Recombinant human type I collagen, hydrogel and application thereof in preparing medical aesthetic fillers

Abstract

The present invention discloses a recombinant type I human collagen, a hydrogel and their applications in the preparation of medical aesthetic fillers. The recombinant type I human collagen with a high content of isopeptide bonds is prepared into a composite hydrogel with nanocellulose, which has high stability, low swelling, high retention rate, strong adhesion and hemostatic ability, and has the potential to be used as a skin tissue repair material. Moreover, this composite hydrogel can be used for the repair of burned skin, significantly reducing the inflammatory response of burned skin and promoting wound healing. In addition, this composite hydrogel can also be filled into mice as a filler or inhibitor, with a low inflammatory response, and can promote collagen synthesis in mice. Long-term action can promote the generation of blood vessels and osteocytes, and then promote tissue regeneration, providing a technical basis for its use as a medical aesthetic filling material.

Description

Technical Field

[0001] This invention relates to the field of type I human collagen technology, specifically to recombinant type I human collagen, hydrogel, and its application in the preparation of medical aesthetic fillers. Background Technology

[0002] Type I collagen is the sole component of collagen fibers in the dermis, accounting for over 80% of the skin's composition; it is the most abundant component of dermal connective tissue. Type I collagen is a heterotrimeric molecule, with each chain composed of over 1000 amino acids. The length of a Type I collagen molecule is approximately 300 nm, and its width is approximately 1-5 nm. Collagen trimers have high tensile strength. In most cases, it consists of two α1 chains and one α2 chain, while the α1 homotrimer exists in a minor form.

[0003] Type I collagen provides mechanical support to organisms, maintaining the integrity of organs and tissues and ensuring their normal function, which is crucial for solid organs. Type I collagen is a major component of the basement membrane of solid organs; in bones, over 80% of the organic matter is type I collagen. The main function of type I collagen in bones and connective tissues is to form and maintain the integrity of the skeletal structure. In addition, type I collagen plays a major role in forming specific extracellular microenvironments, which are crucial for maintaining cell integrity and transmitting extracellular signals.

[0004] The earliest medical applications of type I collagen can be traced back to 175 AD, when Dr. Galen first used it as absorbable suture material for gut casings. With improvements in processing and the development of modification techniques, collagen has been made into hemostatic powders, burn dressings, drug carriers, replacement materials for heart membranes, blood vessels, tubes, and trachea, and surgical sutures, among other applications, showing promising prospects in clinical medicine. Type I collagen also has a wide range of uses in the pharmaceutical, cosmetic, and food industries. Summary of the Invention

[0005] In view of this, the present invention provides a recombinant type I human collagen, hydrogel, and its application in the preparation of medical aesthetic fillers.

[0006] One objective of this invention is to provide a method for preparing recombinant type I human collagen, comprising:

[0007] Prepare solutions of human type I procollagen amino-terminal peptide and cross-linked peptide of the same concentration, wherein the human type I procollagen amino-terminal peptide is shown in SEQ ID NO.1 and the cross-linked peptide is shown in SEQ ID NO.2;

[0008] The solution of the human type I procollagen amino-terminal peptide and the solution of the cross-linked peptide are mixed at a volume ratio of (1-2):(1-4);

[0009] Add 5-40 U / g glutaminase to the protein;

[0010] After thorough mixing, react at 50℃ for 0.5–6 hours;

[0011] After the reaction is complete, remove the sample, place it in a boiling water bath to inactivate the enzyme, and cool it to room temperature.

[0012] Adjust the pH of the solution to 4.6 to precipitate the modified product and remove unmixed cross-linked peptides. Centrifuge at 10000×g for 15 min and discard the supernatant.

[0013] The precipitate was washed with water at pH 4.6, and the resulting precipitate was recombinant type I human collagen.

[0014] Specifically, the solution of the human type I procollagen amino-terminal peptide is mixed with the solution of the cross-linked peptide at a volume ratio of 1:1, 1:2, 1:3, 1:4 or 2:1.

[0015] Specifically, the amount of glutaminase added is 5 U / g, 10 U / g, 20 U / g, 30 U / g, or 40 U / g protein.

[0016] Specifically, the reaction time is 0.5h, 1h, 2h, 4h or 6h.

[0017] One objective of this invention is to provide a method for preparing a composite hydrogel, comprising:

[0018] An ionic liquid containing 50 g / L 1,5-diazabicyclo[4.3.0]-5-nonene and 50 g / L levulinic acid was prepared in an ice bath at 0 °C.

[0019] Under mechanical stirring in an oil bath at 100°C, nanocellulose and recombinant type I human collagen prepared by the above method were simultaneously added to the ionic liquid, and the mixture was stirred rapidly until fully dissolved.

[0020] Place the reactants in a petri dish, let stand at room temperature for 1 day, and then wash repeatedly with anhydrous ethanol.

[0021] Specifically, the final concentration of the nanocellulose is 1.25 g / L, and the final concentration of the recombinant type I human collagen is 1.25 g / L.

[0022] Specifically, the nanocellulose has a diameter of 4–10 nm and a length of 200 nm.

[0023] One of the objectives of this invention is to provide recombinant type I collagen obtained by the method described.

[0024] One objective of this invention is to provide the application of the recombinant type I collagen obtained by the method in the preparation of skin tissue repair materials.

[0025] One objective of this invention is to provide the application of recombinant type I collagen obtained by the method in the preparation of biological filler materials.

[0026] Beneficial effects:

[0027] A recombinant type I human collagen with a high content of isopeptide bonds was prepared using the method provided in this invention. This high-isopeptide-content recombinant type I human collagen was then combined with nanocellulose to prepare a composite hydrogel. This hydrogel exhibits high stability, low swelling, high weight retention, strong adhesion, and hemostatic ability, demonstrating potential as a skin tissue repair material. Furthermore, this composite hydrogel can be used to repair burned skin, significantly reducing inflammatory responses and promoting wound healing. In addition, this composite hydrogel can be used as a filler or inhibitor in mice, exhibiting low inflammatory response and promoting collagen synthesis in mice. Long-term action promotes angiogenesis and osteoblast formation, thereby promoting tissue regeneration, providing a technical basis for its use as a medical aesthetic filler material. Attached Figure Description

[0028] Figure 1 Images of the experimental group, control group 1, control group 2, and control group 3 on days 1, 20, 40, and 60 in the inverted test experiment.

[0029] Figure 2 The results are for the experimental group, control group 1, control group 2 and control group 3 in the in vitro swelling and degradation experiment.

[0030] Figure 3 The results are for the experimental group, control group 1, control group 2 and control group 3 in the in vitro adhesion experiment.

[0031] Figure 4 The results are for the experimental group, control group 1, control group 2, and control group 3 in the cell experiment.

[0032] Figure 5 The levels of white blood cells (WBC), neutrophils (Neu), and lymphocytes in mice in the model group, test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5) were measured at 14 days in the skin burn experiment.

[0033] Figure 6The results show the burn area of ​​mice in the model group, test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5) at 7, 14, and 21 days in the skin burn experiment.

[0034] Figure 7 The results show the relative collagen fiber content of mice in the model group, test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5) at 7, 14, and 21 days in the skin burn experiment.

[0035] Figure 8 The results show the relative expression levels of TNF-α in mice in the blank group (Blank), test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5) during the injection experiment.

[0036] Figure 9 The results show the relative expression levels of IL-6 in mice in the blank group, test group 1, test group 2, test group 3, test group 4, and test group 5 during the injection experiment.

[0037] Figure 10 The results show the relative expression levels of type I collagen in mice in the blank group, test group 1, test group 2, test group 3, test group 4, and test group 5 during the injection experiment.

[0038] Figure 11 The results show the relative expression levels of type III collagen in mice in the blank group (Blank), test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5) during the injection experiment.

[0039] Figure 12 The results show the relative VEGF expression levels in mice in the blank group, test group 1, test group 2, test group 3, test group 4, and test group 5 during the injection experiment.

[0040] Figure 13 The results show the relative expression levels of AKP in mice in the blank group, test group 1, test group 2, test group 3, test group 4, and test group 5 during the injection experiment. Detailed Implementation

[0041] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention. Reagents not specifically described in detail in this invention are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional experimental methods and can be obtained from the prior art.

[0042] I. Preparation of Recombinant Type I Human Collagen

[0043] A recombinant type I human collagen was obtained by cross-linking a human type I procollagen amino-terminal peptide (MSST0034, Sigma-Aldrich, SEQ ID NO.1) and a cross-linked peptide (SEQ ID NO.2) using transglutaminase (MTG, CAS No. 80146-85-6, solubility in water 1.0 g / L, Beijing Solarbio Science & Technology Co., Ltd.) catalyzed by transglutaminase. Specific steps included:

[0044] 1. Effect of reaction conditions

[0045] 1) Crosslinking ratio

[0046] Separate solutions of human type I procollagen N-terminal peptide (SEQ ID NO.1) and cross-linked peptide (SEQ ID NO.2) with a protein concentration of 50 g / L were prepared, and the pH was adjusted to 7.5. The human type I procollagen N-terminal peptide and cross-linked peptide solutions were mixed at volume ratios of 1:1, 1:2, 1:3, 1:4, and 2:1, respectively. Glutaminase was added at a concentration of 30 U / g protein. After thorough mixing, the reaction mixture was incubated at 50°C on a horizontal shaker for 4 hours, with three replicates for each sample. After the reaction, the samples were removed and placed in a boiling water bath for 15 minutes to inactivate the enzyme, then cooled to room temperature. The pH was adjusted to 4.6 to precipitate the modified product and remove any unmixed cross-linked peptides. The precipitate was centrifuged at 10000×g for 15 minutes, and the supernatant was discarded. The precipitate was washed with water at pH 4.6, and the supernatant was discarded after centrifugation. This washing process was repeated twice. The resulting precipitate was recombinant type I human collagen, which was then freeze-dried.

[0047] 2) Enzyme addition amount

[0048] Separate solutions of human type I procollagen N-terminal peptide (SEQ ID NO.1) and cross-linked peptide (SEQ ID NO.2) with a protein concentration of 50 g / L were prepared, and the pH was adjusted to 7.5. The human type I procollagen N-terminal peptide solution and the cross-linked peptide solution were mixed at a volume ratio of 1:3. Glutaminase was added at concentrations of 5 U / g, 10 U / g, 20 U / g, 30 U / g, and 40 U / g of protein. After thorough mixing, the reaction system was incubated at 50℃ on a horizontal shaker for 4 h. Each sample was performed in triplicate. After the reaction, the samples were removed and placed in a boiling water bath for 15 min to inactivate the enzyme, then cooled to room temperature. The pH of the solution was adjusted to 4.6 to precipitate the modified product and remove unmixed cross-linked peptides. The precipitate was centrifuged at 10000×g for 15 min, and the supernatant was discarded. The precipitate was washed with water at pH 4.6, centrifuged again, and the supernatant was discarded. This washing process was repeated twice. The precipitate was then freeze-dried, and the resulting precipitate was recombinant type I human collagen.

[0049] 3) Reaction time

[0050] Separate solutions of human type I procollagen N-terminal peptide and cross-linked peptide with a protein concentration of 50 g / L were prepared, and the pH was adjusted to 7.5. The human type I procollagen N-terminal peptide solution and the cross-linked peptide solution were mixed at a volume ratio of 1:3. Glutamine transaminase was added at a concentration of 30 U / g protein. After thorough mixing, the reaction system was placed in a 50℃ incubator with horizontal shaking for 0.5, 1, 2, 4, and 6 hours, with each sample prepared in triplicate. After the reaction, the samples were removed and treated as above.

[0051] 2. Determination of the content of isopeptide bonds in recombinant type I human collagen.

[0052] The content of ε-(γ-Glu)Lys (isopeptide bonds) was detected using a SilGreen ODS C18 column. The cross-linked group (recombinant type I human collagen) and the blank control group (human type I procollagen N-terminal peptide and cross-linked peptide) were trypsin-digested with 8000 U / g of protein substrate dissolved in 0.01 mol / L PBS (pH 7.0). The digestion was completed at 37°C for 48 h, followed by boiling incubation for 5 min to inactivate the enzyme. The digested samples were centrifuged at 10000 rpm for 20 min, and the supernatant was lyophilized. The lyophilized samples were deproteinized with 100% methanol, centrifuged, and the supernatant was dried using a nitrogen blower at 60°C. Finally, the samples were reconstituted in 0.5 mL of mobile phase. The mobile phase solution was added to an Amicon® Ultra 3K ultrafiltration centrifuge tube and centrifuged at 4000 × g for 30 min to collect the filtrate. The processed sample filtrate was derivatized, and the content of isopeptide bonds was determined. An OPA derivatizing reagent was prepared fresh, consisting of 22.4 mmol / L OPA (o-phthalaldehyde, CAS: 643-79-8, Shanghai Aladdin), 0.4 mol / L Na₂CO₃, and 50% methanol containing 2% β-mercaptoethanol. 80 μL of the sample was rapidly mixed with 320 μL of the OPA derivatizing reagent, vortexed for 70 s, and allowed to stand for 2 min. 10 μL of the mixture was injected into the liquid chromatograph for detection with a fluorescence detector. Mobile phase A consisted of 20 mmol / L potassium acetate (pH 5.5) containing 1% tetrahydrofuran (THF); mobile phase B consisted of 1% THF dissolved in pure methanol. From 0-55 min, mobile phase B concentration was 20%-95%; from 55-60 min, mobile phase B concentration was 95%-20%. The column temperature was 40℃, the flow rate was 1.0 mL / min, the excitation wavelength (EX) was 334 nm, and the emission wavelength (EM) was 440 nm. The standard ε-(γ-Glu)Lys was dissolved in the mobile phase, and a concentration gradient of 0.005, 0.01, 0.05, 0.1, 0.5, 1.0, and 2.0 mmol / L was prepared to construct a standard curve.

[0053] As shown in Table 1, when the cross-linking ratio was 1:3 or 1:4, the enzyme addition was 30 U / g, and the reaction time was 4 h, a high content of ε-(γ-Glu)Lys isopeptide bonds could be obtained, indicating that highly cross-linked recombinant type I human collagen was successfully prepared.

[0054] Table 1. ε-(γ-Glu)Lys (isopeptide bond) content (μmol / 100g)

[0055]

[0056] II. Preparation of Hydrogels

[0057] A composite hydrogel of nanocellulose / recombinant type I human collagen was prepared using a levulinic matrix ionic liquid as a solvent. Specific steps included:

[0058] Under an ice bath at 0°C, 1,5-diazabicyclo[4.3.0]-5-nonene and acetylpropionic acid were added sequentially to a two-necked flask in a 1:1 weight ratio and stirred for 5 min to form a yellow transparent ionic liquid (concentration of 50 g / L for both). Under mechanical stirring in an oil bath at 100℃, nanocellulose (final concentration 1.25 g / L, purity: ≥99%, diameter (nm): 4-10, length: 200 nm, YXL0026, Yingxin Laboratory) and recombinant type I human collagen obtained in the previous steps (final concentration 1.25 g / L, isopeptide bond content 98.36 ± 0.72 μmol / 100 g) were simultaneously added to the ionic liquid. The mixture was rapidly stirred for approximately 30 minutes until the nanocellulose and recombinant type I human collagen were fully dissolved. The reaction mixture was placed in a petri dish and allowed to stand at room temperature for 1 day. Then, it was repeatedly washed with anhydrous ethanol. The four composite gels formed were perforated using a perforator to prepare hydrogel columns with a diameter of 30 mm and a height of 3 mm. These columns were then immersed in pure water for 12 hours, with the pure water being replaced during this period.

[0059] Using the same method, the recombinant type I human collagen was replaced with ordinary type I human collagen (5008, Advanced Biomatrix) as control group 1. Additionally, no protein was added; only nanocellulose was used for preparation, serving as control group 2. Furthermore, using the same method, the recombinant type I human collagen was replaced with the aforementioned human type I procollagen N-terminal peptide to prepare a hydrogel, serving as control group 3. Using the same method, the recombinant type I human collagen was replaced with cross-linked peptides to prepare a hydrogel, serving as control group 3.

[0060] III. Physical Performance Test

[0061] 1. Inverted test

[0062] The hydrogel cylinders prepared in each experimental group were subjected to gel inversion testing. The prepared hydrogels were placed in vials and inverted, and observations were conducted on days 1, 20, 40, and 60. Figure 1 As shown, no hydrogel was formed in control group 4, while control groups 2 and 3 liquefied on day 20, and neither the experimental group nor control group 1 liquefied.

[0063] 2. In vitro swelling and degradation test

[0064] The hydrogel to be tested was placed in a 9cm petri dish containing phosphate buffered saline (PBS, 20mM). At regular intervals, the hydrogel was removed from the petri dish, and excess moisture was removed from the surface using filter paper. The hydrogel was weighed using an analytical balance. Swelling rate = (Wt - W0) / W0 × 100%; Weight retention rate = (W0 - Wt) / W0 × 100%; where Wt is the weight of the hydrogel removed from the petri dish at different times, and W0 is the initial weight of the wet hydrogel. Figure 2 As shown, the hydrogel in the experimental group swelled at the upper position after 2 hours, while the swelling of the control groups 2 and 3 was obvious; the hydrogel in the experimental group had the highest weight retention rate within 60 days.

[0065] 3. In vitro adhesion test

[0066] The adhesion of the hydrogel to tissue was simulated using fresh pigskin. Pigskin tissue was cut into 20mm × 40mm rectangles and immersed in PBS (20mM). A prepolymerized hydrogel solution (100μL) was applied to the surface of the pigskin, and another piece of pigskin was used to cover it, pressing the adhesive surfaces together. The adhesive area was 20mm × 10mm. The pigskin was left at room temperature for 2 minutes or 2 hours, and then the short-term and long-term tissue adhesion forces of the hydrogel were measured using a universal tensile testing machine.

[0067] like Figure 3 As shown, the adhesion strength of the hydrogel in the experimental group was approximately 35 kPa, significantly higher than that in the control groups 1, 2, and 3. Skin repair hydrogels require excellent adhesion to skin tissue and hemostatic ability, thus indicating that the hydrogel provided in the experimental group has the potential to serve as a skin tissue repair material.

[0068] IV. Cell Experiments

[0069] L929 cell line (Shangen Biotechnology), human cardiomyocytes (AC16, 1×10⁶, BC-C-HU-038, Biochannel), rat hepatocytes (CP-R033, Pronosai), and rat kidney cells (NRK, CL-0173, Pronosai) (50,000 cells per well) were used. Hydrogels (5 mg / mL concentration) from the experimental groups, control groups 1, 2, 3, and 4 were added to the culture medium and cultured at 37°C for 24, 48, and 72 hours. At each time point, 10 μL of a cell counting kit (Invigentech) was added to each well, and the cells were incubated at 37°C for 2 hours. The absorbance at 590 nm was measured using a microplate reader. The control group (without hydrogel) was used. Cell viability was calculated as the percentage of absorbance after culture to that of the control group.

[0070] The results are as follows Figure 4As shown, the hydrogels in each group showed no significant toxicity to L929 cell line, human cardiomyocytes, rat hepatocytes and rat kidney cells, and have the potential to be used as skin tissue repair materials on the body surface and as filling materials in the body.

[0071] V. Animal Experiments

[0072] 1. Skin burn test

[0073] ICR mice (female, weight: 20-30g, Wuhan Small and Large Animal Experiment Center) were randomly divided into blank group, model group, test group 1, test group 2, test group 3, test group 4, and test group 5.

[0074] The test sample for test group 1 was the hydrogel prepared in the experimental group described above. The test sample for test group 2 was prepared using the same method as the experimental group, except that the recombinant type I human collagen was replaced with recombinant type I human collagen with an isopeptide bond content of 88.18 ± 0.56 μmol / 100g as shown in Table 1. The test sample for test group 3 was the hydrogel provided in control group 1. The test sample for test group 4 was the hydrogel provided in control group 2. Test group 5 was the hydrogel provided in control group 3.

[0075] Burn treatment primarily focuses on three aspects: stabilizing the body's metabolism, preventing infection, and accelerating functional recovery. The deeper the burn, the higher the risk of complications such as infection, which undoubtedly increases the difficulty of clinical treatment. The burn wound is mainly divided into three areas: the coagulation (necrosis) area, the congestion (ischemia) area, and the outermost inflammatory area. In the ischemic area, tissue can progressively become ischemic and necrotic within 24-48 hours. However, the cells in this area are still viable at this time. If intervention is performed within 24 hours, the progression of necrosis can be halted, preserving as much surviving skin around the burn wound as possible.

[0076] This experiment established a mouse model of deep second-degree burns to evaluate its therapeutic effect. Deep burns lead to immunosuppression in mice. The model establishment process included: mice were weighed and anesthetized with chloral hydrate (4% w / v, 0.1 mL / 10 g). After the anesthesia took effect, the hair on the back of the mice was removed, excess moisture was wiped off, and a heated metal rod was attached to the skin surface to create a circular burn with a diameter of 1.5 cm. The mice with the established deep second-degree burn model were randomly divided into a model group, test group 1 (Test1), test group 2 (Test2), test group 3 (Test3), test group 4 (Test4), and test group 5 (Test5). The corresponding hydrogel was applied to the burn site of the mice in test groups 1 (Test1), 2 (Test2), 3 (Test3), 4 (Test4), and 5 (Test5), respectively. The model group and the control group were not treated.

[0077] Mice were sacrificed on days 7, 14, and 21 post-surgery. The surface area of ​​the damaged region was measured using ImageJ, and a ruler was used to calibrate the magnification of the wound area photographs. The formula for calculating the collagen fiber content in the wound was: Collagen fiber (%) = A0 [Type I collagen area] / A1 [Total tissue area] × 100%. Blood routine tests were performed on the serum levels of white blood cells (WBC), neutrophils (Neu), and lymphocytes (Lym) in each group of mice on day 21.

[0078] like Figure 5 As shown, blood routine tests on day 14 revealed significantly decreased levels of white blood cells (WBC), neutrophils (Neu), and lymphocytes in the model group mice, indicating suppressed immunity and successful establishment of the deep second-degree burn model. In the figure, the white blood cell levels in test groups 1 and 2 were significantly higher than those in the model group (**, p<0.01), while the white blood cell levels in test groups 3, 4, and 5 showed no significant difference compared to the model group (ns). Similarly, the neutrophil levels in test groups 1 and 2 were significantly higher than those in the model group (**, p<0.01), while the neutrophil levels in test groups 3, 4, and 5 showed no significant difference compared to the model group (ns). Finally, the lymphocyte levels in test groups 1 and 2 were significantly higher than those in the model group (*, p<0.05), while the lymphocyte levels in test groups 3, 4, and 5 showed no significant difference compared to the model group (ns). This indicates that after the hydrogels provided in test groups 1 and 2 were used to treat the skin burns, the levels of white blood cells (WBC), neutrophils (Neu), and lymphocytes in the mice recovered on day 14, while test groups 3-5 showed no obvious signs of recovery.

[0079] Figure 6As shown, the burn area of ​​mice in test groups 1 and 2 was significantly lower than that in the model group on day 7 (*, p<0.05), while the burn area of ​​mice in test groups 3, 4, and 5 was not significantly different from that in the model group (ns). The burn area of ​​mice in test groups 1 and 2 was significantly lower than that in the model group on day 14 (**, p<0.01), the burn area of ​​mice in test group 3 was significantly lower than that in the model group on day 14 (*, p<0.05), while the burn area of ​​mice in test groups 4 and 5 was not significantly different from that in the model group (ns). The burn area of ​​mice in test groups 1 and 2 was significantly lower than that in the model group on day 21 (**, p<0.01), the burn area of ​​mice in test group 3 was significantly lower than that in the model group on day 21 (*, p<0.05), while the burn area of ​​mice in test groups 4 and 5 was not significantly different from that in the model group (ns). This indicates that the hydrogels provided in test groups 1 and 2 can rapidly promote wound healing in mice and quickly reduce the burn area. In contrast, the burns in the model group and test groups 3-5 showed obvious coagulative necrosis and epidermal ulceration leading to exposure of the dorsal muscles. In contrast, the scabs on the surface of the burns in test groups 4 and 5 remained intact, the wounds were kept moist and did not dry out, and they were difficult to heal when inverted.

[0080] Figure 7 As shown, the relative collagen fiber content in mice in test groups 1 and 2 was significantly higher than that in the model group on day 7 (**, p<0.01), while the relative collagen fiber content in test groups 3, 4, and 5 was not significantly different from that in the model group (ns). The relative collagen fiber content in mice in test groups 1 and 2 was significantly higher than that in the model group on day 14 (**, p<0.01), while the relative collagen fiber content in test groups 3, 4, and 5 was not significantly different from that in the model group (ns). This indicates that the hydrogels provided in test groups 1 and 2 can rapidly promote wound healing in mice, quickly reduce the burn area, and promote the growth of skin tissue fibers. In contrast, the burned skin in the model group and control group mice may have experienced irreversible degeneration and coagulative necrosis, resulting in the inability of their collagen fibers to recover rapidly.

[0081] 2. Injection Experiment

[0082] ICR mice were randomly divided into a blank group, test group 1, test group 2, test group 3, test group 4, and test group 5.

[0083] The test sample for test group 1 was the hydrogel prepared in the experimental group described above. The test sample for test group 2 was prepared using the same method as the experimental group, except that the recombinant type I human collagen was replaced with recombinant type I human collagen with an isopeptide bond content of 88.18 ± 0.56 μmol / 100g as shown in Table 1. The test sample for test group 3 was the hydrogel provided in control group 1. The test sample for test group 4 was the hydrogel provided in control group 2. Test group 5 was the hydrogel provided in control group 3. No injection was performed in the blank group.

[0084] ICR mice were acclimatized to the IVC environment for one week before the experiment. Each mouse was weighed and anesthetized with a 0.5% sodium pentobarbital solution injected into the spine at a dose of 50 mg / kg body weight. The back was shaved, and 0.1 mL of freshly prepared test sample from each group was injected clockwise into the shaved area. Each mouse had four injection sites arranged in a square pattern within one shaved area. After injection, the injection sites (including the injected material, surrounding capsule, and full-thickness skin) were surgically removed at weeks 1, 4, and 16 for relevant analysis.

[0085] 1) RT-PCR of transplanted tissue

[0086] Total RNA was extracted from the transplanted tissue. Specifically, 100 mg of transplanted tissue was pre-cooled, ground at 4°C, centrifuged at 12000 rpm for 10 min at 4°C, and the supernatant was collected. 400 μL of chloroform was added, mixed, and allowed to stand for 3 min. The supernatant was centrifuged at 12000 rpm for 10 min at 4°C, and the supernatant was collected. 550 μL of isopropanol was added, mixed, and allowed to stand for 15 min. The precipitate was centrifuged at 12000 rpm for 10 min at 4°C to obtain the precipitate. 1.5 mL of 75% ethanol was added, and the precipitate was centrifuged at 12000 rpm for 5 min at 4°C to remove the ethanol. The precipitate was dried in a clean bench for 5-10 min until it became transparent. It was dissolved in 15 μL of double-distilled nuclease-free water, and its purity was measured to be 1.8-2.0. It was then diluted with double-distilled sterile water to 100-500 ng / μL.

[0087] The extracted total RNA was reverse transcribed. The reverse transcription reaction system consisted of 4 μL 5× Reaction Buffer, 0.5 μL LOligo(dT)18 Primer (100 μM), 0.5 μL Random Hexamer Primer (100 μM), and 1 μL... RTEnzyme Mix, 2 μg total RNA, add double-distilled water to 20 μL, mix well and centrifuge. Set the reverse transcription program at 25℃ for 5 minutes, 45℃ for 30 minutes, and 85℃ for 5 seconds on a PCR instrument. The resulting cDNA is stored at -20℃ for later use.

[0088] Fluorescent PCR. Prepare the fluorescent PCR reaction system: 7.5 μL 2×SYBR Green qPCR Master Mix, 1.5 μL upstream primer (2.5 μM), 1.5 μL downstream primer (2.5 μM), 2 μL cDNA, and 4 μL nuclease-free water. PCR reaction program: pre-denaturation: 95℃ for 30 s; denaturation: 95℃ for 15 s, annealing and extension: 60℃ for 30 s; 95℃ for 10 s, 65℃ for 1 min, then increase to 95℃. Calculate the relative expression level of each gene using ΔΔCT based on the Ct value obtained from the instrument. Each sample was tested in triplicate.

[0089] GAPDH-F:cctcgtcccgtagacaaaatg, SEQ ID NO.3; GAPDH-R:tgaggtcaatgaaggggtcgt, SEQ ID NO.4;

[0090] TNF-α-F: ccctcacactcacaaaccacc, SEQ ID NO.5; TNF-α-R: ctttgagatccatgccgttg, SEQ ID NO.6

[0091] IL-6-F: catagctacctggagtacatgaagaa, SEQ ID NO.7; IL-6-R: gactccagcttatctcttggttga, SEQ ID NO.8

[0092] Colla1-F:gagaggtgaacaaggtcccg, SEQ ID NO.9; Colla1-R:aaacctctctcgcctcttgc, SEQ ID NO.10

[0093] Col3a1-F:tttcttctcacccttcttcatcc, SEQ ID NO.11; Col3a1-R:catatttgacatggttctggcttc, SEQ ID NO.12

[0094] VEGF-F: aggagtaccccgacgagataga, SEQ ID NO.13; VEGF-R: cacatctgctgtgctgtaggaa, SEQ ID NO.14

[0095] AKP-F: gagatggacaagttcccttacg, SEQ ID NO. 15; AKP-R: tcgtggtggtcacaatgc, SEQ ID NO. 16.

[0096] 2) Results

[0097] like Figure 8 As shown, the relative expression levels of TNF-α in mice in test groups 1 and 2 were not significantly different from those in the control group at week 1 (ns), while the relative expression levels of TNF-α in mice in test groups 3, 4, and 5 were significantly higher than those in the control group at week 1 (*, p<0.05; **, p<0.01). The relative expression levels of TNF-α in mice in test groups 1 and 2 were not significantly different from those in the control group at week 4 (ns), while the relative expression levels of TNF-α in mice in test groups 3, 4, and 5 were significantly higher than those in the control group at week 4 (*, p<0.05; **, p<0.01). The relative expression levels of TNF-α in mice in test groups 1 and 2 were not significantly different from those in the control group at week 16 (ns), while the relative expression levels of TNF-α in mice in test groups 3, 4, and 5 were significantly higher than those in the control group at week 16 (*, p<0.05; **, p<0.01).

[0098] like Figure 9 As shown, the relative expression levels of IL-6 in mice in test groups 1 and 2 were not significantly different from those in the control group at week 1 (ns), while the relative expression levels of IL-6 in mice in test groups 3, 4, and 5 were significantly higher than those in the control group at week 1 (*, p<0.05; **, p<0.01). The relative expression levels of IL-6 in mice in test groups 1 and 2 were not significantly different from those in the control group at week 4 (ns), while the relative expression levels of IL-6 in mice in test groups 3, 4, and 5 were significantly higher than those in the control group at week 4 (*, p<0.05; **, p<0.01). The relative expression levels of IL-6 in mice in test groups 1 and 2 were not significantly different from those in the control group at week 16 (ns), while the relative expression levels of IL-6 in mice in test groups 3, 4, and 5 were significantly higher than those in the control group at week 16 (*, p<0.05; **, p<0.01).

[0099] This indicates that although the expression levels of TNF-α and IL-6 increased in all groups of mice within one week after transplantation, resulting in a significant inflammatory response, the expression levels of TNF-α and IL-6 in test groups 1 and 2 gradually decreased 16 weeks after injection and remained significantly different from the blank group. This suggests that the hydrogels used as test samples in test groups 1 and 2, as fillers or grafts, do not produce a significant inflammatory response in mice.

[0100] like Figure 10As shown, the relative expression level of type I collagen in mice in test group 2 was significantly higher than that in the control group at week 1 (*, p<0.05), while the relative expression level of type I collagen in mice in test groups 1, 3, 4, and 5 was not significantly different from that in the control group at week 1 (ns). The relative expression level of type I collagen in mice in test groups 1, 2, 3, and 4 was significantly higher than that in the control group at week 4 (*, p<0.05; **, p<0.01), while the relative expression level of type I collagen in mice in test group 5 was not significantly different from that in the control group at week 4 (ns). The relative expression level of type I collagen in mice in test groups 1–5 was significantly higher than that in the control group at week 16 (*, p<0.05; **, p<0.01).

[0101] like Figure 11 As shown, the relative expression level of type III collagen in mice in test group 2 was significantly higher than that in the control group at week 1 (*, p<0.05), while the relative expression level of type III collagen in mice in test groups 1, 3, 4, and 5 was not significantly different from that in the control group at week 1 (ns). The relative expression level of type III collagen in mice in test groups 1 and 2 was significantly higher than that in the control group at week 4 (**, p<0.01), while the relative expression level of type III collagen in mice in test groups 3, 4, and 5 was not significantly different from that in the control group at week 4 (ns). The relative expression level of type III collagen in mice in test groups 1–4 was significantly higher than that in the control group at week 16 (*, p<0.05; **, p<0.01), while the relative expression level of type III collagen in mice in test groups 1 and 5 was not significantly different from that in the control group at week 16 (ns).

[0102] This indicates that, one week after injection of the hydrogel, only mice in test group 2 showed an increase in the relative expression levels of type I and type III collagen. Furthermore, although the relative expression levels of type I and type III collagen increased to varying degrees in all groups of mice at week 16, the increases were most significant in test groups 1 and 2. This suggests that the hydrogels used as test samples in test groups 1 and 2, when used as fillers or grafts, can promote collagen expression in mice.

[0103] like Figure 12 As shown, the relative VEGF expression levels in test groups 1–5 showed no significant difference (ns) compared to the control group at week 1. The relative VEGF expression levels in test groups 1 and 2 were significantly higher than the control group at week 4 (*, p<0.05), while the relative VEGF expression levels in test groups 3, 4, and 5 showed no significant difference (ns) compared to the control group at week 4. The relative VEGF expression levels in test groups 1 and 2 were significantly higher than the control group at week 16 (**, p<0.01), while the relative VEGF expression levels in test groups 3, 4, and 5 showed no significant difference (ns) compared to the control group at week 16. VEGF is a vascular endothelial growth factor, crucial for angiogenesis. It specifically acts on vascular endothelial cells, promoting mitosis and cell migration, and increasing vascular permeability. Figure 12 The results showed that the hydrogels used as test samples in test groups 1 and 2, as fillers or grafts, could promote VEGF expression and angiogenesis in mice.

[0104] like Figure 13 As shown, the relative AKP expression levels in test groups 1–5 showed no significant difference (ns) compared to the control group at week 1. The relative AKP expression levels in test groups 1–5 showed no significant difference (ns) compared to the control group at week 4. The relative AKP expression levels in test groups 1 and 2 were significantly higher than the control group at week 16 (*, p<0.05), while the relative AKP expression levels in test groups 3, 4, and 5 showed no significant difference (ns) compared to the control group at week 16. AKP (alkaline phosphatase) is a specific marker of bone cell synthesis; its expression level or absence often determines whether a marker for bone cell formation exists. Figure 13 As shown, the hydrogels used as test samples in test groups 1 and 2, when used as fillers or grafts, can promote AKP expression and osteoblast formation in mice.

[0105] In summary, the method provided by this invention yielded a recombinant type I human collagen with a high content of isopeptide bonds. This high-isopeptide-content recombinant type I human collagen was combined with nanocellulose to prepare a composite hydrogel, exhibiting high stability, low swelling, high weight retention, strong adhesion, and hemostatic ability, demonstrating potential as a skin tissue repair material. Furthermore, this composite hydrogel can be used to repair burned skin, significantly reducing inflammatory responses and promoting wound healing. In addition, this composite hydrogel can be used as a filler or inhibitor in mice, exhibiting low inflammatory response and promoting collagen synthesis in mice. Long-term action promotes angiogenesis and osteoblast formation, thereby promoting tissue regeneration, providing a technical basis for its use as a medical aesthetic filler material.

[0106] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention.

Claims

1. A recombinant type I human collagen, characterized in that, It is prepared by the following method: Prepare solutions of human procollagen type I amino-terminal propeptide and cross-linked peptide with the same concentration. The human procollagen type I amino-terminal propeptide is shown as SEQ ID NO.1, and the cross-linked peptide is shown as SEQ ID NO.2; Mix the solution of human procollagen type I amino-terminal propeptide and the solution of cross-linked peptide at a volume ratio of 1:1, 1:2, 1:3, 1:4 or 2:1; Add glutaminase at 5 - 40 U / g protein; After mixing well, place it at 50 °C and react for 0.5 - 6 h; After the reaction is completed, take out the sample, inactivate the enzyme in a boiling water bath, and cool it to room temperature; Adjust the pH of the solution to 4.6 to precipitate the modified product and remove the uncross-linked cross-linked peptide, centrifuge at 10000×g for 15 min, and discard the supernatant; Wash the precipitate with water at pH 4.6, and the obtained precipitate is recombinant human collagen type I.

2. The recombinant type I human collagen according to claim 1, wherein The addition amount of the glutaminase is 5 U / g, 10 U / g, 20 U / g, 30 U / g or 40 U / g protein.

3. The recombinant type I human collagen according to claim 2, wherein The reaction time is 0.5 h, 1 h, 2 h, 4 h or 6 h.

4. A preparation method of a recombinant type I human collagen composite hydrogel, characterized in that, It includes: Under an ice bath at 0 °C, prepare an ionic liquid containing 50 g / L 1,5-diazabicyclo[4.3.0]-5-nonene and 50 g / L levulinic acid; Under mechanical stirring in an oil bath at 100 °C, simultaneously add nanocellulose and the recombinant human collagen type I prepared by the preparation method according to any one of claims 1 - 3 to the ionic liquid, quickly stir the mixture to fully dissolve; Take the reactant and place it in a petri dish, let it stand at room temperature for 1 d, and then wash it repeatedly with absolute ethanol.

5. The preparation method according to claim 4, wherein The final concentration of the nanocellulose is 1.25 g / L, and the final concentration of the recombinant human collagen type I is 1.25 g / L.

6. The preparation method according to claim 5, characterized in that, The diameter of the nanocellulose is 4 - 10 nm, and the length is 200 nm.

7. A recombinant human collagen type I composite hydrogel prepared by the method according to any one of claims 4 - 6.

8. Use of the recombinant human collagen type I according to any one of claims 1 - 3 or the recombinant human collagen type I composite hydrogel according to claim 7 in the preparation of a skin tissue repair material.

9. Use of the recombinant human collagen type I according to any one of claims 1 - 3 or the recombinant human collagen type I composite hydrogel according to claim 7 in the preparation of a biological filling material.

Images