Isothermal amplification kit for detecting porcine circovirus type 3

Abstract

The application belongs to the field of biological detection, and particularly relates to an isothermal amplification kit for detecting porcine circovirus type 3. The application provides an isothermal amplification detection primer group for porcine circovirus type 3 (PCV3), which comprises a pair of outer primers (LOF and LOR) and a pair of inner primers (LIF and LIR) and is designed according to the conserved sequence of the porcine circovirus type 3. The primer group has low design difficulty, and maintains similar sensitivity and specificity to other isothermal amplification reactions such as a loop-mediated isothermal amplification method, can be suitable for target sequences with higher GC content and below 200 bp, has no denaturation and annealing process, is suitable for on-site detection, and has great application potential.

Description

Technical Field

[0001] This invention belongs to the field of biological detection, specifically relating to an isothermal amplification kit for detecting porcine circovirus type 3. Background Technology

[0002] Porcine circovirus type 3 (PCV3) can cause porcine dermatitis and nephropathy syndrome (PDNS), with clinical manifestations including sow abortion, piglet diarrhea and fetal death, and dermatitis, making it one of the major pathogens threatening global swine health. The impact of PCV3 co-infection on the host is not accurately understood, making effective PCV3 prevention a key measure to reduce the disease's harm. Currently, PCV3 pathogen detection methods mainly include conventional PCR and real-time quantitative PCR. However, these detection techniques require complex instruments and equipment, making rapid and effective daily testing difficult for remote and rudimentary pig farms, and they cannot simultaneously identify two pathogens. Since 2017, PCV3 has appeared in pig farms in many locations, causing significant losses, and the situation is worsening. With the increasing demand for disease control in swine farms, there is an urgent need to develop a rapid and accurate product for identifying and diagnosing PCV3 to address its high infection rate and susceptibility to co-infection with other viruses. This is crucial for virus prevention, control, and eradication.

[0003] The first step in clinical diagnosis on farms is clinical assessment, but PCV3 infection often presents as subclinical, manifesting only as a decrease in average daily weight gain, or as highly complex symptoms from mixed infections with other pathogens, making definitive diagnosis difficult using only clinical and pathological methods. Polymerase chain reaction (PCR) is the most common nucleic acid amplification method, with relatively simple primer design, making it easy to apply to the detection of various pathogens. However, its requirements for reaction temperature and equipment make it difficult to use in field testing. Compared to PCR, isothermal amplification methods such as loop-mediated isothermal amplification (LAMP) and recombinase polymerase amplification (RPA) have significant advantages in field testing applications because they do not require complex temperature control equipment. However, complex primer design limits their application in detecting short targets or sequences with abnormal GC content. For example, LAMP's amplification efficiency decreases significantly when dealing with fragments shorter than 200 bp or fragments with excessively high or low GC content, easily leading to false positives. Therefore, establishing an isothermal amplification method suitable for detecting nucleic acid fragments of PCV3 with different lengths and GC contents has important application value in rapid clinical detection. Summary of the Invention

[0004] The first aspect of the present invention is to provide a primer set.

[0005] A second aspect of the present invention is to provide a reagent kit.

[0006] The third aspect of this invention is to provide an application.

[0007] The fourth aspect of this invention aims to provide a method.

[0008] The fifth aspect of the present invention is to provide a detection system.

[0009] To achieve the above-mentioned objectives of this invention, the technical solution adopted by this invention is as follows:

[0010] A first aspect of the present invention provides a primer set, characterized in that the primer set comprises an outer primer and an inner primer;

[0011] The outer primers comprise LOF and LOR: the sequence of LOF is shown in SEQ ID NO.2, and the sequence of LOR is shown in SEQ ID NO.3;

[0012] The sequence of LIF is shown in SEQ ID NO.4, and the sequence of LIR is shown in SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7.

[0013] Preferably, the LIR sequence is as shown in SEQ ID NO.7.

[0014] Preferably, the primer set is used to detect porcine circovirus type 3; further, it is used to detect the Cap gene of porcine circovirus type 3.

[0015] Preferably, the Cap gene is as shown in SEQ ID NO.1:

[0016] GCTCAGCAAACAAAAACTATGTTCGGGCACACAGCCATAGATCTAGACGGCGCCTGGACCACAAACACTTGGCTCCAAGACGACCCTTATGCGGAAAGTTCCACTCGTAAAGTTATGACTTCTAAAAAAAAACACAGCCGTTACTTCACCCCCAAACCAATTCTGGCGGGAACTACCAG CGCTCACCCAGGACAAAGCCTCTTCTTTTTCCAGACCCACCCCATGGCTCAACATATGACCCACCGTTCAATGGGGAGCACTGCTTTGGAGCATTTATGTCCCGGAAAAAAACTGGAATGACAGACTTCTACGGCACCAAAGAAGTTTTGGATTCGTTACAAGTCCGTTCTCTAA.

[0017] A second aspect of the present invention provides a kit comprising the primer set of the first aspect of the present invention.

[0018] Preferably, the kit further comprises a probe.

[0019] Preferably, the probe comprises a fluorescent probe and a quenching probe.

[0020] Preferably, the sequence of the fluorescent probe is as shown in SEQ ID NO.8.

[0021] Preferably, the sequence of the quenching probe is as shown in SEQ ID NO.9.

[0022] Preferably, the 5' end of the fluorescent probe is labeled with a fluorescent group.

[0023] Preferably, the 3' end of the quenching probe is marked with a quenching group.

[0024] Preferably, the fluorescent group includes at least one of FAM and HEX.

[0025] Preferably, the quenching group includes at least one of BHQ1 and TAMRA.

[0026] Preferably, the kit further includes at least one of dNTPs, DNA polymerase, positive standard template, negative control standard, reaction buffer, and water.

[0027] Preferably, the DNA polymerase includes at least one of Taq DNA polymerase, Bsu DNA polymerase, Bst DNA polymerase, KOD DNA polymerase, Phusion DNA polymerase, and T7 DNA polymerase.

[0028] Preferably, the reaction buffer comprises at least one of Tris-HCl, KCl, (NH4)2SO4, MgSO4, and Tween 2O.

[0029] Preferably, the positive standard template includes a plasmid containing the PCV3-Cap gene.

[0030] Preferably, the negative control standard includes a plasmid that does not contain the PCV3-Cap gene.

[0031] A third aspect of the invention provides the use of the primer set of the first aspect of the invention and / or the kit of the second aspect of the invention in the detection of porcine circovirus type 3 for non-diagnostic purposes.

[0032] Preferably, the detection of porcine circovirus type 3 is performed by detecting the Cap gene of porcine circovirus type 3 (e.g., the Cap gene shown in SEQ ID NO. 1).

[0033] A fourth aspect of the present invention provides a method for detecting porcine circovirus type 3 for non-diagnostic purposes, using the primer set of the first aspect of the present invention and / or the kit of the second aspect of the present invention to detect the sample.

[0034] Preferably, the reaction conditions of the method are as follows: the reaction is carried out at 60-65°C, 50-70 seconds per cycle, for a total of 38-42 cycles, and the fluorescence signal is measured at the end of each cycle.

[0035] Preferably, the reaction conditions are as follows: the reaction is carried out at 63°C, for 60 seconds per cycle, for a total of 40 cycles, and the fluorescence signal is measured at the end of each cycle.

[0036] Preferably, the detection of porcine circovirus type 3 is performed by detecting the Cap gene of porcine circovirus type 3 (e.g., the Cap gene shown in SEQ ID NO. 1).

[0037] A fifth aspect of the present invention provides a detection system.

[0038] Preferably, the detection system includes the following components:

[0039] 1) Detection components for the Cap gene of porcine circovirus type 3;

[0040] 2) Data processing components;

[0041] 3) Result output components.

[0042] Preferably, the detection component for the Cap gene of porcine circovirus type 3 contains the primer set of the first aspect of the present invention and / or the kit of the second aspect of the present invention.

[0043] Preferably, the detection component includes a detection instrument, which is selected from one or more of a real-time PCR instrument and a sequencer.

[0044] Preferably, the data processing component is configured as follows:

[0045] Based on the detection results of the detection component, it is determined whether the sample contains porcine circovirus type 3 (PCV3).

[0046] Preferably, the criteria for judging the data processing component are:

[0047] If the Cap gene of porcine circovirus type 3 is detected in the sample to be tested, then the sample to be tested contains or is suspected of containing porcine circovirus type 3.

[0048] If the Cap gene of porcine circovirus type 3 is not detected in the sample to be tested, then the sample to be tested does not contain or is suspected of not containing porcine circovirus type 3.

[0049] The beneficial effects of this invention are:

[0050] This invention is based on an isothermal amplification method suitable for detecting nucleic acid fragments of different lengths and GC contents, and simplifies the primer process—linear displacement isothermal amplification (LDIA). It provides a primer set for isothermal amplification detection of porcine circovirus 3 (PCV3), including an outer primer (LOF and LOR) and inner primers (LIF and LIR). Since the concentration of the inner primers in the mixture is higher than that of the outer primers, they are easily bound to the template and amplified along with the template. Single-stranded DNA (ssDNA) is formed with the help of the extended outer primers and the strand displacement activity of BST DNA polymerase. Short double-stranded DNA (dsDNA) is formed through the inner primers. At 60°C, these short DNA strands (40–120 bp) undergo double-stranded DNA unwinding, i.e., they are in a dissociated and semi-dissociated state. Subsequently, LIF and LIR anneal to the dsDNA and generate new amplicones. These dsDNAs continuously become new templates and initiate a cyclic reaction. Based on this principle, Cap-LAR-FAM and Cap-LAR-BHQ1 are added to the reaction to form a shorter product with LIF or LIR. The innovation of this invention lies in simplifying the primers for isothermal amplification of PCV3 virus detection. Previous isothermal amplification primers required special structures, while this invention unexpectedly discovered that linear primers without special structures can also achieve isothermal amplification under certain combinations.

[0051] The primer set provided by this invention can significantly reduce the difficulty of primer design while maintaining similar sensitivity and specificity to other isothermal amplification reactions such as loop-mediated isothermal amplification. It can be applied to target sequences with higher GC content and those below 200 bp. It has excellent application prospects in on-site detection, especially when dealing with complex nucleic acid sequences. Attached Figure Description

[0052] Figure 1 The figure shows the effect of reaction temperature on the detection of the PCV3-Cap gene by the LDIA method.

[0053] Figure 2 The amplification efficiency of the PCV3-Cap gene was detected by LDIA: where A is the amplification curve result and B is the standard curve result.

[0054] Figure 3 The graph shows the sensitivity results of LDIA for detecting the PCV3-Cap gene: A represents the amplification curve of LDIA for detecting the PCV3-Cap gene; B represents the amplification curve of LAMP for detecting the PCV3-Cap gene; numbers 1-8 represent: 10 7 106 10 5 10 4 10 3 10 2 10 1 and 10 0 Copies / μL template.

[0055] Figure 4 The diagram shows the specificity results of the PCV3-Cap gene detection by LDIA method: A is the amplification curve of the PCV3-Cap gene detected by LDIA method; B is the amplification curve of the PCV3-Cap gene detected by LAMP method; 1-5 represent: 1. PCV3 genomic DNA; 2. PRV genomic DNA; 3. PRRSV genomic DNA; 4. Streptococcus suis serological type 2 genomic DNA; 5. Negative control. Detailed Implementation

[0056] The following will describe the concept and technical effects of the present invention clearly and completely with reference to the embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0057] The primers and probes used in the following examples were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0058] Example 1 Primer Design Rules

[0059] 1. Tm value: Effective initiation temperature, generally 5-10℃ higher than the Tm value. If the primer Tm value is estimated using the formula Tm = 4(G+C) + 2(A+T), then the effective primer Tm is 55-70℃, with the optimal Tm value being close to 60℃.

[0060] 2. Primer end stability: The 3' Gibbs free energy of all primers is ΔG≤-4kcal / mol.

[0061] 3. Target GC content: Both excessively high and low GC content are detrimental to initiation of the reaction. The GC content of the outer primers (LOF and LOR) and the inner primers (LIF and LIR) should not differ too much, and the content should be between 35% and 70%.

[0062] 4. Secondary Structure: It is crucial that the primers themselves do not form secondary structures, especially for inner primers. Designing primers to avoid secondary structures is particularly important, as they not only affect reaction efficiency but can also lead to non-specific amplification. To prevent primer dimers, ensuring the 3' ends are not complementary is also essential. If judged manually, the number of consecutive complementary bases within the primer itself or between primers should not exceed 3 bp. Avoid having three Gs or three Cs in a chain at the 3' end of the primer; the terminal base at the 3' end should ideally be T, C, or G, rather than A. If primer dimers and hairpin structures are unavoidable, their ΔG value should be kept as low as possible (less than 4.5 kCl / mol).

[0063] 5. Primer distance: The distance from the 5' end of LIF to the 5' end of LIR is 60–160 bp; the distance from the 3' end of LOF to the 5' end of LIF is 0–60 bp. The LAR primer is positioned between LIF and LIR, and the region where LAR binds to the target does not overlap with the regions where LIF and LIR bind to the target.

[0064] Primers for the LDIA method can be designed using the standard PCR design software Primer Premier 6. When the primers meet the requirement of a Tm value close to 60°C, preventing the formation of primer dimers and secondary structures, they can amplify targets with lengths of 100–200 bp and GC content of 35%–70%. In contrast, primers for the LAMP method require screening of six regions of the target. The length of the primers themselves and the distance between primers make primer design more complex, making it difficult to design primer sets for amplifying target sequences shorter than 200 bp. Furthermore, the LAMP method struggles to design primers for target sequences with high GC content (greater than 70%) and low GC content (less than 35%). Therefore, compared to LAMP, the primer design method in this invention is simpler and can be used to detect shorter target sequences.

[0065] Example 2: LDIA Target Selection, Primer and Probe Screening, and Reaction Conditions

[0066] This invention targets the Cap gene of porcine circovirus type 3 (PCV3). Mega 11.0 was used for sequence screening of conserved sequences, ultimately targeting the Cap gene sequence of PCV3 (GenBank: MK142772.1) (SEQ ID NO.1). Primers for LDIA were designed and screened using Primer 6.0 and Oliogo7. The selected primer and probe sequences are shown in Table 1 below.

[0067] Table 1 Primers for PCV Cap gene LDIA method

[0068]

[0069] The 5' end of the PCV3 Cap gene detection probe is labeled with fluorescein FAM and named Cap-LAR-FAM; the 3' end of the probe is labeled with a complementary primer of approximately 20 bp using the quencher BHQ1 and named Cap-LAR-BHQ1.

[0070] LDIA reaction system: The concentrations of each component in every 25 μl of the system are as follows: Thermopol Isothermal Buffer (B1003S, NEB, including 200 mM Tris-HCl, 500 mM KCl, 100 mM (NH4)2SO4, 20 mM MgSO4 and 1% Tween 2O), 1.4 mM dNTPs (PO31-01, Vazyme), Bst 2.0 DNA polymerase (M0538S, NEB) and ddH2O. The concentrations of LDIA primers are shown in Table 2 below: 1.4 μM LIF / LIR, 0.6 μM LAR-probe / LAR-quencher and 0.2 μM LOF / LOR.

[0071] Table 2 LDIA reaction system

[0072]

[0073] The reaction conditions were as follows: the reaction was carried out at 63°C for 1 minute per cycle, for 40 cycles, and the fluorescence signal was measured at the end of each cycle.

[0074] Comparative Example 1: Design of LAMP Primers

[0075] LAMP primers for the PCV 3Cap gene (GenBank: MK142772.1) were designed using the online PrimerExplorer V5 software (http: / / primerexplorer.jp / lampv5e / index.html). The selected primer sequences are shown in Table 3 below:

[0076] Table 3 Primers for PCV Cap gene LAMP method

[0077]

[0078]

[0079] LAMP reaction system: The concentrations of each component in every 25 μl of the system are as follows: Thermopol Isothermalbuffer (B1003S, NEB), 1.4 mM dNTPs (P031-01, Vazyme), Bst 2.0 DNA polymerase (M0538S, NEB). LAMP primer concentrations are shown in Table 4 below: 1.4 μM FIP / BIP, 0.6 μM LF / LB, and 0.2 μM F3 / B3.

[0080] Table 4 LAMP reaction system

[0081]

[0082] The reaction conditions were as follows: the reaction was carried out at 63°C for 1 minute per cycle, for 40 cycles, and the fluorescence signal was measured at the end of each cycle.

[0083] Example 3: Construction of plasmid standards

[0084] The conserved sequence of PCV3 (SEQ ID NO.1) was synthesized into pMD19-T to obtain the recombinant plasmid pMD19-T-Cap. The plasmid was synthesized by Sangon Biotech (Shanghai) Co., Ltd. The concentration of the extracted plasmid was measured using a micro-ultraviolet spectrophotometer. The copy number was calculated using the formula: DNA copy number = (plasmid concentration × 6.02 × 10⁻⁶) / (plasmid concentration × 6.02 × 10⁻⁶) 23 ×10 -9 The copy number of the standard plasmid DNA is calculated as (660 × total plasmid length).

[0085] Example 1: Effect of reaction temperature on the LDIA method

[0086] This invention analyzes the effect of high temperature on LDIA. Considering that the inactivation temperature of Bst DNA polymerase is around 80°C, to balance high temperature and enzyme activity, this invention adopts the reaction system and reaction conditions in Example 2, using LIF and LIR3 primers, and setting the test temperature range to 60–75°C. The reaction results are as follows. Figure 1 As shown, 63℃ is the optimal temperature for the reaction.

[0087] Example 2: Efficiency of positive template amplification by LDIA method

[0088] Dilute 10-fold (10 9 10 8 10 7 10 6 10 5 10 4 10 3The standard plasmid pMD19-T-Cap (copies / μL) was used as a template, and each dilution was repeated three times. The reaction system was performed according to the "LDIA reaction system in Table 2" for gradient amplification. LIF and LIR3 primers were used. The reaction was carried out at 63℃ for 1 minute per cycle, for 40 cycles. The fluorescence signal was measured at the end of each cycle. The amplification curve of template copy number versus cycle number (Ct value) is shown in the figure. Figure 2 As shown in Figure A. After the test, a standard curve was plotted by comparing the concentration (lg, copies / μL) of each standard (X-axis) with its corresponding cycle number (Ct, Y-axis). According to the formula: Amplification efficiency E = 10... -1 / 斜率 -1, such as Figure 2 As shown in Figure B, the slope of the PCV3 Cap gene is -3.4189, and the calculated amplification efficiency of PCV3 Cap is 98.43%, proving that the constructed LDIA has high amplification efficiency.

[0089] Example 3: Sensitivity Test of LDIA Method

[0090] Diluted 10-fold (10 7 10 6 10 5 10 4 10 3 10 2 10 1 and 10 0 The standard plasmid pMD19-T-Cap (copies / μL) was used as a template to evaluate the sensitivity of LDIA. The inner primers used were LIF and LIR3, and the reaction system was the same as in Table 2. Simultaneously, a LAMP method targeting the same region of this gene was designed for comparison (Comparative Example 1). Because the LAMP method is not suitable for amplifying very short target genes, the target gene length of this LAMP method was 200 bp. Results are as follows... Figure 3 As shown, the lowest detection limit of LDIA is 100 copies / μL, which is comparable to the sensitivity of LAMP.

[0091] Example 4: Specificity test of LDIA method

[0092] LDIA was subjected to specificity testing and compared with the LAMP method. The reaction system was the same as in Example 2 and Comparative Example 1. In Example 2, LIF / LIR3 primers were used and the DNA template was 2 × 10⁻⁶. 4 copies, the result is as follows Figure 4As shown, under normal amplification conditions in the positive group, the negative group did not produce non-specific signals even after prolonged incubation, demonstrating good specificity. Therefore, the sensitivity and specificity of the LDIA method are comparable to those of the LAMP method. Furthermore, the negative group obtained by the LDIA method exhibits a lower background signal than that obtained by the LAMP method. This may be related to its simpler primer composition, as LAMP requires circular primers (FIP / BIP), while LDIA uses linear primers, making the design conditions easier to meet than those for circular primers.

[0093] Example 5: Repeatability Test of LDIA Method

[0094] Using 10-fold serially diluted quantitative PCR standard plasmids as templates, the following 10-fold serial dilutions were performed: 2 × 10⁻⁶ 6 copies / μL, 2×10 5 copies / μL, 2×10 4 copies / μL, 2×10 3 copies / μL, 2×10 2 The samples were collected in copies / μL. Using the inner primers LIF and LIR3, LDIA was performed using the reaction system and procedure in Table 2. Each reaction was repeated in triplicate for three cycles. The mean number of cycles, standard deviation, and coefficient of variation were calculated. The results are shown in Table 5. The coefficients of variation within and between groups were all less than 2.00%, which proves that the established method has good reproducibility.

[0095] Table 5. Results of repeatability tests for the LDIA method.

[0096]

[0097] In summary, compared to LAMP, the primer design method in LDIA of this invention is simpler, more specific, and applicable to target sequences with higher GC content and less than 200bp.

Claims

1. A reagent kit, characterized in that: The kit includes a primer set and probes; The primer set includes outer primers and inner primers; The outer primers comprise LOF and LOR: the sequence of LOF is shown in SEQ ID NO.2, and the sequence of LOR is shown in SEQ ID NO.3; The inner primers comprise LIF and LIR: wherein the sequence of LIF is shown in SEQ ID NO.4, and the sequence of LIR is shown in SEQ ID NO.7; The probe includes a fluorescent probe and a quenching probe; The sequence of the fluorescent probe is shown in SEQ ID NO.8; The sequence of the quenching probe is shown in SEQ ID NO.9; The 5' end of the fluorescent probe is labeled with a fluorescent group; The quenching probe has a quenching group marked at its 3' end.

2. The reagent kit according to claim 1, characterized in that: The fluorescent group includes at least one of FAM and HEX; and / or The quenching group includes at least one of BHQ1 and TAMRA.

3. The reagent kit according to claim 2, characterized in that: The kit also includes at least one of dNTPs, DNA polymerase, positive standard template, negative control standard, reaction buffer, and water.

4. The reagent kit according to claim 3, characterized in that: The DNA polymerase includes at least one of Taq DNA polymerase, Bsu DNA polymerase, Bst DNA polymerase, KOD DNA polymerase, Phusion DNA polymerase, and T7 DNA polymerase. The reaction buffer includes at least one of Tris-HCl, KCl, (NH4)2SO4, MgSO4, and Tween 20; The positive standard template includes a plasmid containing the PCV3-Cap gene; The negative control standard includes a plasmid that does not contain the PCV3-Cap gene.

5. The use of the kit according to any one of claims 1-4 in the detection of porcine circovirus type 3 for non-diagnostic purposes.

6. A method for detecting porcine circovirus type 3 for non-diagnostic purposes, comprising detecting a sample using the kit described in any one of claims 1-4; The reaction conditions of the method are as follows: the reaction is carried out at 60-65℃, 50s-70s per cycle, for a total of 38-42 cycles, and the fluorescence signal is measured at the end of each cycle.

7. A detection system for porcine circovirus type 3, the detection system comprising the following components: 1) Detection components for the Cap gene of porcine circovirus type 3; 2) Data processing components; 3) Output components; The detection component for the Cap gene of porcine circovirus type 3 contains the kit described in any one of claims 1-4.

8. The detection system according to claim 7, characterized in that: The detection component includes a detection instrument, which is selected from one or more of a real-time PCR instrument and a sequencer.

9. The detection system according to claim 7 or 8, characterized in that: The data processing component is configured as follows: Based on the detection results of the detection component, it is determined whether the sample contains porcine circovirus type 3 (Porcine circovirus type 3). The criteria for judging the data processing component are as follows: If the Cap gene of porcine circovirus type 3 is detected in the sample to be tested, then the sample to be tested contains or is suspected of containing porcine circovirus type 3. If the Cap gene of porcine circovirus type 3 is not detected in the sample to be tested, then the sample to be tested does not contain or is suspected of not containing porcine circovirus type 3.

Images