Furan ring compound

Abstract

The present application relates to furan ring compounds, and to related salts, solvates, prodrugs, and compositions. The compound can improve liver injury induced by APAP and / or OA / PA, can improve up-regulation of inflammatory factors IL-6 and TNF-alpha and lipid synthesis genes PPAR gamma and FABP1 in the liver injury, can promote expression of a cell proliferation gene Ki67, and can be used as a medicine and a lead compound for treating liver diseases.

Description

Technical Field

[0001] The present application relates to furan ring compounds, and to related salts, solvates, prodrugs and compositions. The compounds improve liver damage induced by APAP and / or OA / PA, improve the upregulation of inflammatory factors IL-6 and TNF-α and lipid synthesis genes PPARy and FABP1 in liver damage, promote the expression of cell proliferation gene Ki67, and can be used as candidate drugs and lead compounds for the treatment of liver diseases. Background Art

[0002] Liver injury is a series of clinical syndromes of liver dysfunction caused mainly by viral infection, drug hepatotoxicity, alcoholism, inflammation, oxidative stress and excessive fat accumulation, including acute liver injury, viral liver injury, alcoholic liver injury and fatty liver injury. Worsening of liver injury can lead to acute or chronic liver failure, cirrhosis, liver fibrosis and even liver cancer. At present, the common characteristics of various types of liver injury are hepatocellular damage, inflammation, oxidative stress and sometimes accompanied by symptoms such as lipid accumulation and insulin resistance. At present, the main clinical treatments for liver injury are liver protectants, immunosuppressants, antiviral drugs and lipid-lowering drugs, but the long-term use of these drugs will produce drug resistance, and there are problems such as low safety, large side effects and single therapeutic targets, which leads to poor efficacy. It is difficult to treat various pathological conditions caused by liver injury at the same time, such as insulin resistance, inflammation, oxidative stress, etc. Summary of the invention

[0003] The present application relates to furan ring compounds, and to related salts, solvates, prodrugs and compositions. The compounds improve liver damage induced by APAP and / or OA / PA, improve the upregulation of inflammatory factors IL-6 and TNF-α and lipid synthesis genes PPARy and FABP1 in liver damage, promote the expression of cell proliferation gene Ki67, and can be used as candidate drugs and lead compounds for the treatment of liver diseases.

[0004] To this end, the embodiments of the present application at least disclose the following technical solutions:

[0005] In the first aspect, the embodiments disclose a compound represented by formula (I):

[0006]

[0007] In a second aspect, the embodiments disclose a compound represented by formula (II):

[0008]

[0009] In the third aspect, the embodiments disclose the optical isomers, labeled compounds, pharmaceutically acceptable salts, solvates or prodrugs of the compounds described in the first or second aspect.

[0010] In a fourth aspect, the embodiments disclose an inflammatory factor inhibitor, comprising the compound described in the first or second aspect, or the pharmaceutically acceptable salt described in the third aspect, or a solvent compound or a prodrug thereof.

[0011] In the fifth aspect, the embodiments disclose a lipid synthesis gene inhibitor, including the compound described in the first or second aspect, or the pharmaceutically acceptable salt described in the third aspect, or a solvent compound or a prodrug thereof.

[0012] In the sixth aspect, the embodiments disclose an expression promoter of the cell proliferation genes Ki67 and Pcna, comprising the compound described in the first or second aspect, or the pharmaceutically acceptable salt described in the third aspect, or a solvent compound or a prodrug thereof.

[0013] In a seventh aspect, an embodiment discloses a composition comprising the compound described in the first or second aspect, or the optical isomer, labeled compound, pharmaceutically acceptable salt, tautomer, solvate or prodrug described in the second aspect, and a pharmaceutically acceptable excipient.

[0014] In an eighth aspect, an embodiment discloses a composition. The composition is composed of the compound described in the first or second aspect, the optical isomer, the labeled compound, the pharmaceutically acceptable salt, the tautomer, the solvate or the prodrug described in the second aspect, and the compound, the pharmaceutically acceptable salt, the solvate or the prodrug, or the composition is used in a medicament.

[0015] In the ninth aspect, the embodiments disclose the use of the compound of the first or second aspect, or the pharmaceutically acceptable salt of the third aspect, or the solvate compound or prodrug thereof, or the composition of the seventh aspect for preparing a drug for treating or preventing a disease, disorder or condition, wherein the disease, disorder or condition is selected from:

[0016] (i) Acute liver injury;

[0017] (ii) viral liver damage;

[0018] (iii) alcoholic liver damage;

[0019] (iv) Fatty liver damage.

[0020] In the tenth aspect, the embodiment discloses a method for preparing the compound described in the first or second aspect. The method comprises: obtaining a crude extract of Malanthus chinensis; and performing at least one of the following steps: extraction, C18 column chromatography, gel chromatography, or HPLC preparative chromatography on the crude extract of Malanthus chinensis. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1The present invention provides a schematic diagram of the preparation of the crude extract of Radix Malan, extraction separation, C18 column chromatography separation, gel column chromatography separation, and MTT method activity screening process at each stage.

[0022] Figure 2 The example provides a schematic diagram of the HPLC separation, structural identification, and MTT activity screening process of Malanthus E3 components at each stage.

[0023] Figure 3 The invention provides the safe concentration determination and activity detection of the n-butanol component and the ethyl acetate component in the extraction process of the embodiment. Figure 3 Middle panel A shows the MTT assay to detect the survival rate of AML-12 cells treated with various concentrations of the n-butanol extract of Malan root. Figure 3 Middle panel B shows the MTT assay to detect the survival rate of AML-12 cells treated with different concentrations of the ethyl acetate extract of Malan root. Figure 3 Figure C in the middle shows the cell survival rate of AML-12 cells after treatment with 100 μg / mL n-butanol fraction of Malan root detected by MTT assay, n=5. Figure 3 Middle panel D shows the ALT level in the supernatant of AML-12 cells after treatment with 100 μg / mL n-butanol fraction of Malan root, n=4. Figure 3 Middle panel E shows the cell survival rate of AML-12 cells after treatment with 100 μg / mL ethyl acetate fraction of Malan root detected by MTT assay, n=5. Figure 3 Figure F in the middle shows the ALT level in the supernatant of AML-12 cells after treatment with 100 μg / mL ethyl acetate fraction of Malan root, n = 4. *P<0.05, **P<0.01, ***P<0.001.

[0024] Figure 4 The effects of the n-butanol component and the ethyl acetate component in the extraction process provided in the examples on the TG level of AML-12 cells stimulated by OA / PA. The TG level in cells of each administration group, n=3, *P<0.05, **P<0.01, ***P<0.001.

[0025] Figure 5 The invention provides the safe concentration determination and activity detection of each separated component of ethyl acetate in the extraction process provided by the embodiment. Figure 5 Figures A and H in the middle are the MTT method to detect the survival rate of AML-12 cells after treatment with each component of AH after separation of Malan root into ethyl acetate. I: MTT method to detect the survival rate of AML-12 cells after treatment with each component of AH. Mean±SD, n=3, *P<0.05, **P<0.01, ***p<0.001.

[0026] Figure 6Effects of the ethyl acetate fractions in the extraction process provided in the examples on ALT in the ALI cell model. Effects of the BH fractions on the elevated ALT in the supernatant of AML-12 cells induced by APAP. Mean ± SD, n = 3, *P < 0.05.

[0027] Figure 7 Effects of various components of ethyl acetate in the extraction process provided in the examples on the TG levels of AML-12 cells stimulated by OA / PA. Improvement of various components of BH on the increase of TG in AML-12 cells induced by OA / PA. Mean±SD, n=3, *P<0.05.

[0028] Figure 8 The E component and the G component provided in the examples were separated and their component activities were tested. Figure 8 Middle panel A shows the detection of ALT in the supernatant of AML-12 cells after treatment with components E and G. Figure 8 Middle panel B shows the MTT assay for detecting the cell death rate of AML-12 cells in the APAP model after treatment with components E1-E3 after separation of Malan root E components. Figure 8 Middle panel C shows the detection of ALT in the supernatant of AML-12 cells after treatment with Malan Root E1-E3 components, n=3. Figure 8 The middle figure D shows the MTT method for detecting the AML-12 cell death rate after treatment with the G1-G5 components obtained after separation of the G component of Malan root. Figure 8 Middle panel E shows the detection of ALT in the supernatant of AML-12 cells after treatment with Malan Root G1-G5 fractions. Mean±SD, *P<0.05, **P<0.01, ***P<0.001. Figure 8 Figure F in the middle shows the improving effect of Malan root E component on the increased TG levels stimulated by OA / PA.

[0029] Fig. 9 The activity test of each fraction of the E3 component provided in the example was prepared and separated by HPLC. Fig. 9 Middle panel A shows the survival rate of AML-12 cells under APAP treatment after administration of each separated component of E3. Fig. 9 Middle panel B shows the detection of ALT in the supernatant of AML-12 cells after treatment with the separated components of E3. Fig. 9 Figure C shows the TG levels of AML-12 cells after separation of E3 components. Mean±SD, n=3*P<0.05.

[0030] Fig.10 The E3 component provided in the example was prepared by HPLC and separated into 15-20min compound segments, and the activity of each component was tested. Fig.10 Middle panel A shows the survival rate of AML-12 cells after treatment with the 15-20min components. Fig.10Middle panel B shows the ALT level in the supernatant of AML-12 cells after treatment with the E315-20min component. Fig.10 Figure C in the middle shows the effect of E3-15 min component and E3-20 min component on the relative expression level of intracellular Pcna gene mRNA. Fig.10 Figure D in the middle shows the effect of E3-15 min component and E3-20 min component on the relative expression level of intracellular Ki-67 gene mRNA. Fig.10 Figure E in the middle shows the effect of E3-15 min component and E3-20 min component on the relative expression of intracellular TNF-α gene mRNA. Fig.10 Figure F in the middle shows the effect of E3-15 min fraction and E3-20 min fraction on the relative expression of intracellular IL-1β gene mRNA. Mean±SD, n=3, *P<0.05.

[0031] Fig.11 The activity of the E3 component provided in the example was tested by HPLC separation of the 15-20min compound on OA / PA stimulated cells. Fig.11 The middle panel A shows the TG level of AML-12 cells after treatment with the separated components in the 15-20 min period. Fig.11 Figure B in the middle shows the effect of E3-15 min component and E3-20 min component on the relative expression level of intracellular fabp1 gene. Fig.11 Figure C in the middle shows the effect of E3-15 min fraction and E3-20 min fraction on the relative expression of intracellular ppary gene. Mean±SD, *P<0.05, **P<0.01, ***P<0.001n=3.

[0032] Fig.12 The MS result of the E3-15min component provided in the example has a relative molecular mass of 178.

[0033] Fig.13 The E3-15min component provided in the embodiment 1 H-NMR results (600 MHz, CD3OD).

[0034] Fig.14 The E3-15min component provided in the embodiment 13 C-NMR results (200 MHz, CD3OD).

[0035] Fig.15 NOESY results of the E3-15min component provided in the examples.

[0036] Fig.16The MS result of the E3-20min component provided in the example has a relative molecular mass of 178.

[0037] Fig.17 The E3-20min component provided in the embodiment 1 H-NMR results (600 MHz, CD3OD).

[0038] Fig.18 The E3-20min component provided in the embodiment 13 C-NMR results (200 MHz, CD3OD).

[0039] Fig.19 COSY results of the E3-20min component provided in the Examples.

[0040] Fig. 20 HSQC results of the E3-20min component provided in the Examples.

[0041] Fig.21 HMBC results for the E3-20min component provided in the Examples.

[0042] Fig. 22 NOESY results of the E3-20min component provided in the examples. DETAILED DESCRIPTION

[0043] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application is further described in detail below in conjunction with the examples. It should be understood that the specific embodiments described herein are only used to explain the present application and are not intended to limit the present application. The reagents not described separately in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not described in detail are all conventional experimental methods and can be obtained from the prior art.

[0044] Definitions and terms

[0045] References throughout this specification to "some embodiments" or "an embodiment" mean that a particular feature, structure, or characteristic described in association with the embodiment is included in at least one embodiment. Thus, the phrases "in one embodiment" or "in an embodiment" appearing in various places throughout this specification may not all refer to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments. Furthermore, unless the content clearly dictates otherwise, as used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents. It should also be noted that the term "or" is generally employed in its sense including "and / or", unless the content clearly dictates otherwise.

[0046] Unless otherwise indicated, the following terms as used in this application have the following meanings:

[0047] The term "treatment" refers equally to curative therapy and ameliorative or palliative therapy. The term includes obtaining a beneficial or desired physiological result, which may or may not be clinically determined. Beneficial or desired clinical results include, but are not limited to, detectable or undetectable symptom relief, symptom prevention, disease degree reduction, disease stabilization (i.e., no aggravation), delay or slowing of disease / symptom progression / aggravation, disease / symptom improvement or relief, and reduction (whether partial or complete). The term "relief" and its variations as used in this application mean to reduce the degree and / or undesirable manifestation and / or slow down or prolong the time course of progression of physiological disorders or symptoms compared to not applying the compound, salt, solvate, prodrug or pharmaceutical composition of the present invention. The term "prevention" as used in this application in relation to a disease, disorder or illness refers to a prophylactic or preventive therapy and a therapy that reduces the risk of suffering from a disease, disorder or illness. The term "prevention" includes both avoiding the occurrence of a disease, disorder or illness and delaying the onset of a disease, disorder or illness. Any statistically significant (p≤0.05) avoidance of occurrence, delay in onset, or reduction in risk as measured by a controlled clinical trial can be considered prevention of a disease, disorder, or condition. Subjects suitable for prevention include those subjects who have an increased risk of a disease, disorder, or condition as identified by genetic or biochemical markers.

[0048] Compound

[0049] The embodiment discloses a compound of formula (I)

[0050] The embodiment discloses a compound of formula (II) Optical isomers of compounds

[0051] In some embodiments, the compound described in formula (I) or (II) exists in the form of optical isomers. The compound described in formula (I) or (II) includes all diastereomers, enantiomers and diastereomers and their corresponding mixtures. In the additional embodiment of the compound and method provided in the present application, the mixture of enantiomers and / or diastereomers produced by a single preparation step, combination or mutual conversion can be used for the application described in the present application. In some embodiments, the compound described in formula (I) or (II) is prepared into their single optical isomers in the following manner: the racemic mixture of the compound is reacted with an optically active resolving agent to form a pair of diastereomeric compounds, the diastereomers are separated, and the optically pure enantiomers are recovered. In some embodiments, dissociable complexes are preferred. In some embodiments, diastereomers have different physical properties (such as melting point, boiling point, solubility, reactivity, etc.), and are separated by utilizing these dissimilarity. In some embodiments, diastereomers are separated by chiral chromatography, or preferably, by separation / resolving techniques based on solubility differences.

[0052] Labeled compounds

[0053] In some embodiments, the compounds described by formula (I) or (II) exist in their isotopically labeled form. In some embodiments, the methods disclosed herein include methods of treating diseases by administering such isotopically labeled compounds. In some embodiments, the methods disclosed herein include methods of treating diseases by administering such isotopically labeled compounds in the form of pharmaceutical compositions. Therefore, in some embodiments, the compounds disclosed herein include isotopically labeled compounds, which are the same as those described in the present application, except that one or more atoms are replaced by atoms having an atomic mass or mass number different from the atomic mass or mass number normally found in nature. Examples of isotopes that can be incorporated into the compounds disclosed herein include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, and chlorine, such as 2 H. 3 H. 13 C. 14 C. 15 N. 18 O. 17 O. 31 P. 32 P. 35 S. 18 F and 36 Cl. Compounds of formula (I) or (II) and pharmaceutically acceptable salts, solvates or optical isomers thereof containing the above-mentioned isotopes and / or other isotopes of other atoms are within the scope of the present application. Certain isotopically labeled compounds, for example radioactive isotopes such as 3 H and14 Those into which C is incorporated can be used in drug and / or substrate tissue distribution assays. 3 H) and carbon-14 (i.e. 14 C) isotopes are particularly preferred due to their ease of preparation and detectability. In addition, heavy isotopes such as deuterium (i.e. 2 H) may result in certain therapeutic advantages resulting from greater metabolic stability, such as increased in vivo half-life or reduced dosage requirements.

[0054] In some embodiments, the compounds described by Formula (I) or (II) are labeled by other means, including but not limited to the use of chromophores or fluorescent moieties, bioluminescent labels, or chemiluminescent labels.

[0055] Pharmaceutically acceptable salts

[0056] In some embodiments, the compounds described in formula (I) or (II) exist in the form of their pharmaceutically acceptable salts. In some embodiments, the methods disclosed herein include methods for treating diseases by administering such pharmaceutically acceptable salts. In some embodiments, the methods disclosed herein include methods for treating diseases by administering such pharmaceutically acceptable salts in the form of pharmaceutical compositions.

[0057] In some embodiments, the compound described in formula (I) or (II) has an acidic or basic group, and therefore reacts with any of a number of inorganic or organic bases and inorganic and organic acids to form a pharmaceutically acceptable salt. In some embodiments, these salts are prepared in situ during the final separation and purification of the compounds disclosed herein or their solvates or optical isomers, or by using the purified compound in its free form alone to react with a suitable acid or base, and separating the salts thus formed.

[0058] Examples of pharmaceutically acceptable salts include those prepared by reaction of a compound described by formula (I) or (II) with a mineral acid, an organic acid or an inorganic base, such salts include acetate, acrylate, adipate, alginate, aspartate, benzoate, benzenesulfonate, bisulfate, bisulfite, bromide, butyrate, butyne-1,4-dioate, camphorate, camphorsulfonate, hexanoate, octanoate, chlorobenzoate, chloride, citrate, cyclopentanepropionate, decanoate, digluconate, dihydrogen phosphate, dinitrobenzoate, dodecyl sulfate, ethanesulfonate, formate, fumarate, gluconate heptanoate, glycerophosphate, glycolate, hemisulfate, heptanoate, hexanoate, hexyne-1,6-dioate, hydroxybenzoate, γ-hydroxy The salts of benzoic acid and benzoic acid are bis(2-hydroxy-2-nitro-1-ol)-1-propionate, bis(2-hydroxy-2-nitro-1-ol)-1-propionate, bis(2-hydroxy-2-nitro-1-ol)-1-propionate, bis(2-hydroxy-2-nitro-1-ol)-1-propionate, bis(2-hydroxy-2-nitro-1-ol)-1-propionate, bis(2-hydroxy-2-nitro-1-ol)-1-propionate, bis(2-hydroxy-2-nitro-1-ol)-1-propionate, bis(2-hydroxy-2-nitro-1-ol)-1-propionate, bis(2-hydroxy-2-nitro-1-ol)-1-propionate, bis(2-hydroxy-2-nitro-1-ol)-1-propionate, bis(2-hydroxy-2-nitro-1-ol)-1-propionate, bis(2-hydroxy-2-nitro-1-ol)-1-propionate, bis(2-hydroxy-2-nitro-1-ol)-1-propionate

[0059] In addition, the compound described in formula (I) or (II) can be prepared into a pharmaceutically acceptable salt by reacting the free base form of the compound with a pharmaceutically acceptable inorganic or organic acid, wherein the pharmaceutically acceptable inorganic or organic acid includes but is not limited to inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, metaphosphoric acid, etc.; and organic acids such as acetic acid, propionic acid, hexanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, p-toluenesulfonic acid, tartaric acid, trifluoroacetic acid, citric acid, benzoic acid, Acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, mandelic acid, arylsulfonic acid, methanesulfonic acid, ethanesulfonic acid, 1,2-ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, 2-naphthalenesulfonic acid, 4-methylbicyclo-[2.2.2]oct-2-ene-1-carboxylic acid, glucoheptonic acid, 4,4'-methylenebis-(3-hydroxy-2-ene-1-carboxylic acid), 3-phenylpropionic acid, trimethylacetic acid, tert-butylacetic acid, lauryl sulfuric acid, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid and muconic acid. In some embodiments, other acids such as oxalic acid, although not pharmaceutically acceptable per se, are used to prepare salts that can be used as intermediates in obtaining the compounds disclosed herein, their solvates or optical isomers, and their pharmaceutically acceptable acid addition salts.

[0060] In some embodiments, those compounds described herein that contain free acid groups are reacted with a suitable base, such as a pharmaceutically acceptable hydroxide, carbonate, bicarbonate, sulfate of a metal cation; with ammonia; or with a pharmaceutically acceptable organic primary, secondary, tertiary or quaternary amine. Representative salts include alkali metal or alkaline earth metal salts, such as lithium, sodium, potassium, calcium and magnesium salts, and aluminum salts, etc. Illustrative examples of bases include sodium hydroxide, potassium hydroxide, choline hydroxide, sodium carbonate, N+(C1-4 alkyl)4, etc.

[0061] Representative organic amines that can be used to form base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine, etc. It should be understood that the compounds described in formula (I) or (II) also include the quaternization of any basic nitrogen-containing groups they contain. In certain embodiments, water or oil soluble or dispersible products are obtained by such quaternization.

[0062] Solvate

[0063] In some embodiments, the compound described in formula (I) or (II) exists in the form of a solvate. The present application provides a method for treating a disease by administering such a solvate. The present application also provides a method for treating a disease by administering such a solvate in the form of a pharmaceutical composition.

[0064] Solvates contain a stoichiometric or non-stoichiometric amount of solvent, and in some embodiments, are formed during the process of crystallization with a pharmaceutically acceptable solvent such as water, ethanol, etc. When the solvent is water, a hydrate is formed, or when the solvent is alcohol, an alcoholate is formed. Solvates of compounds described in formula (I) or (II) can be conveniently prepared or formed during the process described in the present application. For example only, hydrates of compounds described in formula (I) or (II) can be conveniently prepared by recrystallization from an aqueous / organic solvent mixture using an organic solvent including but not limited to dioxane, tetrahydrofuran or methanol. In addition, the compounds provided herein can exist in unsolvated forms as well as solvated forms. In general, for the purposes of the compounds and methods provided herein, solvated forms are considered to be equivalent to unsolvated forms.

[0065] Tautomer

[0066] In some cases, the compound exists in the form of tautomers. The compound described in formula (I) or (II) includes all possible tautomers within the formula described in the present application. Tautomers are compounds that can be mutually converted by the migration of hydrogen atoms, and the migration is accompanied by the conversion of single bonds and adjacent double bonds. In the bonding arrangement in which tautomerism is likely to occur, there will be a chemical equilibrium of tautomers. All tautomeric forms of compounds disclosed in the present application are considered. The exact ratio of tautomers depends on several factors, including temperature, solvent and pH.

[0067] Prodrug

[0068] Some embodiments provide prodrugs of compounds described in formula (I) or (II). Prodrugs are compounds that are converted in whole or in part into compounds of the present application when administered to a subject (e.g., a human). In most embodiments, prodrugs are pharmacologically inert chemical derivatives that can be converted into active drug molecules in vivo to exert therapeutic effects. Any compound described herein can be administered in the form of a prodrug to increase the activity, bioavailability, or stability of the compound or to otherwise change the properties of the compound. Typical examples of prodrugs include compounds having biologically unstable protective groups on the functional portion of the active compound. Prodrugs include, but are not limited to, compounds that can be oxidized, reduced, aminated, deaminated, hydroxylated, dehydroxylated, hydrolyzed, dehydrated, alkylated, dealkylated, acylated, deacylated, phosphorylated, and / or dephosphorylated to produce active compounds. The present application also encompasses salts and solvates of the prodrugs described above.

[0069] The compounds, salts, solvates and prodrugs of the present application may contain at least one chiral center. Therefore, the compounds, salts, solvates and prodrugs may exist in at least two isomeric forms. The present application encompasses the racemic mixtures of compounds, salts, solvates and prodrugs of the present application and enantiomerically enriched and substantially enantiomerically pure isomers. For the purposes of the present application, the isomers of the "substantially enantiomers" of the compounds contain less than 5% other isomers of the same compound by weight, more typically less than 2%, and most typically less than 0.5%.

[0070] Pharmaceutically acceptable excipients

[0071] Conventional procedures for selecting and preparing suitable pharmaceutical preparations are described, for example, in “AμLton's Pharmaceutics—The Design and Manufacture of Medicines”, MEAμLton and KMG Taylor, Churchillμ Livingstone Elsevier, 4th edition, 2013.

[0072] Pharmaceutically acceptable excipients (including adjuvants, diluents or carriers) that can be used in the pharmaceutical composition of the present application are those pharmaceutically acceptable excipients commonly used in the field of drug formulation, and include (but are not limited to) sugars, sugar alcohols, starches, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins (such as human serum albumin), buffer substances (such as phosphates, glycerol, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silicon dioxide, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethyl cellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and lanolin).

[0073] treat

[0074] The present application provides a method for preventing or treating liver damage and / or fatty liver in a subject by administering a composition disclosed in the present application (i.e., a compound and / or composition comprising formula (I) or formula (II)) to a subject (e.g., a subject in need thereof).

[0075] In some embodiments, the subject may have or be susceptible to liver injury and / or fatty liver. Liver injury may be caused by any condition that causes liver cells (i.e., hepatocytes) to die or otherwise function abnormally. Examples of conditions that may cause liver injury include, but are not limited to, cancer (e.g., liver cancer, cholangiocarcinoma, or hepatic adenoma), trauma, inborn errors of metabolism (e.g., inherited metabolic disorders that cause enzyme deficiency), vascular injury, cirrhosis, viral infections (e.g., hepatitis A, hepatitis B, hepatitis E), autoimmune diseases (e.g., autoimmune hepatitis, primary biliary cirrhosis, or primary sclerosing cholangitis), hemochromatosis, hyperoxaluria, oxalate deposition disease, Wilson's disease, or drug-induced hepatotoxicity (e.g., alcohol-induced hepatotoxicity or acetaminophen-induced hepatotoxicity). Fatty liver may be caused by any condition that causes fat accumulation in the liver. These conditions may be, but are not limited to, nonalcoholic fatty liver disease or alcoholic liver disease.

[0076] The present application discloses a method for treating or preventing age-related symptoms or diseases, which includes administering a composition disclosed in the present application. The present application provides a method for reducing the amount of alanine aminotransferase (ALT) and / or aspartate aminotransferase (AST) in a subject, which includes administering a composition provided by the subject. AST and ALT are quite sensitive indicators of liver damage or injury from different types of diseases or conditions, and they are usually measured in liver tests or liver blood tests. Elevated levels of AST and ALT are related to liver damage and liver dysfunction. In some embodiments, after administration of the composition, ALT is reduced in a subject by at least 0.1 U / L, at least 0.2 U / L, at least 0.3 U / L, at least 0.4 U / L, at least 0.5 U / L, at least 0.6 U / L, at least 0.7 U / L, at least 0.8 U / L, at least 0.9 U / L, at least 1.0 U / L, 1.1 U / L, at least 1.2 U / L, at least 1.3 U / L, at least 1.4 U / L, at least 1.5 U / L, at least 1.6 U / L, at least 1.7 U / L, at least 1.8 U / L, at least 1.9 U / L, at least 2.0 U / L, at least 2.1 U / L, at least 2.2 U / L, at least 2.3 U / L, at least 2.4 U / L, at least 2.5 U / L, at least 2.6 U / L, at least 2.7 U / L, at least 2.8 U / L, at least 2.9 U / L .6 U / L, at least 1.7 U / L, at least 1.8 U / L, at least 1.9 U / L, at least 2.0 U / L, 2.1 U / L, at least 2.2 U / L, at least 2.3 U / L, at least 2.4 U / L, at least 2.5 U / L, at least 2.6 U / L, at least 2.7 U / L, at least 2.8 U / L, at least 2.9 U / L, at least 3.0 U / L, at least 3.5 U / L, 4.0 U / L, at least 4.5 U / L or at least 5.0 U / L. In some embodiments, after administration of the composition, ALT is reduced by at least 0.1 U / L, at least 0.2 U / L, at least 0.3 U / L, at least 0.4 U / L, at least 0.5 U / L, at least 0.6 U / L, at least 0.7 U / L, at least 0.8 U / L, at least 0.9 U / L, at least 1.0 U / L, 1.1 U / L, at least 1.2 U / L, at least 1.3 U / L, at least 1.4 U / L, at least 1.5 U / L, at least 1.6 U / L. / L, at least 1.7 U / L, at least 1.8 U / L, at least 1.9 U / L, at least 2.0 U / L, 2.1 U / L, at least 2.2 U / L, at least 2.3 U / L, at least 2.4 U / L, at least 2.5 U / L, at least 2.6 U / L, at least 2.7 U / L, at least 2.8 U / L, at least 2.9 U / L, at least 3.0 U / L, at least 3.5 U / L, 4.0 U / L, at least 4.5 U / L or at least 5.0 U / L.

[0077] Actual dosage levels and administration regimens of the compositions disclosed herein may be varied to obtain an amount of the compound of Formula (I) or Formula (II) and / or composition that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.

[0078] In some embodiments, administering the composition includes administering the composition with one or more doses. In some embodiments, administering the composition includes administering the composition with one or more, five or more, ten or more, twenty or more, thirty or more, forty or more, fifty or more, one hundred or more, or one thousand or more doses. In some embodiments, the dosage comprises at least 25 mg, at least 50 mg, at least 75 mg, at least 100 mg, at least 125 mg, at least 150 mg, at least 200 mg, at least 225 mg, at least 250 mg, at least 275 mg, at least 300 mg, at least 325 mg, at least 350 mg, at least 375 mg, at least 400 mg, at least 425 mg, at least 450 mg, at least 475 mg, at least 500 mg, at least 550 mg, at least 600 mg, at least 650 mg, at least 700 mg, at least 750 mg, at least 800 mg or at least 850 mg of formula (I) or compound of formula (II).

[0079] The compositions disclosed herein can be administered over any time period that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration and is non-toxic to the patient. The time period can be at least 1 day, at least 10 days, at least 20 days, at least 30 days, at least 60 days, at least 3 months, at least 6 months, at least 1 year, at least 3 years, at least 5 years, or at least 10 years. The dosage can be administered as needed, sporadically, or at regular intervals. For example, the dosage can be administered monthly, weekly, twice a week, three times a week, once a day, or twice a day.

[0080] Drug administration

[0081] In certain embodiments, a composition containing one or more compounds described herein is administered for preventive and / or therapeutic treatment. In certain therapeutic applications, the composition is administered to a patient already suffering from the disease or disorder in an amount sufficient to cure or at least partially curb at least one symptom of the disease or disorder. The amount effective for this use depends on the severity and course of the disease or disorder; previous therapy; the patient's health, weight, and response to the drug; and the judgment of the treating physician. The therapeutically effective amount is optionally determined by methods including, but not limited to, dose escalation and / or dose range clinical trials.

[0082] In preventive applications, a composition containing a compound described herein is administered to a patient who is susceptible to or otherwise at risk for a particular disease, condition, or illness. Such an amount is defined as a "prophylactically effective amount or dose". In this use, the exact amount also depends on the patient's health status, weight, etc. When used in a patient, the effective amount for this use will depend on the severity and course of the disease; previous therapy; the patient's health status and response to the drug; and the judgment of the treating physician. In one aspect, preventive treatment includes administering a pharmaceutical composition comprising a compound described herein or a pharmaceutically acceptable salt thereof to a mammal that has previously experienced at least one symptom or risk factor for the disease being treated and is currently in remission to prevent the recurrence of symptoms of the disease or illness.

[0083] In certain embodiments where the patient's condition does not improve, at the discretion of the physician, administration of the compound is continued chronically, that is, for an extended period of time, including for the entire duration of the patient's life, to ameliorate or otherwise control or limit the symptoms of the patient's disease or disorder.

[0084] In certain embodiments where the patient's condition improves, the dose of the administered drug is temporarily reduced or temporarily stopped for a certain length of time (i.e., a "drug holiday"). In specific embodiments, the duration of the drug holiday is between 2 days and 1 year, including, by way of example only, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 15 days, 20 days, 28 days, or more than 28 days. By way of example only, the dose reduction during the drug holiday is 10%-100%, including, by way of example only, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, and 100%.

[0085] Once the patient's condition has improved, a maintenance dose is administered if necessary. Subsequently, in specific embodiments, the dosage or frequency of administration, or both, is reduced to a level that maintains the improved disease, disorder, or condition, as varied by symptoms. However, in certain embodiments, after any recurrence of symptoms, the patient requires long-term intermittent or daily treatment.

[0086] The amount corresponding to such an amount for a given agent varies depending on factors such as the specific compound, the disease state and its severity, the identity (e.g., weight, sex) of the subject or host in need of treatment, and is however determined according to the particular circumstances surrounding the case, including, for example, the specific agent being administered, the route of administration, the condition being treated, and the subject or host being treated.

[0087] However, in general, dosages for adult treatment are generally in the range of 0.01 mg to 5000 mg per day. In one aspect, dosages for adult treatment are from about 1 mg to about 1000 mg per day. In one embodiment, the desired dosage is conveniently provided in a single dose or in divided doses, which are administered simultaneously or at appropriate intervals, for example, in two, three, four or more sub-doses per day.

[0088] In one embodiment, the daily dose suitable for the compound described herein or its pharmaceutically acceptable salt is about 0.01 to about 50 mg per kg body weight. In some embodiments, based on many variables about a single treatment regimen, the amount of active substance in the daily dose or dosage form is lower or higher than the scope indicated in the application. In various embodiments, the daily dose and unit dose are changed depending on many variables, including but not limited to the activity of the compound used, the disease or illness to be treated, the mode of administration, the needs of a single subject, the severity of the disease or illness treated, and the judgment of the practitioner.

[0089] The toxicity and therapeutic efficacy of such treatment regimens are determined in cell culture or experimental animals by standard drug procedures, including but not limited to determining LD10 and ED90. The dose ratio between toxic effects and therapeutic effects is the therapeutic index, and it is expressed as the ratio between LD10 and ED90. In certain embodiments, the data obtained from cell culture assays and animal studies are used to formulate effective daily dose ranges and / or effective unit doses for treatment in mammals including humans. In certain embodiments, the daily dose of the compound described herein is within the range of circulating concentrations including ED50 with minimal toxicity. In certain embodiments, depending on the dosage form used and the route of administration utilized, daily dose ranges and / or unit doses vary within this range.

[0090] In any of the above-mentioned aspects are further embodiments wherein an effective amount of a compound described herein or a pharmaceutically acceptable salt thereof is: (a) systemically administered to a mammal; and / or (b) orally administered to a mammal; and / or (c) intravenously administered to a mammal; and / or (d) administered to a mammal by injection; and / or (e) topically administered to a mammal; and / or (f) non-systemically or locally administered to a mammal.

[0091] Within any of the above-mentioned aspects are other embodiments comprising a single administration of an effective amount of the compound, including other embodiments wherein: (i) the compound is administered once a day; or (ii) the compound is administered to the mammal multiple times over the span of a day.

[0092] In any of the above mentioned aspects are other embodiments comprising multiple administrations of an effective amount of the compound, including the following other embodiments: wherein (i) the compound is administered continuously or intermittently: such as in a single dose; (ii) the time between multiple administrations is every 6 hours; (iii) the compound is administered to a mammal every 8 hours; (iv) the compound is administered to a subject every 12 hours; (v) the compound is administered to a subject every 24 hours. In other or alternative embodiments, the method includes a drug holiday, wherein the administration of the compound is temporarily stopped, or the dose of the compound administered is temporarily reduced; at the end of the drug holiday, administration of the compound is resumed. In one embodiment, the duration of the drug holiday varies from 2 days to 1 year.

[0093] Route of administration

[0094] Suitable routes of administration include, but are not limited to, oral, intravenous, rectal, aerosol, parenteral, ocular, pulmonary, transmucosal, transdermal, vaginal, aural, nasal, and topical administration. In addition, parenteral delivery includes, by way of example only, intramuscular, subcutaneous, intravenous, intramedullary injection, as well as intrathecal, direct intraventricular, intraperitoneal, intralymphatic, and intranasal injection.

[0095] In certain embodiments, the compounds as described herein are administered in a local rather than systemic manner, for example, by direct injection of the compound into an organ, usually in the form of a reservoir formulation or a sustained release formulation. In a specific embodiment, the long-acting formulation is administered by implantation (e.g., subcutaneous or intramuscular implantation) or by intramuscular injection. In addition, in other embodiments, the drug is delivered in a targeted drug delivery system, for example, in a liposome coated with an organ-specific antibody. In such embodiments, the liposome is targeted to an organ and selectively absorbed by the organ. In other embodiments, the compounds as described herein are provided in the form of a rapid release formulation, in the form of an extended release formulation, or in the form of a medium release formulation. In other embodiments, the compounds described herein are administered topically.

[0096] Pharmaceutical compositions / preparations

[0097] The compounds described herein are administered to a subject in need thereof in the form of a pharmaceutical composition, either alone or in combination with a pharmaceutically acceptable carrier, excipient or diluent according to standard pharmaceutical practice. In one embodiment, the compounds of the present invention may be administered to an animal. The compounds may be administered orally or parenterally, including intravenous, intramuscular, intraperitoneal, subcutaneous, rectal and topical routes of administration.

[0098] On the other hand, the present application provides a pharmaceutical composition comprising a compound or optical isomer, a labeled compound, a pharmaceutically acceptable salt, a tautomer, a solvate or a prodrug described herein and at least one pharmaceutically acceptable excipient. The pharmaceutical composition is prepared in a conventional manner using one or more pharmaceutically acceptable excipients that help process the active compound into a pharmaceutically usable preparation. Appropriate formulations depend on the selected route of administration. An overview of the pharmaceutical compositions described herein can be found, for example, in Remington: The Science and Practice of Pharmacy, Nineteenth Edition (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H. A. and Lachman, μL., eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, NY, 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Edition (Lippincott Williams & Wilkins 1999), which are incorporated herein by reference for such disclosure.

[0099] In some embodiments, the pharmaceutically acceptable excipient is selected from carriers, binders, fillers, suspending agents, flavoring agents, sweeteners, disintegrants, dispersants, surfactants, lubricants, colorants, diluents, solubilizers, wetting agents, plasticizers, stabilizers, penetration enhancers, wetting agents, defoamers, antioxidants, preservatives, and any combination thereof.

[0100] The pharmaceutical compositions described herein are administered to a subject by an appropriate route of administration, including, but not limited to, oral, parenteral (e.g., intravenous, subcutaneous, intramuscular), intranasal, buccal, topical, rectal, or transdermal routes of administration. Pharmaceutical formulations described herein include, but are not limited to, aqueous liquid dispersions, liquids, gels, syrups, elixirs, slurries, suspensions, self-emulsifying dispersions, solid solutions, liposomal dispersions, aerosols, solid oral dosage forms, powders, immediate release formulations, controlled release formulations, fast melt formulations, tablets, capsules, pills, powders, dragees, effervescent formulations, lyophilized formulations, delayed release formulations, extended release formulations, pulsed release formulations, multi-particulate formulations, and mixed immediate and controlled release formulations.

[0101] Pharmaceutical compositions including compounds or optical isomers, labeled compounds, pharmaceutically acceptable salts, tautomers, solvates or prodrugs described herein are manufactured in a conventional manner, such as, by way of example only, by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or compression processes.

[0102] The pharmaceutical composition for oral use is obtained by mixing one or more solid excipients with one or more compounds described in the present application, optionally grinding the resulting mixture, and processing the mixture of particles after adding suitable auxiliary agents to obtain tablets or dragee cores when necessary. Suitable excipients include, for example, fillers, such as sugars, including lactose, sucrose, mannitol or sorbitol; cellulose preparations, such as corn starch, wheat starch, rice starch, potato starch, gelatin, tragacanth, methylcellulose, microcrystalline cellulose, hydroxypropyl methylcellulose, sodium carboxymethylcellulose; or other excipients, such as polyvinyl pyrrolidone (PVP or povidone) or calcium phosphate. If necessary, disintegrants such as cross-linked sodium carboxymethyl cellulose, polyvinyl pyrrolidone, agar or alginic acid or its salt, such as sodium alginate, are added. In some embodiments, dyes or pigments are added to tablets or dragee coatings for identification or characterization of different combinations of active compound dosages.

[0103] Pharmaceutical compositions for oral administration include push-fit capsules made of gelatin and soft, sealed capsules made of gelatin and a plasticizer such as glycerol or sorbitol. Push-fit capsules contain a blend of the active ingredient with a filler such as lactose, a binder such as starch, and / or a lubricant such as talc or magnesium stearate and optionally a stabilizer. In soft capsules, the active compound is dissolved or suspended in a suitable liquid, such as a fatty oil, liquid paraffin, or liquid polyethylene glycol. In some embodiments, a stabilizer is added.

[0104] The pharmaceutical composition for parenteral use is formulated into an infusion or injection. In certain embodiments, the pharmaceutical composition suitable for injection or infusion includes a sterile aqueous solution or dispersion or sterile powder comprising a compound or optical isomer described herein, a labeled compound, a pharmaceutically acceptable salt, a tautomer, a solvate or a prodrug. In certain embodiments, the pharmaceutical composition includes a liquid carrier. In certain embodiments, the liquid carrier is a solvent or a liquid dispersion medium, including, for example, water, saline, ethanol, a polyol (such as glycerol, propylene glycol, liquid polyethylene glycol, etc.), a vegetable oil, a non-toxic glyceride and any combination thereof. In certain embodiments, the pharmaceutical composition also includes a preservative to prevent microbial growth.

[0105] Preparation of compounds of formula (I) or (II)

[0106] The main active substance in the root of Aster indicus μL. that exerts its efficacy in the treatment of liver diseases is not yet clear. This application uses a series of technical means to first perform a preliminary separation of the chemical substances in the root of Aster indicus, uses in vitro activity experimental technology to determine the main separated components, and finally separates the monomer compounds. This application uses infiltration method, silica gel column chromatography, gel column chromatography, HPLC and other technical means to isolate two new furan ring compounds from the root of Aster indicus for the first time, and they have the effect of protecting the liver.

[0107] The embodiment provides a method for preparing the compound of formula (I) or (II). The method comprises obtaining a crude extract of Malanthus annuus; and subjecting the crude extract of Malanthus annuus to at least one of extraction, C18 column chromatography, gel chromatography, or HPLC preparative chromatography.

[0108] 1. Preparation of compounds of formula (I) or (II)

[0109] (1) Preparation of Malan Root Crude Extract

[0110] like Figure 1 As shown, 5 kg of dried Malan root medicinal materials (from Anhui Kanghe Chinese Medicine Technology Co., Ltd.) are taken, crushed by a pulverizer and placed in a 25L soaking bucket for standby use. 15L of methanol is added to the soaking bucket, and the methanol needs to soak the Malan root medicinal materials for 2 weeks. After 2 weeks, the soaking liquid is taken, the Malan root medicinal material residue is filtered, and the soaking liquid is suspended and refrigerated for storage. Recover the methanol and soak the Malan root medicinal materials again, and repeat steps 2 and 3 three times. The accumulated suspension is the crude extract of Malan root.

[0111] (2) Extraction of Malan Root Crude Extract

[0112] like Figure 1 As shown, the crude extract of Malan root was subjected to a first extraction using a solvent of ethyl acetate and water in a volume ratio of 3:1; the aqueous phase solution obtained from the first extraction was collected and mixed with n-butanol in a volume ratio of 1:1 for a second extraction; the aqueous phase solution, ethyl acetate phase solution and n-butanol phase solution obtained from the first extraction and the second extraction were screened using the MTT method, and the results showed that the ethyl acetate phase solution contained active ingredients.

[0113] (3) C18 silica gel column separation

[0114] like Figure 1As shown, the ethyl acetate phase solution obtained above was concentrated, spin-dried, and loaded onto a C18 silica gel column (inner diameter 5 cm, 50 g 200 mesh silica gel in total), and a solvent with a volume ratio of dichloromethane to methanol of 100:1 was used as the mobile phase for elution for 2 column volumes, and the compound components eluted and separated by each gradient mobile phase were collected in a 15 mL test tube. The eluted substances with similar substances were combined and suspended to dryness using the thin layer chromatography plate UV-356nm and UV-254nm data to obtain eight components A, B, C, D, E, F, G, and H. It was found that component E contained active ingredients by MTT detection.

[0115] (4) Gel column chromatography separation of E component

[0116] like Figure 1 As shown, after using the solvent E component with a volume ratio of 100:1 between methyl chloride and methanol, the sample was loaded onto a gel column Sephadex LH-20 (Pharmacia, Sweden), and a solvent with a volume ratio of 100:1 between dichloromethane and methanol was used as an eluent, and eluted for 2 column volumes. The eluted substances with similar substances were combined and suspended to dryness using the thin layer chromatography plate UV-356nm and UV-254nm data to obtain five components E1 to E5. After detection by the MTT method and TG method, it was found that the E3 component had the highest activity.

[0117] (5) HPLC purification of E3 component

[0118] like Figure 2 As shown, the E3 component was dissolved in a solvent with a volume ratio of acetonitrile to water of 2:1, and then loaded onto a chromatographic column C18 (5μm, 10×250mm, Sepax GP-C-18) for HPLC chromatography purification, with a mixed solution of acetonitrile (A) and water (B) as the mobile phase for gradient elution for 20min, the elution program was 20%A→80%A, UV-220nm and UV-300nm were used as detection wavelengths, and the main compounds with peak times of 4-9min, 9-15min, and 15-20min were collected. After activity screening, 15-20min had the activity of improving APAP-induced acute liver injury.

[0119] The effluent from 90 to 20 min was collected and purified again using the same chromatographic column conditions, except that the elution procedure of the mobile phase was 20% A→80% A and the elution time was 20 min. The eluates from 15 min and 20 min were collected and freeze-dried to obtain compounds E3-15min and E3-20min.

[0120] (6) Hydrogen spectrum, carbon spectrum and mass spectrum identification

[0121] like Fig.12 and Fig.16, MS detection was performed on E3-15 min and E3-20 min groups respectively. Among them, the predicted relative molecular mass [M+H] of E3-15min compound + =179.07082, measured relative molecular mass [M+H] + =179.07033. E3-20min compound predicted relative molecular mass [M+Na] + =201.05276, measured relative molecular mass [M+Na] + =201.05266.

[0122] like Fig.13 and Fig.17 The E3-15 min and E3-20 min components were detected by hydrogen nuclear magnetic resonance, and the 1H-NMR spectra of the two substances were obtained.

[0123] like Fig.14 and Fig.18 The E3-15 min and E3-20 min groups were subjected to carbon nuclear magnetic resonance detection, and the 13C-NMR spectra of the two substances were obtained.

[0124] The structural characteristics of component E3-15min are 1 H NMR (600MHz, Methanol-d4) δ7.65(d,J=5.4Hz,1H),6.31(dd,J=5.4,0.8Hz,1H),5.52(td,J=2.5,0.8Hz,1H),3.95(d t,J=12.6,6.3Hz,1H),2.63(ddd,J=17.0,5.5,2.5Hz,1H),2.55(ddd,J=17.0,6.5,2.5Hz,1H),1.28(d,J=6.2Hz,3H); 13 C NMR(201MHz,MeOD)δ170.85,144.88,120.94,95.46,67.25,30.88,22.61; ESI-MS:[M+H] + =179.07082

[0125] The structural characteristics of component E3-20min are 1 H NMR (600MHz, Methanol-d4) δ7.65(d,J=5.4Hz,1H),6.31(d,J=5.4Hz,1H),5.52(t,J=2.5Hz ,1H),3.95(m,1H),2.63(ddd,J=14.7,5.5,2.8Hz,1H),2.55(m,1H),1.28(d,J=6.2Hz,3H); 13C NMR (201MHz, MeOD) δ170.89,158.19,144.84,121.00,101.19,95.48,77.25,67.25,30.88,22.61; [M+Na] + =201.05266

[0126] According to the two compounds E3-15 min and E3-20 min 1 H-NMR results and 13 C-NMR results, processed, obtained both 1 H and 13 C chemical shift ( Fig.13 ,14,17 and 18), and found that both 13 The C signal is exactly the same, 1 There is a certain difference in H signal, indicating that the two compounds have the same C skeleton but different H environments. Fig.15 and Fig. 22 ), since the double bond restricts the free rotation of different groups on both sides, cis-trans isomerism occurs, making E3-15 min and E3-20 min two compounds cis-trans isomers of each other. Among them, the cis-structured E3-15min compound has a relatively close spatial distance between the H at position 3 and the H at position 5, and both can respond in the NOESY spectrum. However, the trans-structured E3-20min compound has no such signal. After identification, the molecular structure of component E3-15min is shown in formula (I), and the molecular structure of component E3-20min is shown in formula (II).

[0127] 2. MTT test

[0128] (1) Preparation of test sample gradient solution

[0129] Take the aqueous phase component (the concentrated dry product of the aqueous phase solution), the ethyl acetate phase component, the n-butanol component, the A-G components, the E1-E5 components or the G1-5 components and prepare a 200 mg / mL drug stock solution with DMSO, and dilute the stock solution with complete culture medium in sequence to a gradient solution of 100 mg / mL, 10 mg / mL, 1 mg / mL, 100 g / mL, and 10 g / mL of the test sample.

[0130] (2) Safety concentration test

[0131] AML-12 cells (SNL-242, Shann Bio) were incubated in a 5% CO2, 37°C incubator and cell passage was performed when the cell confluence reached 80%. Trypsin was added for digestion and the cells were resuspended to control the cell density to 1×10 5, cells were inoculated into 96-well flat-bottom plates, and 10 μL of cell suspension and 100 μL of complete medium were added to each well. After the cells adhered to the wall, the medium in the 96-well flat-bottom plate was discarded, and the gradient solution of the test sample was added, 100 μL per well, and 5 replicate wells were set for each drug concentration. Incubate for 24 hours at 5% CO2 and 37°C, and observe under an inverted microscope; after 24 hours, the medium containing the drug was discarded, and 100 μL of complete medium and 20 μL of MTT solution (5 mg / mL, i.e. 0.5% MTT) were added to each well, and the culture was continued for 4 hours; after 4 hours, the culture was terminated, and the culture medium in the well was carefully aspirated; 150 μL of dimethyl sulfoxide was added to each well, and the well was shaken at a low speed for 10 minutes to fully dissolve the crystals. The absorbance of each well was measured at 490 nm in an enzyme-linked immunosorbent assay.

[0132] (3) Results

[0133] like Figure 3 As shown in A, the concentration of n-butanol component within 1 mg / mL and the concentration of ethyl acetate component within 100 g / mL had no obvious toxic effect on AML-12 cells.

[0134] like Figure 5 As shown in A to H, when the concentration of components A, B, E, F, and H was <1 mg / mL, and the concentration of components C, D, and G was <10 mg / mL, there was no obvious toxic effect on AML-12 cells (*p<0.05, **p<0.01, ***p<0.001).

[0135] like Figure 5 As shown in Tables I, D, E, F and G, except for component A, the other components have an improvement effect on cell death caused by APAP (*p<0.05, **p<0.01), and components D, E, F and G may also have a certain effect of promoting cell proliferation (*p<0.05, **p<0.01).

[0136] 3. Cellular ALT test

[0137] (1) Preparation of test solution

[0138] Preparation of acetaminophen solution (APAP): Take 0.4548g APAP, weigh accurately, add 30mL PBS to fully dissolve, filter through a 0.22m sterilizing filter to obtain a 100mM APAP stock solution, dilute the 100mM APAP stock solution 10 times with complete medium, and prepare a 10mM APAP test solution. For other test products, refer to the steps of the MTT method test.

[0139] (2) Group test

[0140] AML-12 cells were divided into a blank group, a model group, and a test group. In the model group and the test group, AML-12 cells were inoculated in a 96-well plate, and complete culture medium, 10mM APAP test solution, and 100μL / well of 10mM APAP working solution containing extract were added, respectively, and cultured at 5% CO2 and 37°C for 24h. The same steps were followed in the test group, and the test solutions of the above different components were used for testing. The blank group was not treated.

[0141] (3) ALT detection in cell supernatant

[0142] Centrifuge at 1000 rpm for 10 min, collect 20 μL of the supernatant of the cell culture fluid from each group, add 20 μL of ALT matrix solution (5 μL is added to the blank group), mix well, and react in a 37°C incubator for 30 min; add an equal volume of 2,4-dinitrotoluene hydrazine solution, add 5 μL of the sample to be tested to the blank group, mix well, and react in a 37°C incubator for 20 min; add 200 μL of 0.4 mol / L sodium hydroxide solution, gently shake the 96-well plate, leave it at room temperature for 15 min, and use a full-wavelength microplate reader to measure the absorbance of each well at a wavelength of 510 nm.

[0143] (4) Results

[0144] like Figure 3 As shown in Figures C and 3E, APAP induced cell death in AML-12 cells compared with the blank group (p<0.01), but the ethyl acetate fraction could reduce cell death induced by APAP. Figure 3 As shown in D and 3F, compared with the blank group, APAP caused an increase in the ALT level in the cell supernatant (p<0.05), but the ethyl acetate fraction was able to reduce the increase in ALT caused by APAP. Figure 3 As shown in Figures C and 3E, the test solution provided by the test group was able to reduce APAP-induced cell death (p<0.05) and the increase in ALT levels (p<0.05).

[0145] like Figure 6 As shown, compared with the APAP model group, components E and G at safe concentrations could significantly reduce the ALT level in the cell supernatant of AML-12 cells after APAP treatment (p<0.05). The results indicate that components E and G may have the effect of improving ALI.

[0146] like Figure 8 B, AML-12 cells were treated with APAP, and the cell death rates of the model group and the drug-treated group were compared by MTT experiment. The results showed that E1-E3 had a certain improvement effect on the cell death caused by APAP (*p<0.05, ***p<0.05, **p<0.01). Figure 8C, The cell supernatant was collected after 12 hours of APAP treatment, and the biochemical index ALT was used to reflect the level of cell damage. The results showed that E1-E3 could significantly reduce the ALT level of cell supernatant under APAP treatment (**p<0.01, ***p<0.001). These results indicate that E1, E2, and E3 components may have a protective effect on AML-12 cell damage caused by APAP and OA / PA.

[0147] like Figure 8 As shown in Figures D and 8E, compared with the APAP model group, the isolated G1, G3, and G4 fractions all showed a significant decrease in the ALT level in the cell supernatant, which had a protective effect on APAP-induced AML-12 cell damage, and the G4 fraction may have a certain pro-proliferation effect on cells.

[0148] like Fig. 9 A, compared with the model group, compounds with peak time of 15-20min can significantly reduce cell death rate (p<0.05). Fig. 9 As shown in B, after 15-20 min of compound treatment, ALT levels were significantly lower than those in the model group ( Fig. 9 B, p<0.05).

[0149] like Fig.10 A, Compared with the APAP model group, the cell death rate was significantly decreased after treatment with E3-15min compound (p<0.05), but the improvement effect of E-23min was not significant. Therefore, E3-23min is not the main active substance.

[0150] like Fig.10 B, Compared with the model group, the ALT level in the supernatant of cells treated with E3-15 min compound was significantly decreased (p<0.05).

[0151] This indicated that compounds E3-15min and E3-20min could improve the increase of ALT level induced by APAP.

[0152] 4. Cellular level TG test

[0153] (1) Preparation of test solution

[0154] Preparation of OA drug (Oleic acid): 0.1mol / L sodium hydroxide solution: Dissolve 0.12μL sodium hydroxide in 30ml ultrapure water to prepare 0.1mol / L sodium hydroxide solution. 20mM OA solution: Mix 76.17μL OA and 12ml (0.1mol / L) sodium hydroxide solution, saponify overnight in a water bath at 75℃ until clear and transparent. 20% BSA solution: Add 2.6g BSA solution to 13ml PBS, oscillate in a 55℃ air bath for 30min, until it turns brown and clear. Preparation of 10mM OA solution: Add 12ml of 20mM OA solution to 12ml 20% BSA solution, oscillate in a 55℃ air bath for 30min, filter while hot, and store at 4℃.

[0155] Preparation of PA drug (Palmitic acid): 20mM PA solution: 0.031g PA is added to 6ml (0.1mol / L) sodium hydroxide solution, saponified overnight in a water bath at 75℃ until clear and transparent. Preparation of 5mM PA: 6ml 20mM PA solution is added to 18ml 20% BSA solution, oscillated in a 55℃ air bath for 30min, filtered while hot, and stored at 4℃ for 1 month.

[0156] Preparation of OA / PA working solution: Take 10mM OA 3.75ml + 5mM PA 3.75ml + 142.5ml complete culture medium to prepare OA / PA drug.

[0157] (2) Group test

[0158] OA / PA working solution was used to treat AML-12 cell lines to simulate the hyperlipidemia in vivo: the safe drug concentration was determined, and the corresponding drug concentration was prepared using OA / PA working solution as solvent. AML-12 cells were seeded in 6-well plates, and 100 μL / well of complete culture medium, OA / PA working solution, and OA / PA working solution of each component of Malan root extract were added respectively. The cells were cultured at 37°C for 24 h with 5% CO2 and divided into blank group, model group, and test group. (3) The TG content of each cell precipitate was measured.

[0159] Collect the cell culture precipitate of each group by centrifugation at 1000rpm for 10min, wash 1-2 times with isotonic buffer (e.g. 0.1molL, pH7-7.4 phosphate buffer), centrifuge at 1000rpm for 10min, discard the supernatant, and keep the cell precipitate; add 0.2-0.3mL of homogenization medium (e.g. 0.1molL pH7-74 phosphate buffer or physiological saline), ultrasonically disrupt under ice water bath conditions (power: 300W 3-5 seconds / time, interval 30 seconds, repeat 3-5 times) or manually homogenize, and the prepared homogenate is directly measured without centrifugation. Shake the well plate to mix, incubate at 37℃ for 10min, wavelength 500nm, and measure the absorbance of each group with an enzyme marker, and detect the protein concentration of each group by BCA method.

[0160] (4) Results

[0161] AML-12 cells were treated with OA / PA working solution for 12 hours to simulate the high-fat environment in vivo, and the above-mentioned test solution was used for intervention.

[0162] like Figure 4 As shown in the figure, compared with the blank group, the OA / PA group can significantly increase the intracellular TG level. Compared with the model group, the ethyl acetate phase solution of the test group can significantly reduce the increase of TG level in cells induced by OA / PA.

[0163] like Figure 7 As shown, in AML-12 cells, compared with the OA / PA group, the E and G components at a safe concentration could significantly reduce the increase in ALT levels caused by OA / PA. The results showed that the E and G components could improve both the acute liver injury caused by APAP and the fatty liver injury caused by OA / PA.

[0164] like Figure 8 F, At the same time, AML-12 cells were treated with OA / PA, and the intracellular TG level was measured by TG experiment. The results showed that E1-E3 had a certain improvement effect on the increase of cell TG level caused by OA / PA. These results indicate that E1, E2, and E3 components may have a protective effect on AML-12 cell damage caused by APA P and OA / PA.

[0165] like Fig. 9 C, The three components were tested to improve the TG level under OA / PA stimulation, and it was found that the 15-20min component had an improving effect on TG (p<0.05).

[0166] like Fig.11 A, Compared with the OA / PA model group, the cellular TG level was significantly decreased after treatment with E3-15min and E3-20min compounds, but the E-23min compound could not improve the TG level.

[0167] like Fig.11 B and Fig.11 C, Compared with the model group, the E3-15min compound can significantly reduce the expression of PPARy and FABP1. Therefore, the E3-15min compound can improve the increase of TG levels induced by OA / PA and reduce the expression of lipid synthesis genes.

[0168] This indicates that both the E3-15min fraction and the E3-20min fraction have an ameliorative effect on APAP- and OA / PA-induced liver injury.

[0169] 5. RT-PCR

[0170] AML-12 cells with APAP and OA / PA-induced liver damage were collected, and total RNA was extracted by Trizol method. DNA was removed by DNAEraser and transcribed into cDNA. The transcription system was 10 μL RNA, 4 μL 5×primerscriptbuffer2, 4 μL RNase Free ddH2O, 1 μL primerscript RT Enzyme mixⅠ, and reacted at 37℃ for 15 min, then at 85℃ for 5 s, and stored at -20℃. The obtained cDNA was subjected to fluorescent quantitative PCR. The PCR reaction system included 5 μL TB green, 5 μL upstream primer of the gene to be tested, 0.2 μL downstream primer, 1 μL ROX Reference Dye (50×), 3.4 μL ddH2O, and 1 μL cDNA. In a real-time quantitative PCR instrument, the reaction was carried out at 95℃ for 10 s, then at 95℃ for 10 s, and at 60℃ for 30 s, and the cycle was repeated 40 times. GAPDH was used as the internal reference and 2 -ΔΔCt The relative expression levels of mRNA of Pcna, Ki-67, IL-6, TNF-α, PPARy and Fabp1 were determined. The primers used are shown in the table below.

[0171] Gene Upstream primer Downstream primer PcN tttgaggcacgcctgatcc,SEQ ID NO:1 ggagacgtgagacgagtccat, SEQ ID NO:2 Ki-67 atcattgaccgctcctttaggt,SEQ ID NO:3 gctcgccttgatggttcct, SEQ ID NO:4 IL-6 ctccaagccaaagtccttagag, SEQ ID NO:5 aggagctgtcattagggacatc, SEQ ID NO:6 TNF-α agaagggagtttcaaacctggt, SEQ ID NO:7 gtcttgctcatgtgtgtaagtga, SEQ ID NO:8 PPARy cacagactcggcactcaat,SEQ ID NO:9 tagaacctgcatctccacc, SEQ ID NO:10 Fabp-1 atgaacttctccggcaagtacc,SEQ ID NO:11 ctgacacccccttgatgtcc,SEQ ID NO:12 GAPDH aactttggcattgtggaagg, SEQ ID NO:13 ggatgcagggatgatgttct, SEQ ID NO:14

[0172] like Fig.10 C and Fig.10 D, The levels of cell proliferation genes Ki67 and Pcna increased. The above results indicate that the E3-15 min component not only has anti-inflammatory effects, but also has the effects of reducing APAP-induced AML-12 cell death and promoting cell proliferation.

[0173] like Fig.10 As shown in E and F, the expression levels of intracellular inflammatory genes Il-1β and Tnf-α were detected. Compared with the model group, the E3-15 min component could significantly reduce the expression levels of the above two inflammatory genes (p<0.05).

[0174] The above is only a preferred specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. Compound represented by formula (I):

2. Compound represented by formula (II):

3. An optical isomer, labeled compound, pharmaceutically acceptable salt, tautomer, solvate or prodrug of the compound according to claim 1 or 2.

4. An inflammatory factor inhibitor, comprising the compound according to claim 1 or 2, or the pharmaceutically acceptable salt according to claim 3, or a solvate compound or a prodrug thereof.

5. A lipid synthesis gene inhibitor, comprising the compound according to claim 1 or 2, or the pharmaceutically acceptable salt according to claim 3, or a solvate compound or a prodrug thereof.

6. An agent for promoting the expression of the cell proliferation gene Ki67, comprising the compound according to claim 1 or 2, or the pharmaceutically acceptable salt according to claim 3, or a solvent compound or a prodrug thereof.

7. A composition comprising the compound according to claim 1 or 2, or the optical isomer, labeled compound, pharmaceutically acceptable salt, tautomer, solvate or prodrug according to claim 3, and a pharmaceutically acceptable excipient.

8. The compound according to any one of claims 1 to 2, or the optical isomer, labeled compound, pharmaceutically acceptable salt, tautomer, solvate or prodrug according to claim 3, or the composition according to claim 7, wherein the compound, the pharmaceutically acceptable salt, solvate or prodrug, or the composition is used in a medicament.

9. Use of the compound of claim 1 or 2, or the optical isomer, labeled compound, pharmaceutically acceptable salt, tautomer, solvate or prodrug of claim 3, or the composition of claim 7 for the preparation of a medicament for treating or preventing a disease, disorder or condition selected from: (i) Acute liver injury; (ii) viral liver damage; (iii) alcoholic liver damage; (iv) Fatty liver damage.

10. A method for preparing the compound according to claim 1 or 2, the method comprising: Obtaining crude extract of Malan root; as well as The crude extract of Radix Malan is subjected to at least one of the following operation steps: extraction, C18 column chromatography, gel chromatography or HPLC preparative chromatography.

Images