BDNF aptamer and toluidine blue is 1:0.1:1-3, preferably, the mass ratio is 1:0.1:2.
5.
5. The microfluidic electrochemical sensor according to claim 1, characterized in that: The sequence of the cortisol aptamer is: 5′-SH-ATGGGCAATGCGGGGTGGAGAATGGTTGCCGCACTTCGGC; The sequence of the BDNF aptamer is: 5′-SH-TCACGACTACAGGTTGGGATAGGTTGGGATAAGTAGTTTA.
6. The microfluidic electrochemical sensor according to claim 1, characterized in that: The electrode is a carbon electrode, preferably a screen-printed carbon electrode.
7. The microfluidic electrochemical sensor according to claim 1, characterized in that: The modified amount of the probe material is 24-40 μg.
8. A method for detecting cortisol and BDNF, comprising: (1) injecting a sample solution to be tested into the microfluidic electrochemical sensor as described in any one of claims 1 to 7 and incubating for a certain period of time; (2) After washing with PBS buffer, the current response of the cortisol electrochemical sensor and the BDNF electrochemical sensor was measured by square wave voltammetry.
9. An electrochemical sensor for detecting cortisol, characterized in that: The electrochemical sensor is the cortisol electrochemical sensor as claimed in claim 1.
10. An electrochemical sensor for detecting BDNF, characterized in that: The electrochemical sensor is the BDNF electrochemical sensor according to claim 1.