An shRNA, recombinant vector, recombinant bacterium for inhibiting the expression of chicken lnc-CA13 gene and their applications

Abstract

The present invention relates to the field of biology, and particularly to an shRNA, a recombinant vector, a recombinant bacterium for inhibiting the expression of chicken lnc-CA13 gene and their applications. The present invention provides an shRNA for inhibiting the expression of chicken lnc-CA13 gene, and constructs a corresponding lentiviral expression vector and recombinant bacterium of the shRNA. The nucleotide sequences of the three shRNAs provided by the present invention are shown in SEQ ID NO.5-10. These three shRNAs can effectively reduce the expression level of chicken lnc-CA13 gene, and the inhibition efficiencies at the gene level are 27.88%, 54.58% and 39.42% respectively. The shRNA for inhibiting the expression of chicken lnc-CA13 gene is constructed on a lentiviral vector, which is suitable for in vivo and in vitro studies; meanwhile, the present invention has important scientific significance and application prospects for in-depth study of the function of chicken lnc-CA13 gene, etc.

Description

Technical Field

[0001] The present invention relates to the biological field, and in particular to a shRNA for inhibiting the expression of chicken lnc-CA13 gene, a recombinant vector, a recombinant bacterium and applications thereof. Background Art

[0002] The main manifestation of chicken cross beak is the dislocation of the upper and lower beaks in a crossed state. Since 1934, at least 12 chicken breeds have been publicly reported to have cross beaks worldwide, with an incidence of 0.2%-7.4%. Chickens with deformed beaks cannot eat and drink normally, resulting in stunted growth and development, and the mortality rate is several times higher than that of normal chickens. The reproductive capacity of adult chickens is also more than 50% lower than that of normal chickens. The cross beak is formed during the brooding period and is extremely hidden. The offspring of normal individuals will also have cross beaks, which seriously restricts the industrial development of local chicken breeds. The transcript characteristics of the bilateral mandibular condyles of cross-beak chickens found that the CA13 gene was downregulated in the condyle on the short bone ramus side of chickens with beak deformities, which reduced the mineralization capacity of osteoblasts involved in carbonic anhydrase, caused bone formation disorders in the mandibular ramus on that side, and formed a cross beak. Among them, the lnc-CA13 gene, as an upstream epigenetic regulatory factor of the CA13 gene, is downregulated in the condyle on the short bone branch side of the cross-beak chicken. Therefore, the lnc-CA13 gene plays an important role in regulating the development of the chicken mandible. However, the relevant functions of the lnc-CA13 gene have not been reported yet. Further research on the pathogenesis of chicken cross-beak is needed to provide a basis for the study of the mechanism of chicken cross-beak.

[0003] RNA interference (RNAi) refers to the highly conserved phenomenon of highly efficient and specific degradation of homologous mRNA induced by double-stranded RNA (dsRNA) during evolution. Since RNAi technology can specifically reduce or shut down the expression of specific genes, it has been widely used to explore the field of gene function. As a method of RNA interference, shRNA uses RNA polymerase III (polⅢ) promoters such as U6 and H1 from human and mouse to transcribe short interfering RNA (shRNA, 19-21 nucleotide RNA double-strand) DNA molecules, including two short inverted repeat sequences separated by a stem-loop sequence, controlled by the polIII promoter, and then connected to 5-6 T bases as the transcription terminator of RNA polymerase III. The shRNA transcribed in the cell is processed and incorporated into the RNA-induced silencing complex (RISC), which guides the nuclease to degrade the target RNA. ShRNA lentivirus is widely used in gene expression research due to its lower transfection conditions (can transfect both dividing and non-dividing cells) and higher transfection efficiency.

[0004] As a powerful tool for modern genomic research, RNAi technology is of great significance for understanding the internal laws of animal growth and development, regulating the efficient expression of beneficial traits, and silencing harmful genes. The present invention intends to construct an interfering lnc-CA13 fragment into a viral vector by molecular biological means. This vector can achieve the interference of lnc-CA13 gene expression. In addition to directly transiently transfecting cells for the interference of lnc-CA13 gene, this vector can more effectively package viruses to interfere with the expression of lnc-CA13 gene at the animal level. This technology will further provide a beneficial approach for the study of the crossbill mechanism. Therefore, the application of RNAi technology will open up a revolutionary new field for poultry gene function research and disease gene therapy. With its outstanding advantages over many other technologies and prominent advantages in various fields, this technology will have more extensive development prospects in the future. Summary of the Invention

[0005] The object of the present invention is to provide an shRNA, a recombinant vector, a recombinant bacterium and their applications for inhibiting the expression of chicken lnc-CA13 gene to solve the problems existing in the above-mentioned prior art. The shRNA provided by the present invention can effectively reduce the expression level of chicken lnc-CA13 gene and has broad application prospects for the functional research of chicken lnc-CA13 gene.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides an shRNA for inhibiting the expression of chicken lnc-CA13 gene, and the shRNA includes lnc-CA13-1, lnc-CA13-2 or lnc-CA13-3;

[0008] The lnc-CA13-1 includes a sense strand (lnc-CA13-1F) with a nucleotide sequence as shown in SEQ ID NO.5 and an antisense strand (lnc-CA13-1R) with a nucleotide sequence as shown in SEQ ID NO.6;

[0009] The lnc-CA13-2 includes a sense strand (lnc-CA13-2F) with a nucleotide sequence as shown in SEQ ID NO.7 and an antisense strand (lnc-CA13-2R) with a nucleotide sequence as shown in SEQ ID NO.8;

[0010] The lnc-CA13-3 includes a sense strand (lnc-CA13-3F) with a nucleotide sequence as shown in SEQ ID NO.9 and an antisense strand (lnc-CA13-3R) with a nucleotide sequence as shown in SEQ ID NO.10.

[0011] In the present invention, the specific sequence of lnc-CA13-1F is: 5’-CcggGCATCATCTCTCCTTGCTATTCAAGAGATAGCAAGGAGAGATGATGCTTTTTTg-3’ (SEQ ID NO.5); the specific sequence of lnc-CA13-1R is: 5’-aattcaaaaaaGCATCATCTCTCCTTGCTATCTCTTGAATAGCAAGGAGAGATGATGC-3’ (SEQ IDNO.6); the specific sequence of lnc-CA13-2F is 5’-CcggGCTCGGTACATTGGTGCTTcTCAAGAGAAAGCACCAATGTACCGAGCTTTTTTg-3(SEQ ID NO.7); the specific sequence of lnc-CA13-2R is 5’-aattcaaaaaaGCTCGGTACATTGGTGCTTTCTCTTGAgAAGCACCAATGTACCGAGC-3’ (SEQ ID NO.8); the specific sequence of lnc-CA13-3F is 5’-CcggCCTTGTTATGGCACCGAATTTCAAGAGAATTCGGTGCCATAACAAGGTTTTTTg-3’ (SEQ ID NO.9); the specific sequence of lnc-CA13-3R is 5’-aattcaaaaaaCCTTGTTATGGCACCGAATTCTCTTGAAATTCGGTGCCATAACAAGG-3’ (SEQ ID NO.10).

[0012] In the present invention, the target sequence of lnc-CA13-1 is as shown in SEQ ID NO.1, specifically: GCATCATCTCTCCTTGCTA; the target sequence of lnc-CA13-2 is as shown in SEQ ID NO.2, specifically: GCTCGGTACATTGGTGCTT; the target sequence of lnc-CA13-3 is as shown in SEQ ID NO.3, specifically: CCTTGTTATGGCACCGAAT.

[0013] The present invention provides a recombinant expression vector containing the above-mentioned shRNA.

[0014] Preferably, the recombinant expression vector is a lentiviral recombinant expression vector.

[0015] The present invention provides a method for constructing the above-mentioned recombinant vector, comprising the following steps:

[0016] (1) Synthesize the coding DNA sense strand and antisense strand of shRNA that inhibits the expression of chicken lnc-CA13 gene respectively;

[0017] (2) Mix the sense strand and the antisense strand and anneal them to form double-stranded DNA;

[0018] (3) After double-digesting the vector, obtain a linearized vector;

[0019] (4) Ligate the double-stranded DNA and the linearized vector to obtain the recombinant expression vector.

[0020] Preferably, the vector is a lentiviral vector.

[0021] More preferably, the lentiviral vector is the GL427 vector, and the map of this vector is as Figure 1 shown.

[0022] The present invention provides a recombinant bacterium containing the above-mentioned shRNA.

[0023] More preferably, the basic bacterium of the recombinant bacterium is Escherichia coli.

[0024] Through experimental verification, the present invention finds that the inhibition efficiencies of the above three kinds of shRNA on the lnc-CA13 gene are 27.88%, 54.58% and 39.42% respectively. Thus, it can be seen that the shRNA, the recombinant vector and the recombinant bacterium containing this shRNA provided by the present invention can effectively inhibit the expression of the chicken lnc-CA13 gene and can be used to prepare products for inhibiting the expression of the chicken lnc-CA13 gene; at the same time, the recombinant vector and the recombinant bacterium containing the above three kinds of shRNA provided by the present invention can be used to prepare these three kinds of shRNA, providing a new way for the preparation of lnc-CA13-1, lnc-CA13-2 and lnc-CA13-3.

[0025] The present invention provides the application of the above-mentioned shRNA, the above-mentioned recombinant expression vector or the above-mentioned recombinant bacterium in inhibiting the expression of the chicken lnc-CA13 gene.

[0026] The present invention provides the application of the above-mentioned shRNA, the above-mentioned recombinant expression vector or the above-mentioned recombinant bacterium in preparing products for inhibiting the expression of the chicken lnc-CA13 gene.

[0027] The present invention provides the application of the above-mentioned shRNA, the above-mentioned recombinant expression vector or the above-mentioned recombinant bacterium in preparing shRNA for inhibiting the expression of the chicken lnc-CA13 gene.

[0028] The present invention discloses the following technical effects:

[0029] The present invention provides shRNAs that inhibit the expression of chicken lnc-CA13 gene, and constructs corresponding shRNA lentiviral expression vectors and recombinant bacteria. The three shRNAs provided by the present invention are lnc-CA13-1, lnc-CA13-2 and lnc-CA13-3 respectively, and their nucleotide sequences are shown in SEQ ID NO.5 - SEQ ID NO.10. All of these three shRNAs can effectively reduce the expression level of chicken lnc-CA13 gene, and the inhibition efficiencies at the gene level are 27.88%, 54.58% and 39.42% respectively. Constructing the shRNAs that inhibit the expression of chicken lnc-CA13 gene on the lentiviral vector is applicable to in vivo and in vitro studies; meanwhile, the present invention has important scientific significance and application prospects for in-depth research on the functions of chicken lnc-CA13 gene and so on. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0031] Figure 1 It is the vector map of GL427 in the embodiments of the present invention;

[0032] Figure 2 It is the vector map of the vector (H1 vector) expressing gene structure gag / pol and regulatory gene rel;

[0033] Figure 3 It is the vector map of the vector (H2 vector) expressing envelope protein VSVG;

[0034] Figure 4 It is the chicken DF1 cells of the lentivirus group transfected with the interfering sequence of lnc-CA13-2; among them, A is the fluorescence group; B is the white light group; the magnification is 100×;

[0035] Figure 5 It is the expression situation of lnc-CA13 gene in chicken DF1 cells induced by the lentiviral packaging vector transfected with the interfering sequence expressing. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0036] Now, various exemplary embodiments of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics and implementation schemes of the present invention.

[0037] It should be understood that the terms used in the present invention are only for describing specific embodiments and are not intended to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0038] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0039] Without departing from the scope or spirit of the present invention, various improvements and variations can be made to the specific embodiments of the present invention specification, which will be obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention will be obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0040] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0041] Example 1 Preparation of RNAi Lentivirus Clone

[0042] (1) For the known sequence information (NC_006111.5) of the chicken MSTRG.93293.25 gene in the GenBank database (http: / / www.ncbi.nlm.nih.gov / genbank), the full-length lnc-CA13 gene sequence was amplified using the RACE technique, and interference sequences were designed based on the full-length sequence. The target sequence information is shown in Table 1.

[0043] Table 1 shRNA Sequences

[0044] Name Gene Target Sequence SEQ ID NO. lnc-CA13-1 lnc-CA13 GCATCATCTCTCCTTGCTA 1 lnc-CA13-2 lnc-CA13 GCTCGGTACATTGGTGCTT 2 lnc-CA13-3 lnc-CA13 CCTTGTTATGGCACCGAAT 3 NC NC CCTAAGGTTAAGTCGCCCTCG 4

[0045] (2) Virus Vector Construction Framework

[0046] Design shRNA interference sequences according to the selected target sequences, and add appropriate restriction enzyme digestion sites at both ends to complete vector construction. Add Ccgg (AgeI digestion site) at the 5' end of the sense strand, and add aattcaaaaa (EcoRI digestion site, SEQ ID NO.13) at the 5' end of the antisense strand. G is the complementary sequence of the digestion site. In addition, add a TTTTTg termination signal at the 3' end of the sense strand, and add the complementary sequence of the termination signal at the 5' end of the antisense strand.

[0047] (3) Synthesis of single-stranded primers, and the specific sequences are shown in Table 2.

[0048] Table 2 DNA primer fragments

[0049]

[0050] Note: Italics are AgeI digestion sites, bold are EcoRI digestion sites, underlines are STEM sequences, single wavy lines are Loop sequences, and double wavy lines are termination signals.

[0051] (4) Anneal the primers to form double-stranded fragments with sticky ends

[0052] Dissolve the oligos synthesized according to the sequences in Table 2 in oligo annealing buffer to 20 μM, and take 30 μL of each complementary single strand and mix them. Then heat the oligo mixture in a water bath at 95 °C for 5 min, and then open the lid of the water bath and let it cool naturally to room temperature in the air to form double-stranded oligo fragments, obtaining annealed double-stranded oligos. Take 1 μL for subsequent ligation reactions, and store the rest at -20 °C.

[0053] (5) Preparation of linearized lentiviral expression vector

[0054] Use restriction enzymes on the lentiviral expression vector (GL427 vector, and the map of this vector is as Figure 1As shown, while this vector is disclosed in the literature "Construction of shASPP2 H22 stable transfected hepatocellular carcinoma cell line and the effect of ASPP2 knockdown on angiogenesis in H22 transplanted tumor mice", "Construction of multi-target silencing CCR5 gene vector and verification of silencing effect" and the Chinese application with the application number "202410265890.2" and the title "A lentiviral envelope protein and its uses"), digestion is carried out. The digestion reaction system is as follows: 2 μg of lentiviral expression vector, 5 μL of 10× reaction Buffer (10× cutsmart Buffer), 1 μL each of restriction endonucleases (AgeI enzyme and EcoRI enzyme), and deionized water is added to make up 50 μL, and it is incubated in a 37°C water bath for more than 2 h. The digestion products are detected by agarose gel electrophoresis to check the digestion effect, and the target vector band is cut out from the gel after agarose gel electrophoresis, and gel extraction is performed using TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver. 3.0 to obtain the linearized interfering vector.

[0055] (6) Insertion of interfering fragment into expression vector

[0056] The double-digested linearized vector and the annealed double-stranded DNA are ligated by T4 DNA ligase, and the ligation reaction is carried out overnight at 16°C to obtain the ligation product. The reaction system is shown in Table 3.

[0057] Table 3 Ligation reaction system

[0058] Reagent Positive Control (μL) Self-Ligation Control (μL) Ligation Mix (μL) Annealed Double-Stranded oligo 10 mM 1 - 1 Linearized Interference Vector 40 ng / μL 3 3 3 10×T4 DNA Ligase Buffer 2 2 2 T4 DNA Ligase 1 1 1 <![CDATA[ddH2O]]> Make up to 20 Make up to 20 Make up to 20

[0059] (7) Transformation of Escherichia coli DH5α competent cells

[0060] Add 10 μL of the ligation reaction product to 100 μL of Escherichia coli DH5α competent cells, gently flick the tube wall several times to mix evenly, place it on ice for 30 min, heat shock at 42°C for 90 s, incubate in an ice-water bath for 2 min, add 500 μL of LB medium, and place it on a shaker at 37°C for 1 h. Take an appropriate amount of the bacterial solution and spread it evenly on a plate containing antibiotics, and incubate it upside down in a constant temperature incubator for 12 - 16 h.

[0061] (8) Colony PCR identification of positive transformants

[0062] Pick the transformants grown on the plate and resuspend them in 10 μL of LB culture medium. Take 1 μL as a template and send it to Yuanbio for colony PCR identification to obtain positive clones with correct sequencing verification.

[0063] (9) Small-scale plasmid extraction

[0064] For the positive clones verified correctly by sequencing, small-scale plasmid extraction is carried out. The steps are as follows: Transfer the bacterial solution with correct sequencing to 10 mL of LB liquid medium containing ampicillin, culture overnight at 37 °C, and extract the plasmid using the Tiangen Endotoxin-Free Plasmid Mini Kit (Midiprep). The detailed steps are as follows:

[0065] 1. Collect the overnight cultured bacterial solution into a labeled 5 mL centrifuge tube, centrifuge at 12000 rpm for 2 min to collect the bacteria;

[0066] 2. Discard the supernatant, add 250 μL of cell resuspension solution, shake well to make the bacterial mass evenly suspended;

[0067] 3. Add 250 μL of cell lysis solution, then add 10 μL of proteinase K, invert 5 - 6 times up and down, mix gently; let stand for 1 - 2 min to clarify the lysis of the bacteria;

[0068] 4. Add 350 μL of neutralization solution, invert to mix evenly to completely precipitate the protein, and let stand on ice for 5 min;

[0069] 5. Centrifuge at 10000 rpm for 10 min, discard the protein, and collect the supernatant into another clean and sterile 1.5 mL EP tube;

[0070] 6. Centrifuge at 12000 rpm for 5 min. Meanwhile, prepare a labeled recovery column, transfer the supernatant to the recovery column, centrifuge at 12000 rpm for 1 min, and discard the lower waste liquid;

[0071] 7. Add 600 μL of pre-prepared wash solution, centrifuge at 12000 rpm for 1 min, discard the lower waste liquid, repeat once, and centrifuge at 12000 rpm for 2 min with no sample to further remove the residual wash solution;

[0072] 8. Transfer the recovery column to a new 1.5 mL EP tube in the laminar flow hood, let stand for 10 - 20 min to air dry naturally;

[0073] 9. Add 95 μL of Nuclease-Free Water to the recovery column, let stand for 2 min, centrifuge at 12000 rpm for 2 min, collect the sample, label it, perform electrophoresis, measure the concentration, and conduct quality inspection.

[0074] Example 2 Lentivirus Packaging

[0075] Virus packaging involves a total of three plasmids, namely the tool vector plasmid GL427 carrying the target sequence (see Example 1), the vector expressing the gene structure gag / pol and the regulatory gene rel (H1 vector, whose map is as Figure 2As shown, this vector is disclosed in the literature "Study on the Relationship between TUBB3 and the Expression Levels of CD44, CD133, PD-L1, and p53 Using a Lentiviral Expression System", the Chinese patent application with the application number "202410861933.3" and the title "Lentiviral Envelope Protein, Its Encoding Nucleic Acid Molecule, and Recombinant Lentivirus Comprising the Same", and the Chinese patent application with the application number "202410265890.2" and the title "A Lentiviral Envelope Protein and Its Use". In the literature "Study on the Relationship between TUBB3 and the Expression Levels of CD44, CD133, PD-L1, and p53 Using a Lentiviral Expression System", the full name of the H1 vector is the psPAX2 vector. In "Lentiviral Envelope Protein, Its Encoding Nucleic Acid Molecule, and Recombinant Lentivirus Comprising the Same", the full name of the H1 vector is the gag-pol Helper plasmid. In "A Lentiviral Envelope Protein and Its Use", the full name of the H1 vector is the gag-pol Helper plasmid and the envelope protein VSVG expression vector (H2 vector, whose map is as Figure 3 As shown, this vector is disclosed in the literature "Pcgf2 Promotes the Reprogramming of Chicken Embryo Fibroblasts into Induced Pluripotent Stem Cells", "Study on the Application of Different Virus Vector Systems in Transgenic Buffalo Somatic Cells", "Construction of a MARC-145 Cell Line Stably Expressing the Porcine CD163 Receptor", and the Chinese patent application with the application number "202410861933.3" and the title "Lentiviral Envelope Protein, Its Encoding Nucleic Acid Molecule, and Recombinant Lentivirus Comprising the Same". In the literature "Pcgf2 Promotes the Reprogramming of Chicken Embryo Fibroblasts into Induced Pluripotent Stem Cells", the full name of the H2 vector is the helper plasmid VSVG. In the literature "Study on the Application of Different Virus Vector Systems in Transgenic Buffalo Somatic Cells", the full name of the H2 vector is the envelope plasmid pCMV-VSVG. In the literature "Construction of a MARC-145 Cell Line Stably Expressing the Porcine CD163 Receptor", the full name of the H2 vector is the packaging helper plasmid VSVG. In "Lentiviral Envelope Protein, Its Encoding Nucleic Acid Molecule, and Recombinant Lentivirus Comprising the Same", the full name of the H2 vector is the VSVG plasmid.

[0076] 1. Preparation of Plasmids

[0077] Extract the three plasmid DNAs in the lentiviral packaging system using the plasmid extraction kit from Qiagen. Dissolve the plasmid DNA in sterilized TE, and determine its concentration and purity by ultraviolet light absorption method to ensure that the A260 / A280 of the extracted plasmid DNA is between 1.8 and 2.0.

[0078] 2. Plasmid Transfection and Lentivirus Harvest

[0079] (1) 24 h before transfection, digest 293T cells in the logarithmic growth phase with trypsin, and adjust the cell density to about 5×10 6Cells / 15 mL were re-seeded into a 10-cm diameter cell culture dish and cultured in an incubator at 37°C and 5% CO2; after 24 h of culture, when the cell density reached 70%-80%, they were used for transfection;

[0080] (2) Two hours before transfection, the medium was replaced with serum-free medium;

[0081] (3) To a sterilized centrifuge tube, the prepared DNA solutions (20 μg of GL427 vector, 15 μg of H1 vector, 10 μg of H2 vector) were added, mixed well with the corresponding volume of GeneChem transfection reagent, the total volume was adjusted to 1 mL, and incubated at room temperature for 15 min;

[0082] (4) The mixture was slowly added dropwise to the 293T cell culture medium, mixed well, and cultured in a cell incubator at 37°C and 5% CO2;

[0083] (5) After 6 h of culture, the medium containing the transfection mixture was discarded, 10 mL of PBS solution was added for washing once, the culture dish was gently shaken to wash the remaining transfection mixture and then discarded;

[0084] (6) 20 mL of cell culture medium containing 10% serum was slowly added and continued to be cultured in an incubator at 37°C and 5% CO2 for 48 - 72 h.

[0085] 3. Lentivirus concentration and purification

[0086] (1) According to the cell status, the supernatant of 293T cells 48 h after transfection (transfection can be counted as 0 h) was collected;

[0087] (2) Centrifuged at 4°C and 4000g for 10 min to remove cell debris;

[0088] (3) The supernatant was filtered through a 0.45-μm filter into a 40-mL ultracentrifuge tube;

[0089] (4) The samples were balanced respectively, and the ultracentrifuge tubes with virus supernatant were placed one by one into a Beckman ultracentrifuge, centrifuged at 25000 rpm for 2 h, and the centrifugation temperature was controlled at 4°C;

[0090] (5) After centrifugation, the supernatant was discarded, the liquid remaining on the tube wall was removed, virus preservation solution (PBS or cell culture medium can be used as a substitute) was added, and gently pipetted up and down to resuspend;

[0091] (6) After being fully dissolved, centrifuged at 10000 rpm for 5 min, and the supernatant was taken for aliquoting to obtain shRNA recombinant lentivirus;

[0092] (7) Prepare samples for detection.

[0093] 4. Lentivirus quality detection

[0094] (1) Physical index detection

[0095] 1) Color determination: By visual inspection, the lentivirus preservation solution is a pinkish clear liquid;

[0096] 2) Viscosity determination: Slowly aspirate 50 μL of the lentivirus preservation liquid with a 20 - 200 μL pipette, without obvious viscosity or liquid aspiration lag.

[0097] (2) Sterility detection

[0098] Add the virus to 293T cells for verification. After normal culture for 24 h, observe under a microscope. There is no contamination by any bacteria or fungi. At the same time, referring to the empty cell group, there are no obvious particles in the cell gaps, and the culture medium is clear and transparent.

[0099] (3) Titer detection

[0100] 1) One day before measurement, plate 293T adherent cells in a 96 - well plate, with 4×10 4 cells per well and a volume of 100 μL;

[0101] 2) According to the expected titer of the virus, prepare 7 - 10 sterile EP tubes, and add 90 μL of serum - free medium to each tube;

[0102] 3) Take 10 μL of the virus stock solution to be measured and add it to the first tube. After mixing, take 10 μL and add it to the second tube, and continue the same operation until the last tube;

[0103] 4) Select the required cell wells, discard 90 μL of the culture medium, and add 90 μL of the diluted virus solution, then culture in an incubator;

[0104] 5) After culturing for 24 h, add 100 μL of complete culture medium, and operate carefully without blowing up the cells;

[0105] 6) After culturing for 4 days, observe the fluorescence expression. The number of fluorescent cells decreases with the increase of the dilution factor.

[0106] Example 3: Lentivirus infection of chicken DF1 cells

[0107] Transfect the chicken DF1 cells, which express the lnc - CA13 gene, with the 3 kinds of shRNA recombinant lentiviruses and the lentivirus particles of the control shRNA prepared according to the method of Example 2, and detect the infection efficiency of different shRNAs using a fluorescence microscope.

[0108] (1) Experimental grouping: The experiment was divided into 5 groups, namely the group without transfection of any lentivirus (blank control group), the lentivirus group transfected with the interfering sequence of lncCA13-1, the lentivirus group transfected with the interfering sequence of lnc-CA13-2, the lentivirus group transfected with the interfering sequence of lncA-CA13-3, and the lentivirus group transfected with the control non-targeting sequence (control group). The number of cells and culture conditions in all groups were the same.

[0109] (2) Method for cell infection experiment: Chicken DF1 cells were inoculated into 12-well plates at a density of 1×10 5 cells / well, and after mixing, cultured in an incubator at 37°C and 5% CO2 for 24 h; after 24 h of culture, the medium was replaced with medium containing triple antibiotics. The lentivirus stock solution was taken, placed on ice until completely dissolved, and centrifuged briefly in a small centrifuge; 1×10 8 TU / mL of lentivirus was mixed with DMEM medium containing 10% FBS at a ratio of 3:50 (the multiplicity of infection index MOI was 60), and then GeneChem transfection enhancer Polybrene-Plus was added at a concentration of 1 μg / μL, mixed well, and added to the cell wells; cultured at 37°C and 5% CO2 for 13 h, and then replaced with DMEM medium containing 10% FBS and continued to culture for 96 h.

[0110] (3) At 24 h, 48 h, 72 h, and 96 h after cell infection, fluorescence microscopy was used for observation and photography, and at the same time bright-field microscopy was used to observe and photograph the total cells. As Figure 4 shown, the infection efficiency of the cells reached over 80% at 72 h. Thus, it can be seen that the lentiviruses containing the interfering sequences and control sequences designed and synthesized in the present invention can effectively infect chicken DF1 cells.

[0111] Example 4 Inhibitory effect of recombinant lentivirus on the expression of lnc-CA13 gene in chicken DF1

[0112] The effect of the shRNA provided by the present invention on the expression level of lnc-CA13 gene in chicken DF1 cells was detected by real-time PCR, as follows:

[0113] (1) Experimental grouping: The experiment was divided into 5 groups, namely the group without transfection of any lentivirus (blank control group, Blank), the lentivirus group transfected with the interfering sequence of lnc-CA13-1 (shlnc-CA13-1), the lentivirus group transfected with the interfering sequence of lnc-CA13-2 (shlnc-CA13-2), the lentivirus group transfected with the interfering sequence of lnc-CA13-3 (shlnc-CA13-3), and the lentivirus group transfected with NC (non-targeting sequence) (control group, NC). The number of cells and culture conditions in all groups were the same.

[0114] (2) RNA extraction and real-time PCR detection: After infection, Trizol A was added to the cells to fully lyse the cells, and the total RNA of each group of cells was extracted by the chloroform-isopropanol method. The extracted mRNA was reverse transcribed into cDNA. Taking the cDNA of each group of cells as a template and the GAPDH gene as an internal reference, the expression of the lnc-CA13 gene was detected by real-time PCR. The results are as Figure 5 shown. The results showed that the shRNA sequences provided by the present invention showed an inhibitory effect on the expression of the lnc-CA13 gene in chicken DF1 cells. Compared with the non-targeted control sequence, lnc-CA13-1, lnc-CA13-2, and lnc-CA13-3 could significantly reduce the expression of the lnc-CA13 gene, and the inhibition efficiencies at the gene level were 27.88%, 54.58%, and 39.42%, respectively. Among them, the interference effect of lnc-CA13-2 was the best.

[0115] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. An shRNA for inhibiting the expression of chicken lnc-CA13 gene, characterized in that, The shRNA is lnc-CA13-1, lnc-CA13-2 or lnc-CA13-3; The sense strand sequence of the lnc-CA13-1 is as shown in SEQ ID NO.5, and the antisense strand sequence is as shown in SEQ ID NO.6; The sense strand sequence of the lnc-CA13-2 is as shown in SEQ ID NO.7, and the antisense strand sequence is the antisense strand as shown in SEQ ID NO.8; The sense strand sequence of the lnc-CA13-3 is as shown in SEQ ID NO.9, and the antisense strand sequence is the antisense strand as shown in SEQ ID NO.

10.

2. A recombinant expression vector containing the shRNA according to claim 1.

3. The recombinant expression vector according to claim 2, wherein The recombinant expression vector is a lentiviral recombinant expression vector.

4. The method for constructing the recombinant vector according to claim 2, wherein, It includes the following steps: (1) Synthesize the coding DNA sense strand and antisense strand of the shRNA that inhibits the expression of the chicken lnc-CA13 gene respectively; (2) Mix the sense strand and the antisense strand and anneal them to form double-stranded DNA; (3) After double-digesting the vector, obtain a linearized vector; (4) Connect the double-stranded DNA and the linearized vector to obtain the recombinant expression vector.

5. The construction method according to claim 4, characterized in that, The vector is a lentiviral vector.

6. A recombinant bacterium containing the shRNA according to claim 1.

7. The recombinant bacterium according to claim 6, wherein The basic bacterium of the recombinant bacterium is Escherichia coli.

8. Use of the shRNA according to claim 1, the recombinant expression vector according to claim 2 or 3, or the recombinant bacterium according to claim 6 or 7 in inhibiting the expression of the chicken lnc-CA13 gene.

9. Use of the shRNA according to claim 1, the recombinant expression vector according to claim 2 or 3, or the recombinant bacterium according to claim 6 or 7 in the preparation of a product for inhibiting the expression of the chicken lnc-CA13 gene.

Images