Nanometer antigen display platform based on PCV2 VLPs, preparation method and application

Abstract

The invention provides a PCV2VLPs-based nano antigen display platform, a preparation method and application, and belongs to the technical field of immune medicines. The invention provides a nanoparticle derived from a porcine circovirus 2. The nanoparticle is formed by assembling a Cap protein of the porcine circovirus 2 with a C terminal fused with SpyTag003. On the basis of a prokaryotic expression PCV2VLPs technology, a SpyTag003 / SpyCatcher 003 system is utilized, other virus antigen proteins are carried on the PCV2VLPs, a nano antigen display platform is constructed, immunogenicity research and a challenge protection test are carried out, and a theoretical foundation is laid for developing multi-unit subunit vaccines and related biological products based on the PCV2VLPs technology.

Description

Technical Field

[0001] The present invention belongs to the technical field of immunopharmaceuticals, and in particular relates to a nano antigen display platform based on PCV2 VLPs, and a preparation method and application thereof. Background Art

[0002] PCV2 is an important immunosuppressive virus that can damage the immune system of pigs, leading to mixed or secondary infections, posing a serious threat to the pig farming industry and causing significant economic losses. There is currently no effective drug for PCV2, so vaccination has become the most effective way to control PCV2 infection. Cap protein is the only known structural protein and major immunogen of PCV2. It can self-assemble into VLPs in vitro. Due to its outstanding immunogenicity, it is often used as an ideal antigen platform for subunit vaccine development.

[0003] PCV2 often causes serious mixed infection with important pig pathogens such as swine influenza virus (SIV), porcine reproductive and respiratory syndrome virus (PRRSV), and Mycoplasma hyopneumoniae (Mhp), but the commercialized combined vaccine technology currently on the market is too traditional and ineffective, so it is urgent to develop a more efficient and economical combined vaccine technology. The nano-platform prepared by the present invention can display any antigen or label on its surface according to demand, providing a new strategy for the development of multi-linked, multivalent and mosaic vaccines, meeting the demand of "one shot to prevent multiple diseases", providing new ideas for the development of new vaccines, and providing new possibilities for the development of a more efficient and economical combined vaccine technology, which not only helps to control the mixed or secondary infection caused by PCV2 and other pathogens, but also is expected to reduce the economic losses of the pig breeding industry. Summary of the invention

[0004] The present invention provides a nano antigen display platform based on PCV2 VLPs, a preparation method and an application thereof, and different virus antigens can be displayed on the nano antigen display platform to construct a multi-unit vaccine.

[0005] The invention provides a porcine circovirus 2-derived nanoparticle, wherein the nanoparticle is assembled from the Cap protein of porcine circovirus 2 with SpyTag003 fused to the C-terminus.

[0006] The present invention provides a method for preparing the above-mentioned nanoparticles, comprising the following steps:

[0007] (1) connecting the 3' end of the gene encoding the SpyTag003 protein to the 3' end of the gene encoding the Cap protein to obtain the Cap-SpyTag003 fragment;

[0008] (2) inserting the Cap-SpyTag003 fragment into an expression vector to construct a recombinant expression vector;

[0009] (3) using the recombinant expression vector to transform expression cells, induce expression and purify to obtain Cap-SpyT recombinant protein;

[0010] (4) The Cap-SpyT recombinant protein is concentrated by ultrafiltration and dialyzed to construct nanoparticles Cap-SpyTVLPs.

[0011] In a specific embodiment of the present invention, the expression vector in step (2) comprises a prokaryotic expression vector.

[0012] In a specific embodiment of the present invention, the ultrafiltration concentration in step (4) comprises placing the Cap-SpyT recombinant protein in a protein ultrafiltration tube and centrifuging to concentrate it to 1.0 mg / mL;

[0013] The molecular weight MW of the dialysis bag used for the dialysis is not higher than 3500, and the dialysis fluid is 5×PBS solution.

[0014] In a specific embodiment of the present invention, after the nanoparticles Cap-SpyTVLPs are constructed in step (4), purification is also included.

[0015] The present invention also provides the use of the nanoparticles in preparing a platform for displaying viral antigens.

[0016] The present invention also provides a multi-combination vaccine, comprising the above-mentioned nanoparticles and the recombinant protein obtained by expression;

[0017] The coding gene of the recombinant protein is obtained by connecting the viral antigen gene through a linker and a Cap-SpyCatcher003 fragment.

[0018] In a specific embodiment of the present invention, the molar ratio of the nanoparticles to the recombinant protein is 1:1.

[0019] The present invention also provides a method for preparing the above-mentioned multi-combination vaccine, comprising mixing the nanoparticles and the recombinant protein and then covalently binding them.

[0020] Beneficial effects: The present invention provides a nanoparticle derived from porcine circovirus 2, wherein the nanoparticle is assembled from the Cap protein of porcine circovirus 2 fused with SpyTag003 at the C-terminus. Based on the principle that SpyTag003 and SpyCatcher003 can be covalently bound, the present invention fuses SpyTag003 with the Cap protein for expression, so that the SpyTag003 tag is carried on the surface of the Cap VLP, and after other viral antigens are fused with SpyCatcher003 for expression, they can be carried on the surface of the CapVLP through the covalent binding of SpyCatcher003 and SpyTag003 to form a two-unit subunit vaccine.

[0021] The present invention is based on the prokaryotic expression of PCV2 VLPs technology and utilizes the SpyTag003 / SpyCatcher003 system to load other viral antigen proteins onto PCV2 VLPs, construct a nano-antigen display platform, and conduct immunogenicity research and virus attack protection tests, laying a theoretical foundation for the development of multi-subunit vaccines and related biological products based on PCV2 VLPs technology.

[0022] The present invention utilizes the self-assembly ability of PCV2 Cap protein VLP and the SpyTag003 / SpyCatcher003 protein assembly system to construct a nano-antigen display nano-platform Cap-SpyTVLPs, which can display any antigen or tag on its surface according to demand. The embodiment of the present invention constructs Cap-SpyTVLPs that display H3N2 subtype SIV HA1 antigen, which has been proven to induce mice to produce good humoral immunity and anti-virus protection ability, providing a theoretical basis for the development of PCV2 and SIV combined vaccines, and providing new ideas for the development of more new combined vaccines or mosaic vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 Schematic diagram for the construction of pET28a-Cap-SpyTag003 vector;

[0024] Figure 2 This is the result of double enzyme digestion identification of pET28a-Cap-SpyTag003;

[0025] Figure 3 This is the result diagram of the prokaryotic expression verification of Cap-SpyT;

[0026] Figure 4 This is a graph showing the protein purification results of Cap-SpyT;

[0027] Figure 5 This is a diagram showing the results of purifying Cap-SpyTVLPs using density gradient centrifugation;

[0028] Figure 6 This is the result of TEM observation of Cap-SpyTVLPs;

[0029] Figure 7 This is a graph showing the stability test results of Cap-SpyTVLPs;

[0030] Figure 8 Schematic diagram for the construction of pET28a-HA1-SpyCatcher003 vector;

[0031] Fig. 9 This is the result diagram of PCR gene amplification and double enzyme digestion identification of recombinant plasmid;

[0032] Fig.10 The results of prokaryotic expression and purification of HA1-SpyC are shown in Figure AB: SDS-PAGE and Western blot identification of prokaryotic expression of HA1-SpyCatcher003 protein; C: purification of HA1-SpyC recombinant protein;

[0033] Fig.11 This is the result of covalent binding between Cap-SpyTVLPs platform and HA1-SpyC;

[0034] Fig.12 The comparative structural diagram of the molar ratio and temperature of the covalent binding conditions;

[0035] Fig.13 This is a diagram showing the results of iodixanol density gradient centrifugation purification of Cap-SpyTVLPs-HA1-SpyC;

[0036] Fig.14 This is the transmission electron microscopy observation result of Cap-SpyTVLPs-HA1-SpyC;

[0037] Fig.15 This is the result of Cap-SpyTVLPs-HA1-SpyC dynamic light scattering analysis;

[0038] Fig.16 Figure 1 shows the immunization procedure and antibody titer determination results. A: Mouse immunization and sample collection schedule; B: ELISA determination of PCV2 Cap antibody titer; C: ELISA determination of H3N2 HA1 antibody titer.

[0039] Fig.17 The figure shows the weight monitoring results of mice in each group after the virus attack. In the figure, A: PCV2-challenged group; B: H3N2 SIV-challenged group;

[0040] Fig.18 The following are the pathological changes of spleen in mice in each group after PCV2 challenge: A: spleen autopsy; B: H&E stained spleen tissue pathological analysis (magnification 10×);

[0041] Fig.19 The figures are the pathological changes in the lungs of mice in each group after H3N2 SIV infection, A: lung autopsy; B: H&E stained lung tissue pathological analysis (magnification 20×). DETAILED DESCRIPTION

[0042] The invention provides a porcine circovirus 2-derived nanoparticle, wherein the nanoparticle is assembled from a Cap protein of porcine circovirus 2 and a SpyTag003 protein.

[0043] In one embodiment of the present invention, the SpyTag003 protein is connected to the C-terminus of the Cap protein. In the embodiment, the Cap protein Gene ID: 80510721, the SpyTag003 protein / SpyCatcher003 protein are all from the literature: Keeble AH, Turkki P, Stokes S, Khairil Anuar INA, Rahikainen R, VP, Howarth M. Approaching infinite affinity through engineering of peptide-protein interaction. Proc Natl Acad Sci US A. 2019 Dec 26; 116(52): 26523-26533. doi: 10.1073 / pnas.1909653116. Epub 2019 Dec 10. PMID: 31822621; PMCID: PMC6936558.; and the connection adopts a flexible linker, and in one embodiment the linker is a GSS Linker.

[0044] The present invention provides a method for preparing the above-mentioned nanoparticles, comprising the following steps:

[0045] (1) connecting the gene encoding the SpyTag003 protein to the C-terminus of the gene encoding the Cap protein to obtain the Cap-SpyTag003 fragment;

[0046] (2) inserting the Cap-SpyTag003 fragment into an expression vector to construct a recombinant expression vector;

[0047] (3) using the recombinant expression vector to transform expression cells, induce expression and purify to obtain Cap-SpyT recombinant protein;

[0048] (4) The Cap-SpyT recombinant protein is concentrated by ultrafiltration and dialyzed to construct nanoparticles Cap-SpyTVLPs.

[0049] In one embodiment of the present invention, a fusion protein of Cap protein and SpyTag003 protein is expressed by a prokaryotic expression system, and when constructing the recombinant sequence of the fusion protein, SpyTag003 is connected to the 3' end of the full-length cap gene of PCV2 by GSS Linker in the embodiment and marked as Cap-SpyTag003. In one embodiment of the present invention, the constructed Cap-SpyTag003 gene sequence is handed over to Shanghai Sangon Biotechnology Co., Ltd. for synthesis and inserted into the pET28a vector to construct the pET28a-Cap-SpyTag003 plasmid. The sequence connection sites of the pET28a vector of the present invention include Nco I and Xho I.

[0050] The present invention induces the expression of the fusion protein based on an expression system. In one embodiment, the expression system is a prokaryotic expression system. For example, in the embodiment, the fusion protein is expressed in Escherichia coli and purified to construct the Cap-SpyT recombinant protein.

[0051] The present invention places the Cap-SpyT recombinant protein into a protein ultrafiltration tube for centrifugation and dialysis, wherein the centrifugation is performed at a low temperature, such as 4000g centrifugation at 4°C, and then dialyzed after being concentrated to 1.0 mg / mL. The dialysate used in the dialysis is configured as a 5×PBS solution, and is placed in a 22 mm (MD34) dialysis bag [MW: 3500] for 24 hours, thereby constructing nanoparticles Cap-SpyTVLPs.

[0052] After the nanoparticle Cap-SpyTVLPs is constructed, the present invention further comprises purification, specifically comprising collecting the precipitate after ultracentrifugation, and placing the precipitate in low temperature (4°C) ddH 2 O overnight, followed by density gradient centrifugation using iodixanol solution, and then removing the iodixanol medium.

[0053] The present invention also provides the use of the nanoparticles in preparing a platform for displaying viral antigens.

[0054] The present invention utilizes the SpyTag003 and SpyCatcher003 systems to carry other viral antigen proteins on the above-mentioned nanoparticles, thereby constructing a nano antigen display platform.

[0055] The present invention also provides a multi-combination vaccine, comprising the above-mentioned nanoparticles and the recombinant protein obtained by expression;

[0056] The coding gene of the recombinant protein is obtained by connecting the viral antigen gene through a linker and a SpyCatcher003 fragment.

[0057] The recombinant protein of the present invention is a recombinant protein obtained by fusion expression of other viral antigens and SpyCatcher003, and during the fusion expression, the linker used may be 4GSS.

[0058] The present invention can prepare a multi-combination vaccine based on the above-mentioned nano antigen display platform. In one embodiment, H3N2 subtype SIV antigen HA1 is displayed based on Cap-SpyTVLPs, and the immunogenicity is verified. It is found that Cap-SpyT VLPs-HA1-SpyC can provide an immune protection effect that is superior to that of a single antigen. In a specific embodiment of the present invention, the molar ratio of the nanoparticles to the recombinant protein is 1:1.

[0059] The present invention also provides a method for preparing the above-mentioned multi-combination vaccine, comprising mixing the nanoparticles and the recombinant protein and then covalently binding them.

[0060] In the present example, Cap-SpyTVLPs and HA1-SpyC were covalently bound at a molar ratio of 1:1 at 4°C overnight, and possible aggregates were removed by centrifugation at 4000 g for 30 min at 4°C.

[0061] To further illustrate the present invention, a PCV VLPs-based nanoantigen display platform, preparation method and application provided by the present invention are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0062] Unless otherwise specified, the test materials used in the examples of the present invention are all conventional commercially available materials in the art.

[0063] in:

[0064] (1) Figure 1 The pET28a-Cap-SpyTag003 prokaryotic expression vector shown includes: pET28a prokaryotic expression vector, C-terminal 6×His tag, PCV2 Cap, GSS linker and SpyTag003 nucleic acid sequence, and pET28a prokaryotic expression vector insertion sites Nco I and Xho I;

[0065] (2) Cap-SpyT recombinant protein: including 200 mM imidazole solution and Cap-SpyT protein;

[0066] (3) Cap-SpyTVLPs: including ddH 2 O and Cap-SpyTVLPs;

[0067] (4) pET28a-HA1-SpyCatcher003 prokaryotic expression vector: including pET28a prokaryotic expression vector, C-terminal 6×His tag, H3N2 HA1, 4GSS linker and SpyCatcher003 nucleic acid sequence, and pET28a prokaryotic expression vector insertion sites EcoR I and NotI;

[0068] (5) HA1-SpyC recombinant protein: including 8 M urea solution and HA1-SpyC protein;

[0069] (6) Cap-SpyTVLPs-HA1-SpyC: The products of (3) and (5) were covalently bound at a molar ratio of 1:1 at 4°C overnight.

[0070] Example 1 Construction of a Nanoantigen Display Platform Cap-SpyTVLPs Based on PCV2 VLPs

[0071] 1.1 The SpyTag003 nucleic acid sequence was inserted into the 3' end of the full-length cap gene of PCV2 through a GSS linker and labeled as Cap-SpyTag003. The gene sequence was synthesized by Shanghai Sangon Biotechnology Co., Ltd. and inserted into the Nco I and Xho I restriction sites of the pET28a vector to construct the pET28a-Cap-SpyTag003 plasmid;

[0072] The pET28a-Cap-SpyTag003 plasmid was double-digested with Nco I and Xho I for verification. The results are as follows: Figure 2 As shown, it indicates that the Cap-SpyTag003 sequence was successfully connected.

[0073] 1.2 The Cap-SpyT recombinant protein was obtained by prokaryotic expression and non-denaturing purification (reference Yu Tao, Hu Jingyu, Si Wei, et al. Screening and identification of host nuclear proteins interacting with porcine circovirus type 2 Cap protein [J]. Chinese Journal of Veterinary Medicine, 2024, 44(01): 20-28. DOI: 10.16303 / j.cnki.1005-4545.2024.01.04.), and SDS-PAGE combined with Coomassie Brilliant Blue staining and Western blot were used to evaluate the protein purification effect and identify the eluted target protein; the prokaryotic expression results are shown in Figure 3 As shown in the figure, all recombinant proteins can be expressed in soluble form in BL21 (DE3) by Coomassie brilliant blue staining and Western blot analysis, and the molecular weight of the Cap protein inserted with the SpyTag003 sequence is slightly larger than that of the unmodified Cap protein; the purification results are shown in the figure. Figure 4As shown, the target protein can be obtained in a single and high purity by purification by nickel affinity chromatography when eluted with 200 mM imidazole.

[0074] 1.3 Place the recombinant protein in a protein ultrafiltration tube and centrifuge at 4000g at 4°C to concentrate to 1.0 mg / mL, then place it in a 22 mm (MD34) dialysis bag [MW: 3500] and dialyze for 24 hours. The dialysate is prepared as 5× PBS solution, and the dialysate is replaced 2-3 times during the period;

[0075] 1.4 Place the dialyzed Cap-SpyT VLPs in an ultracentrifuge tube and centrifuge at 160,000 g for 2 h at 4 °C using a BECKMAN ultracentrifuge (instrument model OPTIMAL-100XP, rotor model TYPE 50.2Ti). Discard the supernatant and add 800 μL ddHO. 2 O soak the precipitate at low temperature (4°C) overnight;

[0076] 1.5 Resuspend the overnight soaked precipitate and transfer it to a horizontal opening ultracentrifuge tube. Use a long needle to sequentially spread 15%, 24%, 40%, and 54% iodixanol solutions from the bottom of the tube to form a density gradient. Use a BECKMAN ultracentrifuge (instrument model OPTIMAL-100XP, rotor model SW 55Ti) to centrifuge at 350000g for 1 h at 4°C. After centrifugation, several gray-white bands can be seen. Use a long needle to carefully draw out the bands of different layers for band identification to determine the enrichment position of Cap-SpyTVLPs.

[0077] The results are as follows Figure 5 As shown, two grayish-white bands appeared in the density gradient solution. The bands were named band 1 and band 2 from bottom to top. The liquid containing the two bands was collected using a long needle and identified by SDS-PAGE electrophoresis to determine that the enrichment position of Cap-SpyTVLPs was mainly located in band 1.

[0078] 1.6 Before the subsequent experiments, it is necessary to remove the density gradient centrifugation medium iodixanol, use a protein ultrafiltration tube to ultrafilter the sample to replace the buffer, add the successfully identified sample to the sample chamber on the upper layer of the ultrafiltration tube (10kDa), centrifuge at 4000g for 10 minutes at 4°C (can be repeated multiple times), and when the volume of the sample chamber in the ultrafiltration tube is reduced to 100μL, repeat the ddH 2 O solution washing can achieve the effect of almost complete removal of iodixanol medium;

[0079] 1.7 The morphology of Cap VLPs and Cap-SpyTVLPs was observed using a transmission electron microscope (model Hitachi HT7700, working voltage 80 kV);

[0080] TEM transmission electron microscopy observation of Cap-SpyTVLPs results are as follows Figure 6 As shown, it was confirmed that Cap-SpyTVLPs underwent the expected self-assembly, maintained a regular icosahedral structure, and had a diameter slightly larger than that of Cap VLPs, which was consistent with its theoretical size.

[0081] 1.8 Thermal stability of Cap-SpyTVLPs: Equal portions of Cap-SpyTVLPs were placed at 25°C, 37°C, 55°C or 75°C for 1 h, and then cooled at 4°C for 10 min; at 4°C, centrifuged at 4000g for 30 min to remove possible aggregates, and the supernatant after centrifugation was analyzed and identified by SDS-PAGE combined with Coomassie Brilliant Blue staining; Freeze-thaw stability of Cap-SpyTVLPs: Cap-SpyTVLPs were subjected to 15 freeze-thaw cycles, with each freezing time of not less than 24 h. The 0th, 5th, 10th and 15th freeze-thaw samples were taken, respectively, and centrifuged at 4000g for 30 min at 4°C to remove possible aggregates, and the supernatant after centrifugation was analyzed and identified by SDS-PAGE combined with Coomassie Brilliant Blue staining.

[0082] The stability test results of Cap-SpyT VLPs are shown in Figure 7 As shown, the results of thermal stability analysis showed that incubation at 25°C and 37°C did not change the stability of Cap-SpyT VLPs, and the solubility was still maintained even after incubation at 55°C and 75°C for 1 hour, showing good thermal elasticity; the freeze-thaw stability results showed that Cap-SpyT VLPs maintained a stable structure after 15 freeze-thaw cycles.

[0083] Example 2 Display of H3N2 subtype SIV antigen HA1 based on Cap-SpyTVLPs

[0084] 2.1 Design HA1 gene full-length specific primers based on the full genome sequence of influenza A virus (A / swine / Guangdong / 04 / 2005 (H3N2)):

[0085] HA1-F (SEQ ID No. 1): CAAAAACTTCCCGGAAATGACAA;

[0086] HA1-R (SEQ ID No. 2):TGGTGGTGCTCGAGTGCGGCCGCTCTAGTTTGTTTCTCTGGTACATT;

[0087] The SpyCatcher003 gene sequence was synthesized by Shanghai Sangon Biotechnology Co., Ltd. and inserted into the pET28a vector. The primers were designed as follows:

[0088] SpyCatcher003-F(SEQ ID No.3):ATGGGTCGCGGATCCGAATTCATGGGTTCAAGTGTAACCAC;

[0089] SpyCatcher003-R (SEQ ID No. 4):TTCCGGGAAGTTTTGTGAACCGCCAGAGCCGC.

[0090] The restriction enzyme sites were EcoR I and NotI, and the expected amplified fragments were 384 bp and 987 bp. The homologous recombination primers were synthesized by Zhejiang Shangya Biotechnology Co., Ltd. The SpyCatcher003 nucleic acid sequence was connected to the N-terminus of the H3N2 HA1 gene through a 4GSS linker to construct the following: Figure 8 The pET28a-HA1-SpyCatcher003 plasmid shown in FIG. 1 is shown in FIG. 1 ; the results of PCR gene amplification and double enzyme digestion of the recombinant plasmid are shown in FIG. Fig. 9 As shown, it indicates that the pET28a-HA1-SpyCatcher003 plasmid was successfully constructed.

[0091] 2.2 HA1-SpyC recombinant protein was obtained by prokaryotic expression and denaturation purification. SDS-PAGE combined with Coomassie Brilliant Blue staining and Western blot were used to evaluate the protein purification effect and identify the eluted target protein; the results are as follows Fig.10 As shown in A, all recombinant proteins were successfully expressed; purification conditions were explored, such as Fig.10 As shown in B, it was found that the recombinant protein was mainly present in the precipitate of the broken bacteria, that is, the recombinant protein was mainly present in the form of inclusion bodies; the recombinant protein was purified by nickel affinity chromatography, and the results were as follows Fig.10 As shown in C, when eluted with Buffer D solution, a relatively single and higher purity target protein can be obtained.

[0092] 2.3 Cap-SpyTVLPs were covalently bound to HA1-SpyC at molar ratios of 1:1, 1:3, and 1:0.3 at 4°C and 25°C overnight, and possible aggregates were removed by centrifugation at 4000 g for 30 min at 4°C;

[0093] The results of covalent binding of Cap-SpyT VLPs platform with HA1-SpyC are shown in Fig.11 and Fig.12 As shown, Fig.11 SDS-PAGE combined with Coomassie Brilliant Blue staining and Western blot were used to analyze the assembly efficiency of the display platform, confirming the effective covalent reaction, which can be used for subsequent experiments.

[0094] When further exploring the optimal covalent binding molar ratio and temperature, the minimum amount of unbound Cap-SpyTVLPs remaining was taken as the benchmark, e.g. Fig.12 As shown, when Cap-SpyTVLPs were combined with HA1-SpyC at a molar ratio of 1:1 at 4 °C, the residual Cap-SpyTVLPs were minimal and the assembly efficiency was highest.

[0095] The results of iodixanol density gradient centrifugation purification of Cap-SpyTVLPs-HA1-SpyC are as follows Fig.13 As shown, a grayish-white band appeared in the density gradient solution. The liquid containing the band was collected using a long needle, and the iodixanol medium was removed.

[0096] 2.4 The morphology of HA1-SpyC displayed on the Cap-SpyTVLPs platform was observed using a transmission electron microscope (model Hitachi HT7700, working voltage 80 kV), and the size distribution of HA1-SpyC displayed on the Cap-SpyTVLPs platform was detected by dynamic light scattering (DLS) using a laser particle size analyzer (model Malvern Zetasizer Nano ZS90).

[0097] The results of transmission electron microscopy observation of Cap-SpyTVLPs-HA1-SpyC are shown in Fig.14 As shown, it is confirmed that Cap-SpyT VLPs and HA1-SpyC have the expected covalent binding, maintaining the structure of the nanoparticles. At the same magnification, the diameter of Cap-SpyTVLPs-HA1-SpyC is significantly larger than that of Cap-SpyTVLPs, which is consistent with its theoretical size. The dynamic light scattering analysis results of Cap-SpyT VLPs-HA1-SpyC are shown in Fig.15 As shown, Cap-SpyT VLPs-HA1-SpyC showed a relatively single size distribution of about 53 nm, which was significantly increased compared to the particle size of Cap VLPs of about 24 nm.

[0098] Example 3 Study on the immunogenicity of H3N2 subtype SIVHA1 antigen displayed on the Cap-SpyTVLPs platform

[0099] 3.1 Sixty healthy SPF BALB / c female mice aged 6 to 8 weeks were randomly divided into 12 groups, with 5 mice in each group. They were housed in negative pressure SPF mouse isolation cages within the barrier of the GCP animal experimental platform of the Animal Medical Center of Zhejiang University. The mice were free to eat and drink, and the feed and drinking water were sterilized.

[0100] Table 1 Specific immune groups

[0101]

[0102] 3.2 The immunization dose is 20 μg of monomeric protein or the corresponding amount of VLPs, VLPs-antigen covalent binding products (unbound VLPs and antigens are excluded by size exclusion chromatography) to produce an equimolar dose of antigen protein. TM ISA201 VG adjuvant was emulsified at 32°C in a 1:1 volume ratio, and each immunization dose was 100 μL;

[0103] 3.3 Each group of mice was immunized twice by hind leg intramuscular injection at an interval of 14 days. Blood samples were collected from the mandibular vein 14 days after each immunization to detect specific antibodies by ELISA;

[0104] 3.4 PCV2 and H3N2 SIV virus challenge protection tests were conducted 28 days after the first immunization. Mice in groups I to VI were challenged with PCV2 HZ0201 strain (10 7.3 TCID 50 / mL) were intraperitoneally injected with 200 μL of virus per mouse; mice in groups VII-XII were injected with influenza A virus (A / swine / Guangdong / 04 / 2005 (H3N2)) (10 6.5 TCID 50 / mL) for intranasal challenge, with each mouse receiving a 50 μL challenge.

[0105] 3.5 The weight loss of mice after infection was recorded every day within 14 days after infection. Mice in the H3N2 SIV group were killed and autopsied on the 6th day after infection, and lung samples were taken to observe the lesions. Mice in the PCV2 group were killed and autopsied on the 14th day after infection, and spleen samples were taken to observe the lesions. Tissues were collected and immersed in 4% paraformaldehyde and sent to Hangzhou Hawke Biological Company for preparation of pathological sections and HE staining.

[0106] Immunization procedures and antibody titer test results Fig.16 As shown, Fig.16 In the middle B group, the antibody titers against PCV2 Cap antigen were 1:1120, 1:1280, 1:1600, and 1:1280 after the first immunization, and 1:21760, 1:66560, 1:58880, and 1:47360 after the second immunization, respectively. Fig.16As shown in C, for SIV HA1 antigen, the antibody titers of group VIII (HA1-SpyC), group IX (Cap-SpyTVLPs / HA1-SpyC separately), group X (Cap-SpyTVLPs-HA1-SpyC), and group XI (Cap-SpyTVLPs-HA1-SpyC Freeze-thaw cycle) were 1:1440, 1:2080, 1:3040, and 1:1800 after the first immunization, and 1:56300, 1:71680, 1:112640, and 1:89600 after the second immunization. The results showed that the antibody level produced by mice immunized with the Cap-SpyTVLPs platform displaying the H3N2 subtype SIV HA1 antigen was higher than that of the single immunization or separate immunization groups, indicating that the use of PCV2VLPs to display the HA1 antigen is beneficial to improve the immunogenicity of the two, and 15 freeze-thaw cycles do not affect their immunogenicity;

[0107] The weight monitoring results of mice in each group after the virus attack are as follows: Fig.17 As shown, Fig.17 The body weight of mice in the 6 groups of A decreased within 1-4 days after being challenged with PCV2HZ0201 strain, and gradually recovered from the 5th to 7th day. The mice in the group with the immunogen Cap-SpyTVLPs-HA1-SpyC and its freeze-thaw cycle had recovered to their original weight before the challenge on the 6th to 7th day; the groups immunized with the immunogens Cap-SpyTVLPs and HA1 monomer protein and Cap-SpyT VLPs alone did not recover to their original weight before the challenge until the 10th to 13th day; and the group with the immunogens PBS and HA1 monomer protein had the slowest weight gain. Fig.17 As shown in B, after the influenza A virus (A / swine / Guangdong / 04 / 2005 (H3N2)) strain was challenged, the groups with PBS and Cap-SpyT VLPs as the immunogens showed significant weight loss, reaching the lowest value on the 2nd to 4th day, gradually recovering on the 5th day, and the body weight on the 6th day was still less than 95% of the original body weight before the challenge; the groups with HA1 monomer protein and HA1 monomer protein and Cap-SpyT3 VLPs alone provided only partial protection, and were still accompanied by significant weight loss, reaching the lowest value on the 2nd to 3rd day, gradually recovering on the 4th day, and the body weight on the 6th day was slightly lower than the original body weight before the challenge; in contrast, the mice in the immunogen Cap-SpyT VLPs-HA1-SpyC and its freeze-thaw cycle group did not lose weight significantly after the attack;

[0108] The pathological changes of spleen in each group of mice after PCV2 challenge were as follows Fig.18As shown, spleen samples were collected from mice in groups I-VI on the 14th day after the PCV2HZ0201 strain was challenged, and lesions were observed and histologically examined. There was no significant difference in the spleen samples of the six groups of mice by naked eye observation, but the spleen pathological sections of mice in the groups with PBS and HA1-SpyC monomer protein as the immunogens showed a significant increase in the number of white pulp and lymphoid bodies; the groups immunized with Cap-SpyTVLPs alone and HA1 monomer protein and Cap-SpyTVLPs alone provided only partial protection, and the pathological sections showed that the number of white pulp and lymphoid bodies still increased; in contrast, the pathological sections of mice in the group with Cap-SpyT VLPs-HA1-SpyC and its freeze-thaw cycle as the immunogens showed a near-normal state after the attack, and almost no lesions were observed;

[0109] The results of lung pathological changes in each group of mice after H3N2 SIV infection are shown in Fig.19 As shown in the figure, lung samples of mice in groups VII-XII were collected on the 6th day after being challenged with influenza A virus (A / swine / Guangdong / 04 / 2005 (H3N2)) strain for lesion observation and histological examination. The lungs of mice in groups immunized with PBS and Cap-SpyTVLPs alone showed substantial lesions. Pathological sections showed a large number of inflammatory cell infiltrations, the infiltration components were mainly lymphocytes, and the alveolar septa were congested and hyperplastic. The groups immunized with HA1 monomer protein and HA1 monomer protein and Cap-SpyTVLPs alone provided only partial protection. The lungs still had lesions but the symptoms were milder than those of the non-protective groups. Pathological sections showed inflammatory cell infiltration around the bronchi, but not much in the alveoli. In contrast, the groups immunized with Cap-SpyTVLPs alone provided only partial protection. The lungs of mice in the VLPs-HA1-SpyC and freeze-thaw cycle groups showed a near-normal state after attack, with almost no lesions observed. Pathological sections showed that the cell structure of the mouse lung tissue was normal, there was no edema in the alveolar septa, and no inflammatory cell infiltration.

[0110] In conclusion, the Cap-SpyTVLPs constructed by the present invention and displaying the H3N2 subtype SIV HA1 antigen can induce mice to produce better humoral immunity and protection against virus attack.

[0111] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A porcine circovirus 2-derived nanoparticle, characterized in that The nanoparticles are assembled from the Cap protein of porcine circovirus 2 with SpyTag003 fused to the C-terminus.

2. The method for preparing nanoparticles according to claim 1, characterized in that: The following steps are involved: (1) connecting the 3' end of the gene encoding the SpyTag003 protein to the 3' end of the gene encoding the Cap protein to obtain the Cap-SpyTag003 fragment; (2) inserting the Cap-SpyTag003 fragment into an expression vector to construct a recombinant expression vector; (3) using the recombinant expression vector to transform expression cells, induce expression and purify to obtain Cap-SpyT recombinant protein; (4) The Cap-SpyT recombinant protein is concentrated by ultrafiltration and dialyzed to construct nanoparticles Cap-SpyTVLPs.

3. The preparation method according to claim 2, characterized in that: The expression vector in step (2) includes a prokaryotic expression vector.

4. The preparation method according to claim 2, characterized in that: The ultrafiltration concentration in step (4) includes concentrating the Cap-SpyT recombinant protein to 1.0 mg / mL.

5. The preparation method according to claim 2, characterized in that: The molecular weight MW of the dialysis bag used for dialysis in step (4) is not higher than 3500, and the dialysis fluid is 5×PBS solution.

6. The preparation method according to claim 2, characterized in that: After the nanoparticles Cap-SpyTVLPs are constructed in step (4), purification is also included.

7. Use of the nanoparticles according to claim 1 in preparing a platform for displaying viral antigens.

8. A combined vaccine, characterized in that: Comprising the nanoparticles according to claim 1 and the recombinant protein obtained by expression; The coding gene of the recombinant protein is obtained by connecting the viral antigen gene through a linker and a SpyCatcher003 fragment.

9. The multiple vaccine according to claim 8, characterized in that: The molar ratio of the nanoparticles to the recombinant protein is 1:

1.

10. The method for preparing the combined vaccine according to claim 8 or 9, characterized in that: The method comprises mixing the nanoparticles and the recombinant protein and then covalently binding them.

Images