Acid-resistant petase mutant and application thereof

By performing site-directed mutagenesis on FAST-PETase, the problem of decreased enzyme activity under acidic conditions was solved, improving the enzyme's acid resistance and stability, achieving higher enzyme activity and a wider pH adaptation range, making it suitable for the biodegradation of PET plastics.

CN119530195BActive Publication Date: 2025-11-04JIANGNAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411735771.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-29
Publication Date
2025-11-04
Estimated Expiration
2044-11-29

AI Technical Summary

Technical Problem

The existing PET enzyme FAST-PETase exhibits decreased activity under acidic conditions, making it difficult to meet the requirements of industrial applications, especially under slightly acidic pH conditions where enzyme activity is significantly reduced or inactivated.

Method used

By performing site-directed mutagenesis on FAST-PETase, arginine at key amino acid sites 84, 117, and 227 was mutated to aspartic acid or glutamic acid, and the N-terminal amino acids 1 to 21 were truncated, resulting in a variety of acid-resistant enzyme mutants, such as R84D, R84E, R117D, R117E, K227D, and K227E.

Benefits of technology

The enzyme's acid resistance and stability were improved, resulting in high enzyme activity within the pH range of 6.5-8.5, with residual enzyme activity >60%. The enzyme activity of the single mutant R84D was 2.2 times higher than that of the wild type.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119530195B_ABST
    Figure CN119530195B_ABST
Patent Text Reader

Abstract

The application discloses an acid-resistant PET plastic degrading enzyme PETase mutant and application thereof, and belongs to the technical field of biological enzyme engineering.The amino acid sequence of a wild type FAST-PETase is shortened, single-point mutated and pairwise complexly mutated to obtain a mutant R84D, which reduces the optimum reaction pH of the FAST-PETase and improves the stability of the FAST-PETase under different pH values.The enzyme activity of the mutant constructed in the application is 2.2 times higher than that of the starting FAST-PETase.At pH 6.5-8.5, the R84D has high stability, and the enzyme activity residue is all greater than 60%.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to an acid-resistant PET plastic degrading enzyme PETase mutant and application thereof, and belongs to the technical field of biological enzyme engineering. BACKGROUND

[0002] Polyethylene terephthalate (PET) is a synthetic polymer that constitutes a wide variety of consumer plastics. Its outstanding mechanical and chemical stability hinders its degradation. Plastic pollution has been recognized as a significant threat to living organisms, eventually accumulating through the food chain, thus having a negative impact on human health.

[0003] At present, the commonly used methods for degrading PET plastics include physical method, chemical method and biological method. Physical recycling leads to the breakage of PET molecular chains, the reduction of molecular weight, and the existence of impurities that are difficult to remove, thereby significantly reducing the performance and economic feasibility of PET. Chemical processing is energy-intensive, high in cost, and can produce toxic secondary pollutants. Compared with physical and chemical methods for treating PET, the biological degradation method is environmentally friendly and low in energy consumption. Therefore, biological degradation is considered to be the most effective method for PET degradation. The biological degradation method includes microbial degradation and biological enzyme degradation. Due to the aromatic components contained in the structure of PET, it cannot directly enter the microbial cells for biological degradation. Therefore, the extracellular enzymes secreted by microorganisms are first needed to degrade the PET macromolecular polymer into water-soluble small molecules, which are then absorbed by microbial cells for further digestion, and finally hydrolyzed into CO2 and H2O. The effectiveness of PET biological degradation mainly depends on the performance of these extracellular enzymes. Therefore, the most promising choice is PET enzymatic biological degradation. In recent years, a series of in vitro PET degrading enzymes have been reported, mainly targeting the PET ester bond, which decomposes PET into smaller molecules such as TPA, EG, mono(2-hydroxyethyl) terephthalate (MHET) and bis(2-hydroxyethyl) terephthalate (BHET). Utilizing enzymatic method for biological degradation of PET under natural environmental conditions is a promising approach with certain economic benefits, which can reduce the global burden of plastic waste, thereby limiting its global impact on the environment and human health.

[0004] After several years of improvement, IsPETase and its variants show a decrease in activity in long reaction times required to reach 100% substrate conversion, thus not meeting the requirements for large-scale industrial applications. Hongyuan et al. obtained a heat-resistant high-activity IsPETase mutant, FAST-PETase, using machine learning, which maintains high activity at 50°C and pH = 8.0. Since FAST-PETase can gradually degrade PET into bis(hydroxyethyl) terephthalate (BHET), mono(2-hydroxyethyl) terephthalate (MHET) and terephthalic acid (TPA), the pH value of the reaction solution will decrease to some extent after direct injection into plastic flakes, and the enzyme activity will decrease or even be inactivated under acidic conditions. In view of this, site-directed mutagenesis is used to improve the acid resistance of FAST-PETase. SUMMARY

[0005] To solve the above problems, the present application provides an enzyme mutant for improving the acid resistance of FAST-PETase, single mutants R84D, R84E, R117D, R117E, K227D, K227E, double mutants R84D / R117D, R84D / R117E, R84D / K227D, R84D / K227E, R84E / R117D, R84E / R117E, R84E / K227D, R84E / K227E, R117D / K227D, R117D / K227E, R117E / K227D, R117E / K227E.

[0006] The present application provides an enzyme mutant of FAST-PETase with improved acid resistance, which is based on the parent and at least one mutation as follows:

[0007] (1) mutating the 84th arginine to aspartic acid or glutamic acid;

[0008] (2) mutating the 117th arginine to aspartic acid or glutamic acid;

[0009] (3) mutating the 227th lysine to aspartic acid or glutamic acid;

[0010] (4) truncating the N-terminal 1-21 amino acids.

[0011] In one embodiment, the mutant is based on SEQ ID NO. 1, in which the 84th arginine is mutated to aspartic acid and the 117th arginine is mutated to aspartic acid, and the mutant obtained is named R84D / R117D.

[0012] In an embodiment, the mutant is obtained by mutating the arginine at position 84 to aspartic acid and the arginine at position 117 to glutamic acid, based on SEQ ID NO. 1, and is designated as R84D / R117E.

[0013] In an embodiment, the mutant is obtained by mutating the arginine at position 84 to aspartic acid and the lysine at position 227 to aspartic acid, based on SEQ ID NO. 1, and is designated as R84D / K227D.

[0014] In an embodiment, the mutant is obtained by mutating the arginine at position 84 to aspartic acid and the lysine at position 227 to glutamic acid, based on SEQ ID NO. 1, and is designated as R84D / K227E.

[0015] In an embodiment, the mutant is obtained by mutating the arginine at position 84 to glutamic acid and the arginine at position 117 to aspartic acid, based on SEQ ID NO. 1, and is designated as R84E / R117D.

[0016] In an embodiment, the mutant is obtained by mutating the arginine at position 84 to aspartic acid and the arginine at position 117 to glutamic acid, based on SEQ ID NO. 1, and is designated as R84E / R117E.

[0017] In an embodiment, the mutant is obtained by mutating the arginine at position 84 to aspartic acid and the lysine at position 227 to aspartic acid, based on SEQ ID NO. 1, and is designated as R84E / K227D.

[0018] In an embodiment, the mutant is obtained by mutating the arginine at position 84 to aspartic acid and the lysine at position 227 to glutamic acid, based on SEQ ID NO. 1, and is designated as R84E / K227E.

[0019] In an embodiment, the mutant is obtained by mutating the arginine at position 117 to aspartic acid and the lysine at position 227 to aspartic acid, based on SEQ ID NO. 1, and is designated as R117D / K227D.

[0020] In an embodiment, the mutant is obtained by mutating the arginine at position 117 to aspartic acid and the lysine at position 227 to glutamic acid, based on SEQ ID NO. 1, and is designated as R117D / K227E.

[0021] In an embodiment, the mutant is a mutant in which the arginine at position 117 is mutated to glutamic acid and the lysine at position 227 is mutated to aspartic acid, based on SEQ ID NO. 1, and the mutant is named R117E / K227D.

[0022] In an embodiment, the mutant is a mutant in which the arginine at position 117 is mutated to glutamic acid and the lysine at position 227 is mutated to glutamic acid, based on SEQ ID NO. 1, and the mutant is named R117E / K227E.

[0023] The present application also provides a gene encoding the mutant.

[0024] The present application also provides a recombinant plasmid carrying the gene.

[0025] The present application also provides a recombinant microorganism expressing the mutant.

[0026] The present application also provides a recombinant Escherichia coli, using pET28a(+) as a vector and Escherichia coli BL21(DE3) as a host, to express the mutant.

[0027] The present application also provides a method for preparing the FAST-PETase mutant, which comprises culturing the recombinant Escherichia coli in a culture medium for a period of time, and inducing expression of the FAST-PETase mutant using IPTG.

[0028] In an embodiment, the method comprises culturing the recombinant Escherichia coli to an OD 600 = 0.6-0.8, adding IPTG to a final concentration of 0.4 mM, and inducing expression at 16°C for 24 h.

[0029] The present application also provides a method for improving the acid resistance of a PETase mutant, which comprises mutating one or more of the amino acids at positions 84, 117 and 227 of a PETase enzyme.

[0030] In an embodiment, the mutations include, but are not limited to, any of R84D, R84E, R117D, R117E, K227D, and K227E.

[0031] In an embodiment, the amino acid sequence of the PETase enzyme is shown in SEQ ID NO. 1.

[0032] The present application also provides the use of the mutant in catalyzing the reaction of p-nitrophenyl acetate.

[0033] In an embodiment, the use is to react the mutant in an environment containing p-nitrophenyl acetate in an acidic environment.

[0034] In an embodiment, the application is that the mutant is reacted with p-nitrophenyl acetate (p-NPA) as a substrate in an environment with pH of 6-7.

[0035] Beneficial effects:

[0036] The present application takes FAST-PETase as a starting strain, and further performs 3D structure homology modeling on FAST-PETase, selects amino acid residues in the range around the active site through analysis by a visualization software, determines three key amino acid residue sites, and performs site-directed mutagenesis on the key amino acid residue sites. The enzyme activity of the mutant R84D constructed by the present application is at least 2.2 times higher than that of the wild type, which is increased from 14 U / mL to 31 U / mL. The R84D has high stability at pH = 6.5-8.5, and the enzyme activity residue is all > 60%. BRIEF DESCRIPTION OF DRAWINGS

[0037] Figure 1 Enzyme activity of the site-directed mutant.

[0038] Figure 2 Enzyme activity of the site-directed composite mutant.

[0039] Figure 3 Comparison of the optimal reaction pH of the mutant R84D and the wild type FAST-PETase.

[0040] Figure 4 Comparison of the pH stability of the mutant R84D and the wild type FAST-PETase. DETAILED DESCRIPTION

[0041] The present application will be further described below in combination with the drawings and specific embodiments, so that those skilled in the art can better understand the present application and implement it, but the embodiments are not limiting to the present application.

[0042] Method for measuring enzyme activity:

[0043] DPBS buffer (pH 7.0) and 20 mM p-nitrophenyl acetate (p-NPA) are taken, 800 μL of DPBS buffer, 100 μL of p-NPA and 100 μL of crude enzyme solution are mixed, and reacted at 30°C for 5 min, 1000 μL of anhydrous ethanol is added to terminate the reaction. After the reaction is completed, centrifugation is performed at 12,000 rpm for 1 min, 200 μL is taken to a 96-well plate, and the absorbance value is measured at 415 nm.

[0044] The FAST-PETase enzyme activity definition unit is: under the above reaction conditions, the amount of enzyme required to generate 1 μmol of p-nitrophenol per minute by the enzyme catalyzing the substrate acetic acid p-nitrophenyl ester is one enzyme activity unit (U).

[0045] Construction of the mutant of Example 1

[0046] 1. Site-directed mutation - single point mutation

[0047] The active site of FAST-PETase enzyme (amino acid sequence as shown in SEQ ID NO. 1) is located at Ser154, Asp200, His231. Around these three active sites, There are 3 basic amino acids in the range of 84R, 117R, 227K. By using site-directed mutation, the 3 amino acids are mutated into D or E, respectively, to construct 6 mutants: R84D, R84E, R117D, R117E, K227D, K227E.

[0048] Since the first to 21st amino acids of FAST-PETase enzyme have no significant effect on the catalytic function of the enzyme, the nucleotide sequence after truncating 21 amino acids as shown in SEQ ID NO. 2 is synthesized by Tianlin Biotechnology Co., Ltd., and NcoI and XhoI restriction enzyme sites are added at both ends of the coding region. After double enzyme digestion of the target gene fragment by restriction enzymes NcoI and XhoI, the enzyme is treated in the same way, and the pET28a(+) vector is connected, and the FAST-PETase gene is screened to obtain a positive recombinant plasmid pET28a(+)-FAST-PETase, thereby constructing an in vitro heterologous expression system of FAST-PETase.

[0049] The recombinant plasmid pET28a(+)-FAST-PETase is used as a template for site-directed mutation at the above three sites. The PCR amplification conditions are set according to the instructions of Prime STAR HS DNA polymerase: pre-denaturation at 98°C for 3 min; denaturation at 98°C for 15 s; annealing at 55°C for 30 s; extension at 72°C (the extension speed of the enzyme is 1 kb·min -1 , and the specific time is set according to the length of the amplified fragment); set the cycle for 30 times; and then extend at 72°C for 10 min to complete the PCR amplification process. The PCR amplification system is shown in Table 1.

[0050] Table 1 PCR amplification system

[0051]

[0052] wherein:

[0053] 84 site mutated to aspartic acid:

[0054] Forward primer: CCATTTAATACTGCTCTGATCGGCGGTATAACCC;

[0055] Reverse primer: GGGTTATACCGCCGATCAGAGCAGTATTAAATGG;

[0056] 84 site mutated to glutamic acid:

[0057] Forward primer: CCATTTAATACTGCTCTGTTCGGCGGTATAACCC;

[0058] Reverse primer: GGGTTATACCGCCGAACAGAGCAGTATTAAATGG;

[0059] 117 site mutated to aspartic acid:

[0060] Forward primer: CATCTGCTGACTACTATCACTTTCCGGCTGA;

[0061] Reverse primer: TCAGCCGGAAAGTGATAGTAGTCAGCAGATG;

[0062] 117 site mutated to glutamic acid:

[0063] Forward primer: CATCTGCTGACTACTTTCACTTTCCGGCTGA;

[0064] Reverse primer: TCAGCCGGAAAGTGAAAGTAGTCAGCAGATG;

[0065] 227 site mutated to aspartic acid:

[0066] Forward primer: GCTGCCGCCATCAATTTCCAGAAACTGTTTG;

[0067] Reverse primer: CAAACAGTTTCTGGAAATTGATGGCGGCAGC;

[0068] 227 site mutated to glutamic acid:

[0069] Forward primer: GCTGCCGCCTTCAATTTCCAGAAACTGTTTG;

[0070] Reverse primer: AAACAGTTTCTGGAAATTGAAGGCGGCAGCC;

[0071] The plasmid obtained by the above mutation was transformed into E. coli BL21(DE3) competent cells, which were coated on LB solid medium containing 50 μg·L -1 of kanamycin and incubated at 37°C overnight. The correct transformants were selected by sequencing, and FAST-PETase mutants R84D, R84E, R117D, R117E, K227D, and K227E were obtained.

[0072] 2. Site-directed mutation - complex mutation

[0073] Complex mutations were performed on the above-mentioned sites (the method is the same as above), and 12 complex mutants R84D / R117D, R84D / R117E, R84D / K227D, R84D / K227E, R84E / R117D, R84E / R117E, R84E / K227D, R84E / K227E, R117D / K227D, R117D / K227E, R117E / K227D, and R117E / K227E were obtained.

[0074] Example 2 Expression of FAST-PETase and its mutants

[0075] The recombinant plasmid containing the coding recombinant gene was inoculated into LB liquid medium containing 50 μg·mL -1 of kanamycin, and incubated at 37°C, 200 rpm for 8 h. The culture was transferred to TB liquid medium containing 50 μg·mL -1 of kanamycin at an inoculation amount of 1%, and incubated at 37°C, 200 rpm until the OD 600 was 0.6-0.8. IPTG was added at a final concentration of 0.4 mM, and expression was induced at 16°C for 24 h.

[0076] After fermentation, the bacteria were collected by centrifugation at 7,000 rpm for 10 min, washed twice with physiological saline, and concentrated 5 times to suspend in 10 mM KH2PO4-NaOH buffer (pH = 7.0). After washing and suspending the collected bacteria, they were broken by ultrasonic wave for 30 min (amplitude rod 6, power ratio 20%, work 2 s, stop 4 s), centrifuged at 12,000 rpm for 30 min, and the supernatant (i.e. crude enzyme solution) was collected.

[0077] The mutant proteins of the above-mentioned single mutation and complex mutation were respectively placed at 30°C for 5 min, the absorbance value was measured at 415 nm by an enzyme marker, and the results are shown in Table 1. Figures 1-2 Among them, the single mutant R84D has an enzyme activity 2.2 times higher than that of the wild type (shown in SEQ ID NO. 3).

[0078] Example 3 Determination of optimum pH and pH stability of FAST-PETase and mutant R84D

[0079] The optimum pH of the enzyme was determined by measuring the enzyme activity in different pH (6.0-9.0) reaction buffer. The buffer used included K2HPO4-KH2PO4 buffer (pH=6.0-8.0), Tris-HCl buffer (pH=8.0-9.0). The pH stability of the enzyme was determined by measuring the residual enzyme activity after the enzyme was incubated in different pH (6.0-9.0) buffer for 24h at 4°C. The highest enzyme activity was taken as 100%, and the relative enzyme activity was calculated. The results are shown in Table 1. Figures 3-4 As shown in Table 1, the relative enzyme activity of R84D was increased by 10% and 18% compared with the wild type at pH=6 and pH=6.5, respectively. The stability of R84D was higher at pH=6.5-8.5, and the residual enzyme activity was >60%.

[0080] Although the present application has been disclosed with reference to the preferred embodiments, it is not intended to limit the application, and any person skilled in the art can make various modifications and improvements without departing from the spirit and scope of the application. Therefore, the scope of protection of the present application should be defined by the appended claims.

Claims

1. An acid-tolerant FAST-PETase enzyme mutant having improved properties, characterized in that, is based on the parent amino acid sequence as shown in SEQ ID NO. 1, the 84th arginine is mutated to aspartic acid, and the N-terminal 1~21 amino acids are truncated.

2. A gene encoding the mutant of claim 1.

3. A recombinant plasmid carrying the gene of claim 2.

4. A recombinant microorganism expressing the mutant of claim 1.

5. A recombinant Escherichia coli, characterized in that, The mutant of claim 1 is expressed by using pET28a (+) as a vector and E. coli BL21 (DE3) as a host.

6. A method of making the FAST-PETase mutant of claim 1, characterized in that, The recombinant E. coli of claim 5 is cultured in a medium for a period of time, and the expression of the FAST-PETase mutant is induced by IPTG.

7. A method of improving acid tolerance of a PETase enzyme, characterized in that, The 84th arginine of the PETase enzyme with the amino acid sequence as shown in SEQ ID NO. 1 is mutated to aspartic acid, and the N-terminal 1~21 amino acids are truncated.

8. Use of the mutant of claim 1 in catalyzing p-nitrophenyl acetate.

9. Use according to claim 8, characterized in that, The mutant is reacted in an environment containing p-nitrophenyl acetate under an acidic environment.

Citation Information

Patent Citations

  • Novel esterases and uses thereof

    CN116457402A

  • Method for recommending mutation site of plastic degrading enzyme, electronic equipment and medium

    CN116863996A