Ssr molecular marker and application thereof in malus robusta rehd variety identification
By screening and designing SSR molecular markers, the problem of difficult identification of prickly pear varieties has been solved, the application of polymorphic primers has been realized, and rapid and accurate variety identification and breeding support have been achieved.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-22
- Publication Date
- 2026-04-07
AI Technical Summary
Current technologies make it difficult to identify prickly pear varieties, as resources are mixed and difficult to distinguish, leading to an increased risk of variety infringement and limiting the progress of molecular breeding.
Polymorphic primers were designed and screened, an SSR molecular marker database was constructed, and SSR sites with good polymorphism and high stability were screened by PCR amplification and capillary gel electrophoresis. Eight SSR primer pairs were developed for the identification of prickly pear varieties.
It enables rapid and accurate identification of prickly pear varieties, distinguishing multiple varieties and supporting molecular breeding and variety improvement.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant breeding technology, and in particular to an SSR molecular marker and its application in the identification of prickly pear varieties. Background Technology
[0002] Rosa roxburghii Tratt. is a wild plant with sweet and sour fruit rich in vitamin C, vitamin P, superoxide dismutase, various amino acids, minerals, and bioactive substances such as flavonoids. It has broad application prospects in food processing, medicine, health products, and cosmetics. The rosa roxburghii industry has been widely promoted, but the wild germplasm resources are abundant yet unclear. These include several varieties such as Guohong, Fentuan, Fenbian, Shaoci, Wuci, Guinong 1, Guinong 5, Guinong 8, Guinong 9, Guinong 10, Guinong 13, Guinong 14, Guinong 15, Guinong 18, and Guinong 20. Due to the excellent traits and high commercial value of these rosa roxburghii varieties, and the difficulty in distinguishing them from other germplasm, a stable and reliable rosa roxburghii variety identification system is urgently needed to prevent varietal infringement.
[0003] SSR markers possess advantages such as rich polymorphism and strong stability. SSR marker-based molecular identification technology offers advantages such as speed, accuracy, and low cost, and has already been widely applied in industry. Currently, there are few available molecular markers for prickly pear, and its genome has not yet been published, which limits the molecular breeding process of prickly pear. Summary of the Invention
[0004] In order to solve the problems existing in the prior art, the present invention provides an SSR molecular marker and its application in the identification of prickly pear varieties.
[0005] This invention involves downloading the genome of the Samantha rose from NCBI, mining SSR markers, designing primers, and screening them to obtain polymorphic primers. These polymorphic primers, combined with those from the prickly pear transcriptome, form a primer database. Further, capillary gel electrophoresis of the M13 SSR PCR products was used to screen out eight different SSR loci with good polymorphism and high stability. The detection results can be applied to the identification of multiple prickly pear varieties.
[0006] In a first aspect, the present invention provides an SSR molecular marker, including: Chin7, Chin17, Chin24, Chin65, Rox27, Rox28, Rox40, and Rox44;
[0007] Chin7 includes: F: AATATACACGAACAACAACCATCG, R: GGAACATGACCCCTTTTCTTATT;
[0008] Chin17 includes: F: GATGCTTTCATTCTGCTTCAAC, R: ATTTTTACCGTACTCTGGGTGCT;
[0009] Chin24 includes: F: GAGTCATGTTGAATGATATTGGC, R: TTTCCTCTTTTCTTCTTTTTCCC;
[0010] Chin65 includes: F: GAGAGAGTAGCCTTTGATGAGGA, R: GAATGTCGTCAGGGAGCAGTAG;
[0011] Rox27 includes: F: AGTAGTCTAGTGGTTCGACTCTTC, R: GTAGCTCGCAAGGCTCATAAC;
[0012] Rox28 includes: F: TCTATACATATGACCGGCAATC, R: GTGTAGTCATTTATTTGGTACCTCC;
[0013] Rox40 includes: F: ATGGATAAAGACGTGTCTAATTGTA, R: ATATATGGAATAACCGTCCTATTA;
[0014] Rox44 includes: F: AATGAATACTTTGCAAGAGGG, R: GTATACGTTTACTTTGGCTCGAATA.
[0015] The amplified fragment of Chin7 above includes 4 repeats, and the repeat nucleotide sequence is CTACA;
[0016] The fragment amplified by Chin17 above includes 6 repeats, and the repeat nucleotide sequence is TC;
[0017] The fragment amplified by Chin24 above includes 13 repeats, and the repeat nucleotide sequence is TGGA;
[0018] The fragment amplified by Chin65 above includes 7 repeats, and the repeat nucleotide sequence is CTC;
[0019] The Rox27 amplified fragment above contains 4 repeats, with the repeat nucleotide sequence being TAT;
[0020] The fragment amplified by Rox28 above includes three repeats, with the repeat nucleotide sequence being ATG;
[0021] The fragment amplified by Rox40 above includes three repeats, with the repeat nucleotide sequence being CGG;
[0022] The fragment amplified by Rox44 as shown above includes 4 repeats, with the repeat nucleotide sequence being AAT.
[0023] Secondly, the present invention provides a kit comprising: the aforementioned SSR molecular marker.
[0024] Thirdly, the present invention provides the application of the SSR molecular marker or the kit described herein in the identification of varieties of prickly pear.
[0025] The present invention further provides the application of the SSR molecular marker or the kit described herein in molecular marker-assisted breeding, cultivation of superior quality or improvement of germplasm resources of prickly pear.
[0026] Fourthly, the present invention provides a method for identifying varieties of prickly pear, comprising:
[0027] Genomic DNA was extracted from the prickly pear sample to be tested, and PCR amplification was performed using the SSR molecular markers described above. The variety of the prickly pear sample to be tested was determined based on the PCR amplification results.
[0028] Furthermore, the PCR amplification procedure includes:
[0029] Step 1 PCR reaction:
[0030] 93~95℃ for 5~10 minutes;
[0031] 93~95℃ 30~60s, 55-65℃ 30~60s, 70~74℃ 20~40s, 25~35 cycles;
[0032] 70~74℃ for 5~10 minutes;
[0033] After adding fluorescent labeling, the second step of PCR reaction is performed:
[0034] 93~95℃ for 5~10 minutes;
[0035] 93~95℃ 30~60s, 55-65℃ 30~60s, 70~74℃ 20~40s, 13~20 cycles;
[0036] 70~74℃ for 5~10 minutes.
[0037] Furthermore, the determination of the variety of the prickly pear sample to be tested based on the PCR amplification results includes:
[0038] The PCR amplification results and DNA fingerprints are compared to determine the variety of the prickly pear sample to be tested. The DNA fingerprints are constructed from the amplified fragments of the SSR molecular markers of different prickly pear varieties.
[0039] Furthermore, the varieties include:
[0040] Pink Ball, National Red, Less Thorn, Thornless, Pink Edge, Guinong No. 1, Guinong No. 5, Guinong No. 8, Guinong No. 9, Guinong No. 10, Guinong No. 13, Guinong No. 14, Guinong No. 18 or Guinong No. 20.
[0041] The present invention has the following beneficial effects:
[0042] This invention identified eight SSR loci through research and screening, and developed corresponding SSR molecular markers (including eight SSR primer pairs). Based on the detection results of these SSR molecular markers, accurate identification of prickly pear varieties can be achieved. The SSR molecular markers provided by this invention can rapidly and accurately identify multiple prickly pear varieties, and have significant application value in the field of prickly pear breeding. Detailed Implementation
[0043] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0044] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.
[0045] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.
[0046] Example 1
[0047] 1. Experimental Materials
[0048] This invention uses domestically approved and named prickly pear varieties as reference varieties for experiments, including Guohong, Fentuan, Fenbian, Wuci, Shaoci, Guinong No. 1, Guinong No. 5, Guinong No. 8, Guinong No. 9, Guinong No. 10, Guinong No. 13, Guinong No. 14, Guinong No. 18, and Guinong No. 20. The prickly pear material for this invention is obtained from prickly pear leaves collected from the Prickly Pear Germplasm Resource Bank of Qiannan Prefecture, Guizhou Province, and healthy, tender young leaves are collected.
[0049] 2. Experimental Procedure
[0050] (1) Genomic DNA extraction and detection: DNA was extracted from the samples using the Tiangen kit (DP305). The integrity of the DNA was detected by 1% agarose gel electrophoresis. The purity and concentration of the DNA were detected by UV spectrophotometer. Finally, the DNA was uniformly diluted to 10 ng / µL with ddH2O for later use.
[0051] (2) SSR primer design
[0052] The EST-SSR primers for *Rosa rubra* were derived from publicly available primer sequences. Sixty pairs of SSR primers for closely related species were designed based on SSR sites selected from the transcriptome sequences of *Rosa sammonia* downloaded from the NCBI website. (The SSR site selection parameters were: repeat motifs of 1–6 bp, with minimum repeat counts of 10, 6, 3, 3, 3, and 3 for mononucleotides, dinucleotides, trinucleotides, tetranucleotides, pentanucleotides, and hexanucleotides, respectively).
[0053] (3) Synthesis and screening of polymorphic primers
[0054] The TP-M13-SSR primer consists of three primers: an M13 tail (TGTAAAACGACGGCCAGT) added to the 5' end of the forward primer; a standard reverse primer; and primers labeled with three M13 fluorescent tags: ROX (red), HEX (green), and FAM (blue).
[0055] Seventy pairs of synthesized primers were used, and the M13-SSR-PCR products were detected by capillary gel electrophoresis. Using DNA from eight prickly pear varieties (Guohong, Fentuan, Fenbian, Wuci, Shaoci, Guinong No. 1, and Guinong No. 8) as templates, PCR amplification was performed using an optimized PCR program (Table 3). The amplification results were detected by 3.5% agarose gel electrophoresis, and eight optimal primer pairs (corresponding to those in Table 2) were finally obtained, exhibiting the richest polymorphism and no extraneous peaks.
[0056] Table 1. List of primers synthesized in the experiment
[0057]
[0058] PCR system: The PCR reaction system (25.5µL) includes: DNA 1µL, 2*Taq PCR Mix 12.5µL, F-primer 1µL (10µM), R-primer 1µL (10µM), and ddH2O 9.5µL.
[0059] The PCR procedure is as follows:
[0060] Table 2 PCR reaction procedure
[0061]
[0062] (4) PCR amplification and capillary electrophoresis detection
[0063] Based on the polymorphic primers obtained in (3), a second round of PCR amplification was performed, and fluorescent labeling was added.
[0064] The PCR amplification system consisted of: 15 μl of the first-round PCR product, 0.5 μl of 2×Taq DNAase (2.5 U / μL), 0.5 μl of M13 fluorescent primer (10 μmol / L), and 10×PCR Buffer (Mg2+). 2+ 5μL (free)
[0065] The reaction procedure is as follows:
[0066] Table 3 PCR reaction procedure
[0067]
[0068] After obtaining the PCR products, 6 µL of each of the M13 fluorescent products with different colors were mixed into the same well and detected by capillary electrophoresis. The capillary electrophoresis method was as follows: formamide and the molecular weight internal standard were mixed at a volume ratio of 100:1, and 9 µL was added to the sample plate. Then, 1 µL of PCR product diluted 10-fold (the PCR product of this invention, which is a mixture of 8 primers) was added, and capillary electrophoresis was performed using a sequencer.
[0069] (5) Data reading and statistics
[0070] The raw data exported from the capillary electrophoresis sequencer were read using GeneMarker V2.2.0 fragment analysis software. The positions of the molecular weight internal standards in each lane were compared with the positions of the peak values of each sample to obtain the fragment size. To ensure data accuracy, all experimental data were recommended to be read manually or verified manually. Data reading followed the method recommended in Table 3, selecting the main peak and the rounding direction for both single-peak and multi-peak peak types.
[0071] (6) Construction of DNA fingerprinting
[0072] GeneMarker V2.2.0 was used to read 25 prickly pear germplasm resources using 8 primer pairs to obtain the allele fragment sizes and corresponding capillary electrophoresis images at different loci. Allele fragment lengths were read sequentially according to different allele loci, and different allelic variations at corresponding loci in different varieties were recorded. The recording method is as follows: at the same allele locus, the shorter fragment is listed first, followed by the longer fragment, separated by a " / ". Recordings were made in the order of loci Chin7, Chin17, Chin24, Chin65, Rox27, Rox28, Rox40, and Rox44, with spaces separating the records from different loci. This yielded the "molecular ID card" code for prickly pear.
[0073] (7) Construction of fingerprint QR code
[0074] Using the online tool for generating QR codes for grass, the above fingerprint encoding information and basic information about the prickly pear variety were used to generate a two-dimensional information code, as shown below.
[0075] Table 4 Fingerprint patterns
[0076]
[0077] The results above show that the 14 prickly pear varieties can be accurately distinguished using the SSR primer combination provided by this invention.
[0078] The present invention further uses the above DNA fingerprinting to analyze 261 prickly pear materials (56 germplasms), and the results show that it is sufficient to correctly distinguish all prickly pear materials.
[0079] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. An SSR primer combination, characterized in that, include: Chin7, Chin17, Chin24, Chin65, Rox27, Rox28, Rox40, Rox44; Chin7 includes: F: AATATACACGAACAACAACCATCG, R: GGAACATGACCCCTTTTCTTATT; Chin17 includes: F: GATGCTTTCATTCTGCTTCAAC, R: ATTTTTACCGTACTCTGGGTGCT; Chin24 includes: F: GAGTCATGTTGAATGATATTGGC, R: TTTCCTCTTTTCTTCTTTTTCCC; Chin65 includes: F: GAGAGAGTAGCCTTTGATGAGGA, R: GAATGTCGTCAGGGAGCAGTAG; Rox27 includes: F: AGTAGTCTAGTGGTTCGACTCTTC, R: GTAGCTCGCAAGGCTCATAAC; Rox28 includes: F: TCTATACATATGACCGGCAATC, R: GTGTAGTCATTTATTTGGTACCTCC; Rox40 includes: F: ATGGATAAAGACGTGTCTAATTGTA, R: ATATATGGAATAACCGTCCTATTA; Rox44 includes: F: AATGAATACTTTGCAAGAGGG, R: GTATACGTTTACTTTGGCTCGAATA.
2. A reagent kit, characterized in that, include: The SSR primer combination as described in claim 1.
3. The application of the SSR primer combination of claim 1 or the kit of claim 2 in the identification of prickly pear varieties.
4. The application of the SSR primer combination of claim 1 or the kit of claim 2 in molecular marker-assisted breeding, cultivation of superior quality or germplasm resource improvement of prickly pear.
5. A method for identifying the variety of prickly pear, characterized in that, include: Genomic DNA was extracted from the prickly pear sample to be tested, and PCR amplification was performed using the SSR primer combination described in claim 1. The variety of the prickly pear sample to be tested was determined based on the PCR amplification results. The varieties include one or more of the following: Pink Ball, Guohong, Less Thorn, Thornless, Pink Edge, Guinong No. 1, Guinong No. 5, Guinong No. 8, Guinong No. 9, Guinong No. 10, Guinong No. 13, Guinong No. 14, Guinong No. 18 or Guinong No.
20.
6. The identification method according to claim 5, characterized in that, The PCR amplification procedure includes: Step 1 PCR reaction: 93~95℃ for 5~10 minutes; 93~95℃ 30~60s, 55-65℃ 30~60s, 70~74℃ 20~40s, 25~35 cycles; 70~74℃ for 5~10 minutes; After adding fluorescent labeling, the second step of PCR reaction is performed: 93~95℃ for 5~10 minutes; 93~95℃ 30~60s, 55-65℃ 30~60s, 70~74℃ 20~40s, 13~20 cycles; 70~74℃ for 5~10 minutes.
7. The identification method according to claim 5 or 6, characterized in that, The variety of the prickly pear sample to be tested, determined based on the PCR amplification results, includes: The PCR amplification results and DNA fingerprints are compared, and the variety of the prickly pear sample to be tested is determined based on the comparison results; the DNA fingerprint is constructed from the amplified fragment size of different prickly pear varieties based on the SSR primer combination described in claim 1.
Citation Information
Patent Citations
Non-modified polyacrylamide gel electrophoresis method for detecting SSR marker polymorphism of rosa roxburghii tratt
CN109307703A
Specific molecular marker of thorn-free No.1 thorn-free line of roxburgh rose and application of specific molecular marker
CN114317534A