A nucleic acid molecule that alters maize plant height and its application

Abstract

This invention belongs to the field of genetic engineering, specifically relating to a nucleic acid molecule that can alter maize plant height and its applications. This invention obtains a series of nucleic acid molecules capable of altering maize plant height by editing the promoter of the maize ZmGA2ox2 gene.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a nucleic acid molecule that alters the height of maize plants and its applications. Background Technology

[0002] Dwarfing traits have led to breakthroughs in crop yield, and methods for reducing crop plant height have great application potential. Among the main agronomic traits of maize, plant height and ear height affect lodging resistance, photosynthetic efficiency, and harvest index, and are closely related to maize yield. Therefore, plant height and ear height traits have important value in maize breeding practices and germplasm resource improvement.

[0003] Promoter gene editing can alter gene expression by changing promoter characteristics, thereby improving traits. For example, modifying the promoter of the rice OsSWEET gene can improve rice's resistance to bacterial blight (Oliva, R., Ji, C., Atienza-Grande, G. et al. Broad-spectrum resistance to bacterial blight in rice using genome editing[J]. Nat Biotechnol., 2019, 37, 1344-1350); editing promoters such as SlCLV3 in tomatoes can produce continuously changing phenotypes, thus allowing for fine-tuning of the phenotype (Rodríguez-Leal D, Lemmon ZH, Man J, et al. Engineering Quantitative Trait Variation for Crop Improvement by Genome Editing[J]. Cell, 2017, 171:470-480.e8.).

[0004] This invention aims to fine-tune maize plant height by editing the promoter of the maize gibberellin oxidase gene ZmGA2ox2. Summary of the Invention

[0005] To solve the above problems, the present invention adopts the following technical solution:

[0006] The present invention provides a nucleic acid molecule, characterized in that: the sequence of the nucleic acid molecule is as shown in SEQ ID NO.13 or any one of SEQ ID NO.16 to SEQ ID NO.23.

[0007] The present invention also provides an expression cassette, characterized in that it is formed by sequentially connecting the above-mentioned nucleic acid molecule, the nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.2, and the terminator of the sequence shown in SEQ ID NO.3;

[0008] In some embodiments, the nucleotide sequence of the nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.2 is shown in SEQ ID NO.4.

[0009] This invention also provides a method for changing the plant height and / or the interval between pollen shedding and silking of maize, characterized in that it includes any one of the following:

[0010] (1) Use genetic engineering techniques to target and modify the maize genome region sequence shown in SEQ ID NO.1, and select maize plants with altered plant height and / or pollen shedding and silking interval;

[0011] (2) Insert the expression cassette containing the above into the maize genome and select plants with changes in maize plant height and / or pollen shedding and silking interval.

[0012] In some implementations, the above-mentioned genetic engineering techniques employ the CRISPR / Cas9 gene editing method.

[0013] This invention also provides a kit for altering maize plant height and / or the interval between pollen shedding and silking, characterized in that it comprises any one of the following:

[0014] (1) RNA molecules capable of simultaneously recognizing the target sequences shown in SEQ ID NO.5 to SEQ ID NO.8;

[0015] (2) A DNA molecule encoding the RNA described in (1);

[0016] (3) Vectors that express the RNA described in (1).

[0017] In some implementations, the kit described above also includes the Cas9 protein or a nucleic acid molecule encoding the Cas9 protein or a vector expressing the Cas9 protein.

[0018] In some embodiments, the RNA molecule described above is a combination of the sequences shown in SEQ ID NO.9 to SEQ ID NO.12.

[0019] The present invention also provides the application of the above-described expression cassette, method, or kit in altering maize plant height and / or pollen shedding and silking interval.

[0020] The present invention also provides the application of nucleic acid molecules with the sequences shown in SEQ ID NO.13, SEQ ID NO.18, or SEQ ID NO.23 in reducing the high blood pressure in maize plants.

[0021] The present invention also provides the application of nucleic acid molecules with any one of the sequences shown in SEQ ID NO.16 or SEQ ID NO.19 to SEQ ID NO.22 in increasing the height of maize plants.

[0022] The present invention also provides the application of nucleic acid molecules with the sequences shown in SEQ ID NO.13, SEQ ID NO.17, SEQ ID NO.19, SEQ ID NO.20, or SEQ ID NO.23 in increasing the interval between corn pollen shedding and silking.

[0023] The present invention also provides the application of nucleic acid molecules with the sequences shown in SEQ ID NO.16 or SEQ ID NO.22 in shortening the interval between corn pollen shedding and silking.

[0024] The advantages and beneficial effects of this invention are as follows: This invention obtains maize materials with altered plant height and / or pollen shedding and silking intervals by editing the promoter of the ZmGA2ox2 gene. Attached Figure Description

[0025] Figure 1 Information on ZmGA2ox2 gene overexpression and knockout vector elements. A: Schematic diagram of T-DNA region elements in the overexpression vector. B: Schematic diagram of T-DNA region elements in the gene editing knockout vector. C: Target site location and sequence of the knockout vector. D: Mutation status of the edited gene.

[0026] Figure 2 Field plant height performance of maize with overexpression and knockout of the ZmGA2ox2 gene. WT: wild-type maize; KO: knockout maize; OE: overexpression maize.

[0027] Figure 3 The design and results of promoter editing. A: Structure of T-DNA region elements in the gene editing vector; B: Target site location and sequence of the target gene promoter (including PAM); C: Promoter mutation type.

[0028] Figure 4 Promoter editing of plant height and flowering status. Detailed Implementation

[0029] The following definitions and methods are provided to better define this application and to guide those skilled in the art in its practice. Unless otherwise stated, the terms are to be understood in accordance with their conventional usage by those skilled in the art. All patent literature, academic papers, industry standards, and other publicly available publications cited herein are incorporated herein by reference in their entirety.

[0030] As used herein, “maize” means any maize plant and includes all plant varieties that can be bred with maize, including the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which the plant can regenerate, plant callus, and complete plant cells in a plant or plant part, such as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stem, root, root tip, anther, etc. Unless otherwise indicated, nucleic acids are written from left to right in a 5' to 3' direction; amino acid sequences are written from left to right in the amino to carboxyl direction. Amino acids may be represented herein by their commonly known three-letter symbols or by the single-letter symbols recommended by the IUPAC-IUB Committee on Biochemistry Nomenclature. Similarly, nucleotides may be represented by commonly accepted single-letter codes. Numerical ranges include numbers that define the range. As used herein, “nucleic acid” includes deoxyribonucleotides or ribonucleotide polymers in single-stranded or double-stranded form, and, unless otherwise limited, includes known analogs (e.g., peptide nucleic acids) that have the basic properties of natural nucleotides and hybridize with single-stranded nucleic acids in a manner similar to that of naturally occurring nucleotides. As used herein, the term “encoding” or “encoded” in the context of a particular nucleic acid means that the nucleic acid contains the necessary information to guide the translation of that nucleotide sequence into a particular protein. Codons are used to represent the information encoding the protein. As used herein, “full-length sequence” referring to a particular polynucleotide or the protein it encodes means the entire nucleic acid sequence or the entire amino acid sequence having a natural (non-synthetic) endogenous sequence. Full-length polynucleotides encode the full-length, catalytically active form of that particular protein. The terms “polypeptide” and “protein” are used interchangeably herein to refer to polymers of amino acid residues. This term is used for amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids. This term is also used for naturally occurring amino acid polymers. The terms “residue” or “amino acid residue” or “amino acid” are used interchangeably in this document to refer to an amino acid incorporated into a protein, polypeptide, or peptide (collectively, “protein”). Amino acids can be naturally occurring amino acids, and unless otherwise limited, may include known analogs of naturally occurring amino acids that can function in a similar manner to naturally occurring amino acids.

[0031] As used herein, the terms "isolated" and "purified" may be used interchangeably to refer to nucleic acids or peptides or their biologically active portions, which are substantially or essentially free of components typically associated with or reacting with the nucleic acid or peptide as found in their natural environment. Thus, when isolated or purified nucleic acids or peptides are produced using recombinant techniques, they are substantially free of other cellular material or culture media, or when isolated or purified nucleic acids or peptides are chemically synthesized, they are substantially free of chemical precursors or other chemicals. "Isolated" nucleic acids typically do not contain sequences (such as protein-coding sequences) naturally flanking the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid may comprise a nucleotide sequence of less than about 0.5 kb naturally flanking the nucleic acid in the genomic DNA of the cell from which the nucleic acid is derived.

[0032] In this application, the terms "comprising," "including," or variations thereof should be understood to include other elements, numbers, or steps besides those described. "Test plant" or "test plant cell" refers to a plant or plant cell in which genetic modification has taken effect, or a progeny cell of such a modified plant or cell containing the modification. "Control," "control plant," or "control plant cell" provides a reference point for measuring phenotypic changes in the test plant or plant cell. Control plants or plant cells may include, for example: (a) wild-type plants or cells, i.e., plants or cells with the same genotype as the genetic modification starting material, the genetic modification producing the test plants or cells; (b) plants or plant cells with the same genotype as the starting material but transformed with an empty construct (i.e., a construct with no known effect on the target trait, such as a construct containing the target gene); (c) plants or plant cells that are non-transformed isomers of the test plants or plant cells; (d) plants or plant cells that are genetically identical to the test plants or plant cells but not exposed to conditions or stimuli that would induce the expression of the target gene; or (e) the test plants or plant cells themselves, which are under conditions where the target gene is not expressed.

[0033] Those skilled in the art will readily recognize that advances in molecular biology, such as site-specific and random mutagenesis, polymerase chain reaction methods, and protein engineering techniques, have provided a wide range of appropriate tools and procedures for modifying or engineering the amino acid sequences and potential gene sequences of proteins of interest in agriculture.

[0034] In some embodiments, the nucleotide sequence of this application may be modified to perform conserved amino acid substitutions. Principles and examples of conserved amino acid substitutions are further described below. In some embodiments, the nucleotide sequence of this application may be substituted without altering the amino acid sequence according to disclosed monocotyledonous codon preferences; for example, a codon encoding the same amino acid sequence may be substituted with a codon preferred by monocotyledons without changing the amino acid sequence encoded by the nucleotide sequence. In some embodiments, a portion of the nucleotide sequence in this application may be substituted with a different codon encoding the same amino acid sequence, thereby changing the nucleotide sequence without altering the encoded amino acid sequence. Conserved variants include those sequences that encode an amino acid sequence of one of the proteins of the embodiments due to genetic codon degeneracy. In some embodiments, a portion of the nucleotide sequence in this application may be substituted according to a codon preferred by monocotyledons. Those skilled in the art will recognize that amino acid additions and / or substitutions are generally based on the relative similarity of amino acid side-chain substituents, such as the hydrophobicity, charge, size, etc., of the substituents. Exemplary amino acid substituents having the various properties considered above are well known to those skilled in the art and include arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine. Guidance on appropriate amino acid substitutions that do not affect the biological activity of the target protein can be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, DC) (incorporated herein by reference). Conserved substitutions, such as replacing one amino acid with another amino acid having similar properties, can be performed. Identification of sequence identity includes hybridization techniques. For example, a known nucleotide sequence, in whole or in part, can be used as a probe for selective hybridization with other corresponding nucleotide sequences present in cloned genomic DNA fragments or cDNA fragment groups (i.e., genomic libraries or cDNA libraries) from a selected organism.

[0035] In some embodiments, a fragment of a nucleotide sequence and the amino acid sequence it encodes is also included. As used herein, the term "fragment" refers to a portion of the nucleotide sequence of a polynucleotide of an embodiment or a portion of the amino acid sequence of a polypeptide. A fragment of the nucleotide sequence may encode a protein fragment that retains the biological activity of the native or corresponding full-length protein and thus has protein activity. Mutant proteins include biologically active fragments of native proteins containing consecutive amino acid residues that retain the biological activity of the native protein. Some embodiments also include transformed plant cells or transgenic plants containing a nucleotide sequence of at least one embodiment. In some embodiments, plants are transformed using an expression vector containing a nucleotide sequence of at least one embodiment and a promoter operatively linked thereto that drives expression in plant cells. Transformed plant cells and transgenic plants represent plant cells or plants whose genome contains a heteropolynucleotide. Generally, the heteropolynucleotide is stably integrated into the genome of the transformed plant cell or transgenic plant to pass the polynucleotide to offspring. The heteropolynucleotide may be integrated into the genome alone or as part of an expression vector. In some embodiments, the plants involved in this application include plant cells, plant protoplasts, plant cell tissue cultures capable of regenerating plants, plant callus, plant masses, and plant cells that are whole plants or parts of plants, such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruits, kernels, ears, rachis, husks, straw, roots, root tips, anthers, etc. This application also includes plant cells, protoplasts, tissues, callus, embryos, flowers, stems, fruits, leaves, and roots derived from transgenic plants of this application or their progeny, and thus at least partially containing the nucleotide sequences of this application.

[0036] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Any modifications or substitutions made to the methods, steps, or conditions of the present invention without departing from the spirit and substance thereof are within the scope of this application. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al.'s Molecular Cloning Laboratory Manual (Sambrook J & Russell DW, Molecular cloning: alaboratory manual, 2001), or according to the conditions recommended in the manufacturer's instructions. Unless otherwise specified, the chemical reagents used in the examples are all commercially available conventional reagents, and the technical means used in the examples are conventional means well known to those skilled in the art.

[0037] Example

[0038] Example 1: Effects of overexpression and knockout of the ZmGA2ox2 gene on maize phenotype

[0039] To determine whether the ZmGA2ox2 gene (gene number Zm00001d002999) is related to maize plant height, the inventors first used conventional overexpression and gene editing knockout techniques to overexpress and knock out the ZmGA2ox2 gene in the maize inbred line KN5585. Overexpression used the ubi promoter to drive the CDS sequence. Gene knockout used three sgRNAs simultaneously (see schematic diagram of the T-DNA vector for overexpression and gene editing). Figure 1 After obtaining overexpressed and edited maize materials, plant height and ear height traits were investigated. Results showed that the overexpressed maize materials resulted in extremely dwarfed maize with poor seed setting, a 52.53% reduction in plant height, and a 57.43% reduction in ear height. Gene-edited maize showed significantly increased plant height and ear height, with plant height increasing by 4.71% and ear height by 7.97%. Figure 2 ).

[0040] The above results indicate that the ZmGA2ox2 gene plays a role in regulating maize plant height, but direct overexpression and knockout cannot obtain maize materials with industrial application value.

[0041] Example 2: Editing the ZmGA2ox2 promoter to fine-tune maize plant height trait

[0042] The ZmGA2ox2 gene is associated with maize plant height. The inventors intend to edit the ZmGA2ox2 promoter to achieve fine-tuning of maize plant height. The ZmGA2ox2 promoter sequence is shown in SEQ ID NO.1, the genomic sequence of the gene region is shown in SEQ ID NO.4, the amino acid encoding sequence is shown in SEQ ID NO.2, and the terminator sequence is shown in SEQ ID NO.3.

[0043] Four gene editing targets were designed against the promoter sequence: AGACAGTTTATGCGCTTTGTG (SEQ ID NO. 5), CCTAGCGGCCTGACGCACAA (SEQ ID NO. 6), CAGGGGTTCGTGCATAGGCG (SEQ ID NO. 7), and TCCTACATAAAACTGTAGAA (SEQ ID NO. 8). Gene editing vectors were constructed and transformed into the maize inbred line KN5585 to obtain maize material with the ZmGA2ox2 promoter editable. Sequencing revealed a total of 11 promoter editing types (…). Figure 3 The edited promoters are shown in SEQ ID NO.13 to SEQ ID NO.23.

[0044] Two years of field surveys of plant height revealed that, compared with the wild-type control, mutants 14#, 21#, and 50# showed significantly lower plant heights, mutants 19#, 24#, 27#, 38#, and 49# showed significantly higher plant heights, while mutants 16#, 18#, and 20# showed no significant difference in plant height. Furthermore, compared with the wild-type control, mutants 14#, 20#, 24#, 27#, and 50# showed significantly increased ASI values, while mutants 19# and 49# showed significantly decreased ASI values.

[0045] Table 1. Plant height data of mutant maize materials (unit: cm)

[0046]

[0047]

[0048] Table 2. ASI status of mutant maize materials (unit: days)

[0049]

[0050] It is evident that mutations in the GA2ox2 gene promoter can regulate maize plant height and the interval between pollen shedding and silking.

[0051] By editing the promoter of this gene, mutants with different editing types can be obtained, enabling the regulation of maize plant height with a variation range of -20% to 20%. In addition, mutations in the GA2ox2 gene promoter can regulate the interval between pollen shedding and silking in maize.

[0052] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A nucleic acid molecule, characterized by: The nucleic acid molecule sequence is shown as any one of SEQ ID NO.13 or SEQ ID NO.16 to SEQ ID NO.

23.

2. An expression box, characterized in that: It is formed by sequentially linking the nucleic acid molecule as described in claim 1, the nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO. 2, and the terminator of the sequence shown in SEQ ID NO.

3.

3. The expression box according to claim 2, characterized in that, The nucleotide sequence of the nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.2 is shown in SEQ ID NO.

4.

4. A method for altering maize plant height and / or the interval between pollen shedding and silking, characterized in that: Insert the expression cassette containing any one of claims 2-3 into the maize genome, and select maize plants with altered plant height and / or pollen shedding and silking intervals.

5. The expression box according to any one of claims 2-3, or the method according to claim 4, in the application of altering maize plant height and / or pollen shedding and silking interval.

6. Application of nucleic acid molecules with sequences shown in SEQ ID NO.13, SEQ ID NO.18, or SEQ ID NO.23 in reducing the high concentration of maize in maize plants.

7. Application of nucleic acid molecules with any of the sequences shown in SEQ ID NO.16 or SEQ ID NO.19 to SEQ ID NO.22 in increasing the high concentration of maize plants.

8. Application of nucleic acid molecules with sequences shown in SEQ ID NO.13, SEQ ID NO.17, SEQ ID NO.19, SEQ ID NO.20, or SEQ ID NO.23 in increasing the interval between corn pollen shedding and silking.

9. Application of nucleic acid molecules with sequences shown in SEQ ID NO.16 or SEQ ID NO.22 in shortening the interval between corn pollen shedding and silking.

Images