A lentivirus for treating cancer, its preparation method and application

Abstract

The present application provides a lentivirus for treating cancer, its preparation method, application and corresponding pharmaceutical composition. In the present application, an hTERT promoter and a CDC6shRNA gene sequence are inserted after the restriction enzyme site of the vector, and the obtained plasmid is transferred into an expression strain, and a cloned strain is obtained through culture and screening. After shaking the bacteria, an hTERT-CDC6shRNA lentivirus is packaged; the lentivirus described in the present invention is used to infect cancer cells, and the experimental results show that it can very effectively inhibit the proliferation of cancer cells.

Description

Technical Field

[0001] The present application relates to the field of tumor gene therapy. Specifically, the present application provides a lentivirus for treating cancer, a preparation method thereof, and an application thereof. Background Art

[0002] Cancer claims millions of lives every year and is one of the greatest health challenges to humanity. There is currently no effective means of prevention and treatment. The three earliest weapons used by humans: surgery, radiotherapy, and chemotherapy, and current molecular targeted therapy and immunotherapy have low cure rates, high costs, and the pain suffered by patients and the huge side effects on their bodies are beyond the comprehension of ordinary people. In today's rapidly developing technology, cancer remains a worldwide problem.

[0003] On the road to conquering cancer, scientists have been working tirelessly. The 2001 Nobel Prize in Physiology or Medicine honored American scientist Leland H. Hartwell and British scientists Timothy H. Hunt and Paul M. Nurse for their outstanding contributions in discovering key regulators of the cell cycle. As early as 1983, Timothy Hunt used sea urchin eggs as experimental materials and found that the contents of two proteins changed with the cell cycle during its cleavage, pioneering this theoretical research; the 2006 Nobel Prize in Physiology or Medicine honored American scientists for their outstanding contributions in discovering the RNA (ribonucleic acid) interference mechanism, stemming from a research result published by Americans Andrew Fire and Craig Mello in the journal Nature in 1998. These major discoveries have opened up a very broad field for human research on life. Research shows that certain small RNA molecules can determine the fate of a cell by guiding genes to open or close, which will have a profound impact on inducing cells to form a certain specific type of tissue. Recent research has found that using this method can cause the corresponding protein not to be synthesized, thereby "turning off" specific genes and controlling cell proliferation. Cyclin is essential in the human DNA replication initiator, and it is a protein necessary for DNA replication and cell proliferation. The research on the replication mechanism of human DNA in tumors has been widely emphasized. It has been found that the CDC6 protein is highly expressed in a variety of tumor cells, and the degree of its expression is related to the tumor burden; moreover, by inhibiting its expression, the proliferation of tumor cells can be selectively blocked, and when the expression decreases, cell proliferation will be blocked and apoptosis will be promoted.

[0004] The lentivirus vector is a gene therapy vector developed based on HIV-1 (human immunodeficiency virus type I). Lentiviruses can infect not only cells in the active mitotic phase but also cells with slow division and at the end stage of division, including hematopoietic stem cells, neural stem cells, neurons at the end stage of differentiation, hepatocytes, etc. In in vitro cell culture experiments and in vivo transplantation experiments, the target genes introduced by the lentivirus vector can be expressed stably for a long time. In addition, the lentivirus vector does not express any HIV-I proteins and has low immunogenicity. After modification, the lentivirus vector can accommodate exogenous genes of about 10 kb, so most cDNAs can be cloned into the lentivirus vector. These advantages make the lentivirus vector an effective tool for gene transfer in vivo and in vitro. Summary of the Invention

[0005] This patent constructs the artificially synthesized hTERT-CDC6shRNA (1521 bp in base number) gene sequence onto the lentivirus vector. hTERT telomerase is an RNA-dependent DNA polymerase, and its core structure contains the necessary RNA structure, which consists of the reverse transcriptase-active human telomerase catalytic subunit (hTERT) and related proteins. The hTERT promoter region lacks the TATA box and CAAT box, and its structure is a GC-rich CpG island. The core promoter region is 181 bp upstream of the transcription start site, with multiple transcription factor binding sites. The expression of the hTERT gene is in a closed state in mature and differentiated human tissue cells and is activated at the transcriptional level in tumor cells. Therefore, the promoter of the hTERT gene can specifically direct the expression of tumor genes only in tumor cells. Cancer cells contain a large amount of CDC6 protein that is not present in normal cells, and the more the cell division of cancer cells, the higher the content of CDC6 protein. The principle of using the "CDC6shRNA active gene" is based on this characteristic of "unlimited proliferation of cancer". It can eliminate a DNA replication factor called CDC6 that exists in common cancer cells, knockdown the CDC6 protein, effectively cause cancer cells to self-destruct, and through the efficient penetration of cancer cells by the lentivirus vector, restore the normal regulatory function of the proto-oncogene and the mutated, deleted, or inactivated tumor suppressor gene, and transform cancer cells back into normal cells, thus achieving the purpose of inhibiting tumors. Through the results of in vitro experiments, we found that this gene sequence has an obvious anti-tumor effect.

[0006] On the one hand, the present application provides a lentivirus for treating cancer, and the lentivirus for treating cancer carries the hTERT promoter and the CDC6shRNA gene.

[0007] Furthermore, the hTERT promoter sequence is SEQ ID NO.2.

[0008] Furthermore, the CDC6 shRNA gene sequence is SEQ ID NO.3.

[0009] Furthermore, the lentivirus carries the hTERT promoter-CDC6 shRNA combined gene.

[0010] Furthermore, the hTERT promoter-CDC6 shRNA combined gene sequence is SEQ ID NO.1.

[0011] On the other hand, the present application provides the use of the above-mentioned lentivirus for treating cancer in the preparation of a drug for treating cancer.

[0012] Furthermore, the cancer is lung cancer, liver cancer, papillary thyroid cancer, ovarian cancer, renal clear cell adenocarcinoma, pancreatic cancer, human endometrial adenocarcinoma.

[0013] Furthermore, the cancer is lung cancer, liver cancer, papillary thyroid cancer.

[0014] Furthermore, the cancer is lung cancer.

[0015] On the other hand, the present application provides a pharmaceutical composition, which comprises the above-mentioned lentivirus for treating cancer.

[0016] Furthermore, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient.

[0017] Furthermore, the pharmaceutical composition is in the form of an injection.

[0018] On the other hand, the present application provides a method for preparing the above-mentioned lentivirus for treating cancer:

[0019] (1) Insert the hTERT promoter and the CDC6 shRNA gene sequence after the restriction enzyme site of the vector to obtain a plasmid;

[0020] (2) Transfer the plasmid into an expression strain, and culture and screen the successfully transferred strain;

[0021] (3) Shake the successfully transferred strain obtained in step (2) to obtain the hTERT-CDC6 shRNA expression plasmid;

[0022] (4) Package the expression plasmid described in step (3) to obtain the hTERT-CDC6 shRNA lentivirus.

[0023] Those skilled in the art can select suitable excipients for the pharmaceutical compositions involved in this application according to the general knowledge in the pharmaceutical field. The types of available excipients include, but are not limited to, solvents, cosolvents, stabilizers, dispersants, viscosity regulators, antioxidants, pH regulators, sustained-release agents, fillers, sweeteners, binders, gas generators, coating agents, etc. Excipients suitable for injections are particularly preferred. Description of the Drawings

[0024] Figure 1 It is the electrophoresis diagram of plasmid hTERT-CDC6shRNA (lane 2);

[0025] Figure 2 It is the comparison of cell growth conditions from 24 to 72 h in Example 3;

[0026] Figure 3 It is the cell counting result in Example 3;

[0027] Figure 4 It is the data analysis result in Example 3;

[0028] Figure 5 It is the comparison of cell growth conditions from 24 to 72 h in Example 4;

[0029] Figure 6 It is the cell counting result in Example 4;

[0030] Figure 7 It is the data analysis result in Example 4;

[0031] Figure 8 It is the comparison of cell growth conditions from 24 to 72 h in Example 5;

[0032] Figure 9 It is the cell counting result in Example 5;

[0033] Figure 10 It is the data analysis result in Example 5;

[0034] Figure 11 It is the comparison of cell growth conditions from 48 to 96 h in Example 6;

[0035] Figure 12 It is the cell counting result in Example 6;

[0036] Figure 13 It is the data analysis result in Example 6;

[0037] Figure 14 It is the comparison of cell growth conditions from 24 to 72 h in Example 7;

[0038] Figure 15 It is the cell counting result in Example 7;

[0039] Figure 16 For the data analysis results in Example 7;

[0040] Figure 17 For the comparison of cell growth conditions at 24 - 72 h in Example 8;

[0041] Figure 18 For the cell counting results in Example 8;

[0042] Figure 19 For the data analysis results in Example 8.

[0043] Figure 20 For the comparison of cell growth conditions at 24 - 72 h in Example 9;

[0044] Figure 21 For the cell counting results in Example 9;

[0045] Figure 22 For the data analysis results in Example 9. Detailed implementation manners

[0046] Example 1 Construction of hTERT - CDC6shRNA overexpression clone

[0047] Retrieve the relevant gene sequences from Genbank, design the CDC6shRNA sequence, and use seamless cloning method to construct the hTERT - CDC6shRNA overexpression clone.

[0048] The steps are as follows:

[0049] Digest the vector Plenty6.3 / V5 - TOPO (abbreviation D) (purchased from Thermo Fisher Scientific) with restriction enzymes, the restriction enzyme sites are ClaI and MluI, upstream primer:

[0050] aattcaaaattttatcgataagacaattcacaaacacagccc (SEQ ID NO.4) downstream primer: actaaccggtacgcgttcagtctgagtcaggcccttc (SEQ ID NO.5), insert the hTERT promoter and CDC6shRNA gene sequences to obtain the hTERT - CDC6shRNA plasmid.

[0051] Steps:

[0052] 1. Vector digestion

[0053] Prepare the digestion system:

[0054]

[0055] (Note: Restriction digestion reaction conditions: 37°C / 3h)

[0056] 2. Seamless cloning ligation

[0057]

[0058] (Note: Seamless cloning ligation reaction conditions: 37°C / 30min)

[0059] 3. Transformation of ligation products and plating

[0060] Thaw 50 μl of TOP10 competent cells on ice. Take 5 μl of the ligation product and mix it with the competent cells; incubate on ice for 30 min, heat shock in a 42°C water bath for 90 sec, and then incubate on ice for 2 min; transfer the transformation product to an EP tube containing 500 μl of antibiotic-free LB liquid medium, place it on a shaker, and culture at 37°C and 180 rpm for 30 min; centrifuge the EP tube containing the transformed bacteria at 4000 rpm for 2 min; pour off the supernatant in a laminar flow hood, leaving about 100 μl of the medium to resuspend the pellet, and evenly spread it on an LB antibiotic-containing culture plate; invert the plate and incubate it in a 37°C bacterial incubator overnight (12 - 16 h). Pick single colonies from the above plate into 6 ml of LB liquid medium and culture at 37°C and 250 rpm overnight (12 - 16 h); extract the plasmid and perform sequencing identification, and compare the sequencing results with the target gene sequence for identification. The identified plasmid is correct.

[0061] Obtain the plasmid hTERT-CDC6shRNA.

[0062] The gene sequences involved:

[0063] hTERT-CDC6shRNA gene sequence, SEQ ID NO.1

[0064] agacaattcacaaacacagccctttaaaaaggcttagggatcactaaggggatttctagaagagcgacc

[0065] tgtaatcctaagtatttacaagacgaggctaacctccagcgagcgtgacagcccagggagggtgcgagg

[0066] cctgttcaaatgctagctccataaataaagcaatttcctccggcagtttctgaaagtaggaaaggttac

[0067] atttaaggttgcgtttgttagcatttcagtgtttgccgacctcagctacagcatccctgcaaggcctcg

[0068] ggagacccagaagtttctcgccccttagatccaaacttgagcaacccggagtctggattcctgggaagt

[0069] cctcagctgtcctgcggttgtgccggggccccaggtctggaggggaccagtggccgtgtggcttctact

[0070] gctgggctggaagtcgggcctcctagctctgcagtccgaggcttggagccaggtgcctggaccccgagg

[0071] ttgccctccaccctgtgcgggcgggatgtgaccagatgttggcctcatctgccagacagagtgccgggg

[0072] cccagggtcaaggccgttgtggctggtgtgaggcgcccggtgcgcggccagcaggagcgcctggctcca

[0073] tttcccaccctttctcgacgggaccgccccggtgggtgattaacagatttggggtggtttgctcatggt

[0074] ggggacccctcgccgcctgagaacctgcaaagagaaatgacgggcctgtgtcaaggagcccaagtcgcg

[0075] gggaagtgttgcagggaggcactccgggaggtcccgcgtgcccgtccagggagcaatgcgtcctcgggt

[0076] tcgtccccagccgcgtctacgcgcctccgtcctccccttcacgtccggcattcgtggtgcccggagccc

[0077] gacgccccgcgtccggacctggaggcagccctgggtctccggatcaggccagcggccaaagggtcgccg

[0078] cacgcacctgttcccagggcctccacatcatggcccctccctcgggttaccccacagcctaggccgatt

[0079] cgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggg

[0080] gaagcgcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagt

[0081] ggattcgcgggcacagacgcccaggaccgcgcttcccacgtggcggagggactggggacccgggcaccc

[0082] gtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccggg

[0083] tccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctc

[0084] gcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccg

[0085] cgatgaattccccagctgattggtattgctaatacttcaagagagtattagcaataccaatcagctttt

[0086] ttg

[0087] hTERT promoter sequence, SEQ ID NO.2

[0088] agacaattcacaaacacagccctttaaaaaggcttagggatcactaaggggatttctagaagagcgacc

[0089] tgtaatcctaagtatttacaagacgaggctaacctccagcgagcgtgacagcccagggagggtgcgagg

[0090] cctgttcaaatgctagctccataaataaagcaatttcctccggcagtttctgaaagtaggaaaggttac

[0091] atttaaggttgcgtttgttagcatttcagtgtttgccgacctcagctacagcatccctgcaaggcctcg

[0092] ggagacccagaagtttctcgccccttagatccaaacttgagcaacccggagtctggattcctgggaagt

[0093] cctcagctgtcctgcggttgtgccggggccccaggtctggaggggaccagtggccgtgtggcttctact

[0094] gctgggctggaagtcgggcctcctagctctgcagtccgaggcttggagccaggtgcctggaccccgagg

[0095] ttgccctccaccctgtgcgggcgggatgtgaccagatgttggcctcatctgccagacagagtgccgggg

[0096] cccagggtcaaggccgttgtggctggtgtgaggcgcccggtgcgcggccagcaggagcgcctggctcca

[0097] tttcccaccctttctcgacgggaccgccccggtgggtgattaacagatttggggtggtttgctcatggt

[0098] ggggacccctcgccgcctgagaacctgcaaagagaaatgacgggcctgtgtcaaggagcccaagtcgcg

[0099] gggaagtgttgcagggaggcactccgggaggtcccgcgtgcccgtccagggagcaatgcgtcctcgggt

[0100] tcgtccccagccgcgtctacgcgcctccgtcctccccttcacgtccggcattcgtggtgcccggagccc

[0101] gacgccccgcgtccggacctggaggcagccctgggtctccggatcaggccagcggccaaagggtcgccg

[0102] cacgcacctgttcccagggcctccacatcatggcccctccctcgggttaccccacagcctaggccgatt

[0103] cgacctctctccgctggggccctcgctggcgtccctgcaccctgggagcgcgagcggcgcgcgggcggg

[0104] gaagcgcggcccagacccccgggtccgcccggagcagctgcgctgtcggggccaggccgggctcccagt

[0105] ggattcgcgggcacagacgcccaggaccgcgcttcccacgtggcggagggactggggacccgggcaccc

[0106] gtcctgccccttcaccttccagctccgcctcctccgcgcggaccccgccccgtcccgacccctcccggg

[0107] tccccggcccagccccctccgggccctcccagcccctccccttcctttccgcggccccgccctctcctc

[0108] gcggcgcgagtttcaggcagcgctgcgtcctgctgcgcacgtgggaagccctggccccggccacccccg

[0109] cgat

[0110] CDC6 shRNA gene sequence, SEQ ID NO.3

[0111] cccagctgattggtattgctaatacttcaagagagtattagcaataccaatcagc

[0112] Preparation and production process of lentivirus in Example 2

[0113] Transform the hTERT-CDC6 shRNA plasmid in Example 1 into Stbl3 competent cells, and screen for resistant monoclonal strains. The specific operations are as follows:

[0114] Take out the competent cells Stbl3 (purchased from Thermo Fisher Scientific) and the hTERT-CDC6 shRNA plasmid from the -80°C refrigerator and thaw them on ice. Add 1 μg of the plasmid to the competent cells, mix gently, and place it on ice for 25 min. Quickly place the competent cells with the added plasmid into a preheated 42°C water bath for heat shock for 45 sec, and then place it on ice for 2 min again. Add 250 μl of LB liquid medium to the competent cells with the added plasmid, and incubate at 220 rpm / min and 37°C for 1 h. Let the LB solid medium dry completely, pipette 50 μl of the revived transformed bacterial liquid, add it to the prepared LB solid medium, spread it evenly with a spreader, and seal the culture dish with a sealing film. Invert the sealed LB solid medium and place it in a 37°C incubator for 12 - 16 h to obtain resistant monoclonal strains.

[0115] Shake the above-mentioned monoclonal strains to obtain the hTERT-CDC6 shRNA plasmid.

[0116] Select typical single colonies in the laminar flow hood, place them in a 15 ml sterile centrifuge tube (containing 5 ml of LB liquid medium), incubate at 37°C and 220 rpm / min for 12 - 16 h until the OD600 is 0.6 - 0.9. The next day, inoculate it into LB medium at a volume ratio of 1:100, incubate at 37°C and 220 rpm / min for 16 h, and extract the plasmid.

[0117] Package the plasmid extracted in the previous step with the mixed packaging plasmids pLP1, pLP / VSVG, and pLP2 to obtain the hTERT-CDC6 shRNA lentivirus. The specific packaging operations are as follows:

[0118] The packaging cells are 293F cells, and the cell transfection density is 4.0 - 4.5×10 6 / ml.

[0119] Cell transfection procedure: A: Dilute the plasmid with 5% opti-MEM, with a total plasmid amount of 2.5 μg / ml. The ratio of packaging plasmids pLP1, pLP / VSVG, pLP2 to the lentiviral plasmid is 1:1:1:2. B: Dilute the plasmid with 5% opti-MEM. The dosage of the transfection reagent (purchased from Thermo Fisher Scientific, catalog number: A35348) is 6 μl / ml, and it is placed at room temperature for 1 min. The diluted plasmid is added to the diluted transfection reagent, and after standing at room temperature for 15 min, it is added to 293F cells and mixed well. After 4 h, 5% supplement and 4% enhancer are added, and the supernatant is collected after 56 h. After purification by a purification column, concentration and buffer exchange are carried out. First, it is concentrated 5-fold, and then buffer exchange is carried out with 3 volumes of washing and filtering (the buffer is: 1% glycerol, 20 mg / ml sucrose, 1 mg / ml L-arginine, 2 mg / ml glycine, 2% PEG400 added to 0.02 M phosphate buffer pH 7.2), and then the lentivirus is obtained. After aliquoting, it is stored at -80 °C.

[0120] The active titer of the lentivirus detected by QPCR is 5.39×10 7 TU / ml.

[0121] The steps for detecting the activity of the lentivirus are as follows:

[0122] The activity of the lentivirus is detected using 293T cells. The specific operation is as follows:

[0123] 1×10 5 / well of 293T cells are seeded into a 6-well plate. After plating for 24 h, the cell density is B (about 2x10 5 / ml), and 2 ml of medium is added to each well. The next day, the medium is discarded and replaced with 1 ml / well of fresh DMEM medium. 50 μl of lentivirus control (Shanghai Genechem Co., Ltd.) and 50 μl of the virus are gently dropped into the wells, and a blank control is also set up. After 24 h of infection, the medium is replaced with 2 ml of fresh medium and cultured for another 48 h. The cell genome is extracted to detect the activity.

[0124] After culturing, the cells are digested and the genome is extracted. The steps are as follows:

[0125] The medium is aspirated, 1 ml of 1×PBS is added to each well to gently wash the cells and then discarded. The cells are digested with 0.5 ml of trypsin, and then 1 ml of DMEM medium is added to resuspend and collect the cells into a 1.5 ml centrifuge tube. The genomic DNA is extracted using a genomic DNA extraction kit (Tiangen Biochemical Technology (Beijing)), and the genomic DNA is eluted with 100 μl of Elution buffer; the concentration and purity of dsDNA are detected using a microplate reader.

[0126] Perform the QPCR experiment step by step to detect the lentivirus activity. The specific operation steps are as follows:

[0127] Take 293T cells and dilute the reference gene DNA standard product by 10×, with the dilution concentration being 1.0×10 8 copy - 1.0×10 4 copy. Dilute the target plasmid standard product, with the dilution concentration being 1.0×10 8 copy - 1.0×10 4 copy, and establish a standard curve.

[0128] Add the prepared PCR reaction system to the PCR reaction wells on the well plate at 19 μl per well. The 293T cell reference gene DNA and the target gene primers are arranged staggeredly. Place the 293T cell reference gene DNA in rows A and B, and the target gene primers in rows C and D. Add 1 μl of DNA template to each reaction well, and at the same time set a negative control using enzyme-free water instead of the template;

[0129] The PCR reaction system is as follows, and each sample is done in duplicate:

[0130] Reagent Volume 2×qPCR mix 10 μl Forward Primer(10 μM) 0.4 μl Reverse Primer(10 μM) 0.4 μl Probe(10 μM) 0.2 μl DNA Template 1 μl Enzyme-Free Water 8 μl Total 20 μl

[0131] PCR amplification program

[0132]

[0133] Result analysis

[0134] Substitute the Ct values of the obtained target gene and reference gene into the standard curve respectively to obtain their respective copy numbers Q1 and Q2, and calculate the ratio Q1 / Q2 of the target gene to the reference copy number. Then calculate the titer (transduction units per ml, TU / ml) according to the following formula

[0135]

[0136] The primer probe sequences of the 293T cell reference gene DNA are as follows:

[0137] Forward primer TGC AGA TTT GGA CCT GCG AG(SEQ ID NO.6)

[0138] Reverse primer GAA TAG CCA AGG TGA GCG GC(SEQ ID NO.7)

[0139] Probe ACC TGA AGG CTC TGC GCG GAC TTG T(SEQ ID NO.8)

[0140] The primer and probe sequences of the target gene are as follows:

[0141] Forward primer GCT CCT TTC CGG GAC TTT CG(SEQ ID NO.9)

[0142] Reverse primer ATT GTC AGT GCC CAA CAG CC(SEQ ID NO.10)

[0143] Probe TCC CTA TTG CCA CGG CGG AAC TCA TCG(SEQ ID NO.11)

[0144] Experiment of lentivirus infecting human lung cancer cells (ChaGO-K-1) in Example 3

[0145] Human lung cancer cells (ChaGO-K-1) are derived from the Cell Resource Center of the Shanghai Institute of Life Sciences, Chinese Academy of Sciences. RPMI-1640 (purchased from Thermo Fisher Scientific) + 10% FBS (purchased from Gibco) medium is used. The culture flask is placed in a carbon dioxide incubator for culture, and the culture conditions are: 37°C, 5% CO2. After culturing the cells for 24 hours, the cell confluence rate is observed under a microscope to be 80%-90%, and then passage is carried out. After passage 3 times, cell counting is performed and plating is done.

[0146] Cell seeding and plating:

[0147] Cell culture plates (6-well plates), the culture volume is 2.5 ml / well, and the cell seeding amount is 1.00×10 5 cells / well. ChaGo-K-1 cells are digested with trypsin and resuspended in 10 ml of RPMI-1640 complete medium. The cell count is 1.81×10 6 / ml, diluted 18.1 times, inoculated into 4 wells, 1 ml of ChaGo-K-1 cell suspension + 17.1 ml of RPMI-1640 complete medium, of which 2 wells are used for experiments and the remaining 2 wells are reserved. Add 1 ml of diluted cell suspension + 1.5 ml of fresh medium to each well, mix gently, and the culture conditions are: 37°C, 5% CO2.

[0148] Virus infection and cell observation:

[0149] The 6-well plates were labeled as ChaGo-K-1 blank and ChaGo-K-1 virus respectively. After adding the virus (5.39×10 7 TU) to infect ChaGo-K-1 cells, the cell status was observed under a microscope every day at 24 h, 48 h, and 72 h after infection, and the medium was changed and pictures were taken. The volume of the medium changed was 2.5 ml. After changing the medium for ChaGo-K-1 virus, the virus (5.39×10 7 TU) was added. The experiment was stopped after 72 h. After the cells were digested with trypsin, 1 ml of RPMI-1640 complete medium was added to resuspend the cells, and then the cells were counted using a cell counter (Thermo).

[0150] The cell conditions from 24 h to 72 h were compared as Figure 2 shown. It can be seen that after virus infection, the cell morphology changed, the cells did not spread after adhering to the wall, and the cell growth was significantly inhibited.

[0151] , 4 For the cell counting at 72 h after infection, the density of viable cells in the blank reached 4.28×10 5 / well, while the density of viable cells after virus infection only reached 1.06×10 5 / well. The density of viable cells in the blank increased from 1.00×10 5 / ml to 4.28×10 5 / ml. The density of viable cells after virus infection increased from 1.00×10 5 / ml to 1.06×10 5 / ml. According to the tumor inhibition rate calculation formula T / C = (1 - T / C)×100, where T represents the virus group and C represents the blank group; by calculating the tumor inhibition ratio of the virus group relative to the blank group, the tumor inhibition rate was calculated to be 75.23%.

[0152] Cell counting statistical results:

[0153]

[0154] In summary, based on the cell growth conditions during the experiment, after 72 h of virus infection, the growth rate of ChaGo-K-1 cells infected with the virus was significantly lower than that of ChaGo-K-1 blank cells, and the tumor inhibition rate reached 75.23%, showing an effective role in inhibiting the growth of tumor cells.

[0155] Example 4 Experiment on Lentivirus Infection of Human Hepatoma Cells (Li-7)

[0156] Human liver cancer cells (Li-7), sourced from the Cell Resource Center of the Shanghai Institute of Life Sciences, Chinese Academy of Sciences. Use RPMI-1640 (purchased from Thermo Fisher Scientific) + 10% FBS (purchased from Gibco) medium. Place the culture flask in a carbon dioxide incubator for culturing, with the culture conditions: 37°C, 5% CO2. After culturing the cells for 24 h, observe the cell confluence rate under a microscope at 80%-90%, and then passage the cells. After passage 3 times, perform cell counting and seeding. Cell seeding:

[0157] Cell culture plates (6-well plates), with a culture volume of 2.5 ml / well and a cell seeding amount of 1.00×10 5 cells / well. Digest the Li-7 cells with trypsin, resuspend them in 10 ml of complete RPMI-1640 medium, and the cell count is 9.91×10 5 / ml. Dilute by 9.91 times, inoculate 4 wells, with 1 ml of Li-7 cell suspension + 8.91 ml of complete RPMI-1640 medium. Among them, 2 wells are used for experiments, and the remaining 2 wells are reserved. Add 1 ml of diluted cell suspension + 1.5 ml of fresh medium to each well, mix gently, and the culture conditions are: 37°C, 5% CO2.

[0158] Virus infection, cell observation:

[0159] Label the 6-well plates as Li-7 blank and Li-7 virus respectively. Observe the cell status under a microscope every day at 24 h, 48 h, and 72 h after infecting the Li-7 cells with the virus (5.39×10 7 TU), take pictures and change the medium. The volume of the changed medium is 2.5 ml. After changing the medium for the Li-7 virus, add the virus (5.39×10 7 TU). Stop the experiment after 72 h. After digesting the cells with trypsin, add 1 ml of complete RPMI-1640 medium to resuspend them, and then count the cells using a cell counter (Thermo).

[0160] The comparison of the cell conditions from 24 h to 72 h is as Figure 3 shown. It can be seen that the cell morphology changes after virus infection, and the cells do not spread after adhering, and cell growth is significantly inhibited.

[0161] 、 7 shows the cell counting situation at 72 h after infection. Among them, the viable cell density of the blank reaches 4.34×10 5 / well, while the viable cell density after virus infection only reaches 1.11×10 5 / well. The viable cell density of the blank increases from 1.00×10 5 / ml to 4.34×10 5 / ml. The viable cell density after virus infection is from 1.00×105 / ml only increased to 1.11×10 5 / ml. The tumor inhibition rate was calculated according to the formula T / C = (1-T / C) × 100, where T represents the virus group and C represents the blank group. By calculating the tumor inhibition ratio of the virus group relative to the blank group, the tumor inhibition rate was calculated to be 74.42%.

[0162] Cell counting statistical results:

[0163]

[0164] In summary, according to the cell growth conditions during the experiment, 72 hours after virus infection, the growth rate of virus-infected Li-7 cells was significantly lower than that of Li-7 blank cells, and the tumor inhibition rate reached 74.42%, showing an effective effect in inhibiting tumor cell growth.

[0165] Example 5 Experiment on lentivirus infection of human papillary thyroid cancer cells (B-CPAP)

[0166] Human papillary thyroid carcinoma cells (B-CPAP) were obtained from the Cell Resource Center of the Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. RPMI-1640 (Thermo Fisher Scientific) + 10% FBS (Gibco) medium was used. Culture flasks were placed in a CO2 incubator at 37°C, 5% CO2. After 24 hours of culture, cells were observed under a microscope to achieve a confluence of 80%-90% and then passaged. After three passages, cells were counted and plated.

[0167] Cell seeding and plating:

[0168] Cell culture plate (6-well plate), culture volume is 2.5 ml / well, cell inoculation amount is 1.00×10 5 B-CPAP cells were trypsinized and resuspended in 10 ml of RPMI-1640 complete medium. The cell count was 1.07 × 10 6 / ml, dilute 10.7-fold, and inoculate four wells with 1 ml of B-CPAP cell suspension plus 9.7 ml of RPMI-1640 complete medium. Two wells will be used for the experiment, and the remaining two wells will be reserved. Add 1 ml of the diluted cell suspension plus 1.5 ml of fresh medium to each well and mix gently. Culture conditions: 37°C, 5% CO2.

[0169] Virus infection, cell observation:

[0170] The 6-well plates were labeled as B-CPAP blank and B-CPAP virus. B-CPAP cells were added with virus (5.39×10 7The cell status was observed under a microscope every day at 24 h, 48 h, and 72 h after TU infection, and pictures were taken and the medium was changed. The volume of the changed medium was 2.5 ml. After changing the medium for B-CPAP virus, the virus (5.39×10 7 TU) was added. The experiment was stopped after 72 h. After the cells were digested with trypsin, 1 ml of RPMI-1640 complete medium was added to resuspend the cells, and the cells were counted using a cell counter (Thermo).

[0171] The cell conditions from 24 h to 72 h were compared as Figure 5 shown. It can be seen that the cell morphology changed after virus infection. The cells did not spread after adhering to the wall, and the cell growth was significantly inhibited.

[0172] 、 10 Figure 13 shows the cell counting situation at 72 h after infection. The density of viable cells in the blank reached 1.01×10 6 / well, while the density of viable cells after virus infection only reached 2.93×10 5 / well. The density of viable cells in the blank increased from 1.00×10 5 / ml to 1.01×10 6 / ml. The density of viable cells after virus infection increased from 1.00×10 5 / ml to 2.93×10 5 / ml. According to the tumor inhibition rate calculation formula T / C = (1 - T / C)×100, where T represents the virus group and C represents the blank group; by calculating the tumor inhibition ratio of the virus group relative to the blank group, the tumor inhibition rate was calculated to be 70.99%.

[0173] Cell counting statistical results:

[0174]

[0175] In summary, according to the cell growth situation during the experiment, after 72 h of virus infection, the growth rate of B-CPAP cells infected with the virus was significantly lower than that of B-CPAP blank cells, and the tumor inhibition rate reached 70.99%, showing an effective role in inhibiting the growth of tumor cells.

[0176] Example 6 Lentivirus infection of human ovarian cancer cells (Caov-3) experiment

[0177] Human ovarian cancer cells (Caov-3), sourced from the Cell Resource Center of the Shanghai Institute of Life Sciences, Chinese Academy of Sciences. DMEM (purchased from Thermo Fisher Scientific) + 10% FBS (purchased from Gibco) medium was used. The culture flasks were placed in a carbon dioxide incubator for cultivation, with the cultivation conditions: 37°C, 5% CO2. After 48 hours of cell culture, the cell confluence rate was observed under a microscope to be 80%-90%, and subculture was carried out. After subculturing 3 times, cell counting was performed and plating was done.

[0178] Cell seeding and plating:

[0179] Cell culture plates (6-well plates), with a culture volume of 2.5 ml / well, and the cell seeding amount was 1.00×10 5 cells / well. Caov-3 cells were digested with trypsin and resuspended in 10 ml of complete DMEM medium. The cell count was 1.37×10 6 / ml, diluted 13.7 times, and inoculated into 4 wells. 1 ml of Caov-3 cell suspension + 12.7 ml of complete DMEM medium, with 2 wells for experiments and the remaining 2 wells reserved. 1 ml of diluted cell suspension + 1.5 ml of fresh medium was added to each well, gently mixed, and the culture conditions were: 37°C, 5% CO2.

[0180] Virus infection and cell observation:

[0181] The 6-well plates were labeled as Caov-3 blank and Caov-3 virus respectively. After Caov-3 cells were infected with the virus (5.39×10 7 TU), the cell status was observed under a microscope every day at 48 h, 72 h, and 96 h after infection, and photos were taken and the medium was changed. The volume of the medium change was 2.5 ml. After changing the medium for Caov-3 virus, the virus (5.39×10 7 TU) was added. After 96 h, the experiment was stopped. After the cells were digested with trypsin, 1 ml of complete DMEM medium was added to resuspend them, and then cell counting was performed using a cell counter (Thermo).

[0182] The cell conditions from 48 - 96 h were compared as Figure 6 shown. It can be seen that after virus infection, the cell morphology changed, the cells did not spread after attachment, and cell growth was significantly inhibited.

[0183] Regarding the cell counting situation at 96 h after infection, the viable cell density of the blank reached 5.69×10 5 / well, while the viable cell density after virus infection only reached 1.70×10 5 / well. The viable cell density of the blank increased from 1.00×10 5 / ml to 5.69×10 5 / ml. The density of living cells after virus infection increased from 1.00×10 5 / ml to 1.70×10 5 / ml. According to the tumor inhibition rate calculation formula T / C = (1 - T / C)×100, where T represents the virus group and C represents the blank group; by calculating the tumor inhibition ratio of the virus group relative to the blank group, the tumor inhibition rate can be calculated as 70.12%.

[0184] Cell counting statistical results:

[0185]

[0186]

[0187] In summary, based on the cell growth situation during the experiment, after 96 hours of virus infection, the growth rate of Caov-3 cells infected with the virus was significantly lower than that of Caov-3 blank cells. The tumor inhibition rate reached 70.12%, showing an effective effect of inhibiting the growth of tumor cells.

[0188] Example 7 Experiment on Lentivirus Infection of Human Renal Clear Cell Adenocarcinoma Cells (786-0)

[0189] Human renal clear cell adenocarcinoma cells (786-0) were obtained from the Cell Resource Center of the Shanghai Institute of Life Sciences, Chinese Academy of Sciences. RPMI-1640 (purchased from Thermo Fisher Scientific) + 10% FBS (purchased from Gibco) medium was used. The culture flasks were placed in a carbon dioxide incubator for culture, and the culture conditions were: 37°C, 5% CO2. After 24 hours of cell culture, the cell confluence rate was observed under a microscope to be 80%-90%, and subculture was carried out. After subculturing 3 times, cell counting was performed and plating was carried out.

[0190] Cell seeding and plating:

[0191] Cell culture plates (6-well plates), the culture volume was 2.5 ml / well, and the cell seeding amount was 1.00×10 5 cells / well. The 786-0 cells were digested with trypsin and resuspended in 10 ml of RPMI-1640 complete medium. The cell count was 8.45×10 5 / ml, diluted 8.45 times, and inoculated into 4 wells, 1 ml of 786-0 cell suspension + 7.45 ml of RPMI-1640 complete medium, of which 2 wells were used for the experiment and the remaining 2 wells were reserved. 1 ml of diluted cell suspension + 1.5 ml of fresh medium was added to each well, gently mixed, and the culture conditions were: 37°C, 5% CO2.

[0192] Virus infection and cell observation:

[0193] The six-well plates were labeled as 786-0 blank and 786-0 virus respectively. After the 786-0 cells were infected with the virus (5.39×10 7 TU), the cell status was observed under a microscope every day at 24 h, 48 h, and 72 h after infection, and pictures were taken and the medium was changed. The volume of the medium changed was 2.5 ml. After changing the medium for the 786-0 virus group, the virus (5.39×10 7 TU) was added. The experiment was stopped after 72 h. After the cells were digested with trypsin, 1 ml of RPMI-1640 complete medium was added to resuspend the cells, and then the cells were counted using a cell counter (Thermo).

[0194] The cell conditions from 24 to 72 h were compared as Figure 8 shown. It can be seen that after virus infection, the cell morphology changed, the cells did not spread after attachment, and cell growth was significantly inhibited.

[0195] and 13 showed the cell counting results at 72 h after infection. Among them, the viable cell density of the blank reached 5.51×10 5 / well, while the viable cell density after virus infection only reached 2.11×10 5 / well. The viable cell density of the blank increased from 1.00×10 5 / ml to 5.51×10 5 / ml. The viable cell density after virus infection increased from 1.00×10 5 / ml to 2.11×10 5 / ml. According to the tumor inhibition rate calculation formula T / C = (1 - T / C)×100, where T represents the virus group and C represents the blank group; by calculating the tumor inhibition ratio of the virus group relative to the blank group, the tumor inhibition rate was calculated to be 61.70%.

[0196] Cell counting statistical results:[[]]

[0197]

[0198] In summary, according to the cell growth conditions during the experiment, after 72 h of virus infection, the growth rate of the 786-0 cells infected with the virus was significantly lower than that of the 786-0 blank cells, and the tumor inhibition rate reached 61.70%, showing an effective role in inhibiting the growth of tumor cells.

[0199] Example 8 Experiment on Lentivirus Infection of Human Pancreatic Cancer Cells (PANC-1)

[0200] Human pancreatic cancer cells (PANC-1) were sourced from the Cell Resource Center of the Shanghai Institute of Life Sciences, Chinese Academy of Sciences. DMEM (purchased from Thermo Fisher Scientific) + 10% FBS (purchased from Gibco) medium was used. The culture flasks were placed in a carbon dioxide incubator for culturing, with the culture conditions being 37°C and 5% CO2. After 24 hours of cell culture, the cell confluence rate was observed under a microscope to be 80%-90%, and subculture was carried out. After subculturing 3 times, cell counting was performed and seeding was done.

[0201] Cell seeding and plating:

[0202] Cell culture plates (6-well plates) were used, with a culture volume of 2.5 ml / well and a cell seeding amount of 1.00×10 5 cells / well. PANC-1 cells were digested with trypsin and resuspended in 10 ml of complete DMEM medium. The cell count was 1.04×10 6 / ml, diluted 10.4 times, and seeded into 4 wells. 1 ml of PANC-1 cell suspension + 9.4 ml of complete RPMI-1640 medium was used, with 2 wells for experiments and the remaining 2 wells reserved. 1 ml of diluted cell suspension + 1.5 ml of fresh medium was added to each well, gently mixed, and the culture conditions were 37°C and 5% CO2.

[0203] Virus infection and cell observation:

[0204] The 6-well plates were labeled as PANC-1 blank and PANC-1 virus respectively. After PANC-1 cells were infected with the virus (5.39×10 7 TU), the cell status was observed under a microscope every day at 24 h, 48 h, and 72 h after infection, and photos were taken and the medium was changed. The volume of the medium changed was 2.5 ml. After changing the medium for the PANC-1 virus group, the virus (5.39×10 7 TU) was added. The experiment was stopped after 72 h. After the cells were digested with trypsin, 1 ml of complete DMEM medium was added to resuspend the cells, and then cell counting was performed using a cell counter (Thermo).

[0205] The cell conditions from 24 to 72 h were compared as Figure 9 shown. It can be seen that after virus infection, the cell morphology changed, the cells did not spread after adhering, and cell growth was significantly inhibited.

[0206] 、 16 For the cell counting situation at 72 h after infection, the density of viable cells in the blank reached 5.75×10 5 / well, while the density of viable cells after virus infection only reached 2.58×10 5 / well. The density of viable cells in the blank increased from 1.00×10 5 / ml to 5.75×10 5 / ml. The density of live cells after virus infection increased from 1.00×10 5 / ml to 2.58×10 5 / ml. According to the tumor inhibition rate calculation formula T / C = (1 - T / C)×100, where T represents the virus group and C represents the blank group; by calculating the tumor inhibition ratio of the virus group relative to the blank group, the tumor inhibition rate can be calculated to be 55.13%.

[0207] Cell counting statistical results:

[0208]

[0209] In summary of the above experiments, according to the cell growth situation during the experiment, after 72 hours of virus infection, the growth rate of PANC-1 cells infected with the virus was significantly lower than that of PANC-1 blank cells, and the tumor inhibition rate reached 55.13%, showing an effective effect of inhibiting the growth of tumor cells.

[0210] Example 9 Lentivirus infection experiment on human endometrial adenocarcinoma cells (HEC-1-B)

[0211] Human endometrial adenocarcinoma cells (HEC-1-B) are from the Cell Resource Center of the Shanghai Institute of Life Sciences, Chinese Academy of Sciences. Use DMEM (purchased from Thermo Fisher Scientific) + 10% FBS (purchased from Gibco) medium. Place the culture flask in a carbon dioxide incubator for culturing, and the culture conditions are: 37°C, 5% CO2. After culturing the cells for 24 hours, observe the cell confluence rate under a microscope at 80% - 90% and perform passage. After passage 3 times, perform cell counting and plating.

[0212] Cell seeding and plating:

[0213] Cell culture plates (6-well plates), the culture volume is 2.5 ml / well, and the cell seeding amount is 1.00×10 5 cells / well. Digest HEC-1-B cells with trypsin and resuspend them in 10 ml of DMEM complete medium. The cell count is 2.82×10 6 / ml, dilute 28 times, inoculate 4 wells, 1 ml of HEC-1-B cell suspension + 27 ml of RPMI-1640 complete medium, of which 2 wells are used for experiments and the remaining 2 wells are reserved. Add 1 ml of diluted cell suspension + 1.5 ml of fresh medium to each well, mix gently, and the culture conditions are: 37°C, 5% CO2.

[0214] Virus infection, cell observation:

[0215] The 6-well plates are labeled as HEC-1-B blank and HEC-1-B virus respectively. Add virus (5.39×107 After TU infection, observe the cell status under the microscope every day at 24h, 48h, and 72h, take pictures and change the medium. The volume of the changed medium is 2.5 ml. After changing the medium for HEC-1-B virus, add the virus (5.39×10 7 TU). Stop the experiment after 72h. After digesting the cells with trypsin, add 1 ml of complete DMEM medium to resuspend the cells and count them with a cell counter (Thermo).

[0216] The cell conditions from 24h to 72h are compared as Figure 2 shown. It can be seen that the cell morphology changes after virus infection. After adhering to the wall, the cells do not stretch, and cell growth is significantly inhibited.

[0217] Figure 3 Figure 11 Figure 12 Figure 14 Figure 15 Figure 17 Figure 18 、 19 For the cell counting at 72h after infection, the density of viable cells in the blank reaches 4.34×10 5 / well, while the density of viable cells after virus infection only reaches 2.17×10 5 / well. The density of viable cells in the blank increases from 1.00×10 5 / ml to 4.34×10 5 / ml. The density of viable cells after virus infection increases from 1.00×10 5 / ml to 2.17×10 5 / ml. According to the tumor inhibition rate calculation formula T / C = (1 - T / C)×100, where T represents the virus group and C represents the blank group; by calculating the tumor inhibition ratio of the virus group relative to the blank group, the tumor inhibition rate can be calculated to be 50%.

[0218] Cell counting statistical results:

[0219]

[0220] In summary, according to the cell growth situation during the experiment, after 72h of virus infection, the growth rate of HEC-1-B cells infected with the virus is significantly lower than that of HEC-1-B blank cells, and the tumor inhibition rate reaches 50%, showing an effective role in inhibiting the growth of tumor cells.

Claims

1. Use of a lentivirus for treating cancer in the preparation of a medicament for treating cancer, characterized in that, The lentivirus for treating cancer carries the hTERT promoter-CDC6shRNA combined gene, and the sequence of the hTERT promoter-CDC6shRNA combined gene is SEQ ID NO.1; the cancer is lung cancer, liver cancer or papillary thyroid cancer.

2. The application according to claim 1, wherein the cancer is lung cancer.

3. The application according to claim 1, wherein the drug further comprises a pharmaceutically acceptable excipient.

4. The application according to claim 1, wherein the drug is in the form of an injection.

5. The preparation method of the lentivirus for treating cancer according to claim 1 comprises: (1) Inserting the hTERT promoter and the CDC6shRNA gene sequence after the restriction enzyme site of the vector to obtain a plasmid; (2) Transferring the plasmid into an expression strain and culturing to screen the successfully transferred strain; (3) Performing shake culture on the successfully transferred strain obtained in step (2) to obtain the hTERT-CDC6shRNA expression plasmid; (4) Packaging the expression plasmid described in step (3) to obtain the lentivirus for treating cancer.

Images