A KASP marker primer combination for detecting watermelon peel gloss traits and its application

Abstract

The present invention discloses a KASP marker primer combination for detecting the glossiness trait of watermelon peel and its application, belonging to the field of molecular biology technology for watermelon breeding. The KASP marker primer combination comprises an upstream primer 1, an upstream primer 2, and a downstream primer 1; the nucleotide sequence of the upstream primer 1 is shown in SEQ ID NO. 1; the nucleotide sequence of the upstream primer 2 is shown in SEQ ID NO. 2; and the nucleotide sequence of the downstream primer 1 is shown in SEQ ID NO. 3. The KASP marker primer combination uses the KASP molecular marker Cla_27993083 as the detection target. Using the primer combination of the present invention for amplification can accurately and rapidly identify the glossiness trait of watermelon peel, providing a new technical approach for the screening and identification of watermelon materials with glossy peels and the breeding of glossy watermelon varieties.

Description

Technical Field

[0001] The invention relates to the technical field of watermelon breeding molecular biology, in particular to a KASP marker primer combination for detecting the gloss trait of watermelon peel and an application thereof. Background Art

[0002] Watermelon is a major horticultural crop. my country is the world's largest producer and marketer of watermelon, consistently ranking first in production and holding a key position in the global horticultural industry. Peel gloss is a key economic trait for watermelon fruit quality evaluation and germplasm improvement, significantly impacting its commercial value. Research has shown that plants with high glossiness exhibit superior quality, manifested in firm fruit texture, salinity, and drought tolerance. Therefore, breeding watermelon varieties with high glossiness is a key goal for watermelon breeders.

[0003] In 1988, Corey and Schlimme analyzed the changes in peel gloss of two watermelon varieties during fruit ripening. They found that peel gloss correlated with pulp maturity. When the soluble solids content and pulp color of the watermelon reached a stable state during ripening, the peel gloss of the Charleston cultivar began to decline. They also found that peel gloss varied between varieties, suggesting that it might be related to the amount and structure of wax on the peel surface. Therefore, they proposed that peel gloss could be used as a harvesting criterion for fruit ripeness. Correlating peel gloss with the quantitative and structural changes in peel wax and pulp texture could provide a non-destructive testing technique for selecting high-quality watermelons during harvesting and grading. Subsequently, researchers have screened and cloned genes associated with watermelon peel color through genetic mapping, library construction, and RNA-seq. However, these studies primarily focused on peel color formation, such as genes that differentiate between yellow and green peel color or dark green and light green fruit stripes. Research related to peel gloss has not been conducted.

[0004] In summary, the identification of watermelon peel gloss trait is still limited to visual inspection at present, and molecular markers for identifying watermelon peel gloss trait have not been reported. Therefore, it is necessary to provide a molecular identification technology that can quickly perform watermelon peel gloss trait. Summary of the Invention

[0005] The present invention aims to provide a KASP marker primer combination for detecting the glossiness trait of watermelon peel and its application, so as to solve the problems existing in the above-mentioned prior art. The KASP marker primer combination of the present invention can accurately and quickly identify the glossiness trait of watermelon peel.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] Technical solution 1: The KASP marker primer combination includes upstream primer 1, upstream primer 2 and downstream primer 1; the nucleotide sequence of the upstream primer 1 is shown in SEQ ID NO.1; the nucleotide sequence of the upstream primer 2 is shown in SEQ ID NO.2; and the nucleotide sequence of the downstream primer 1 is shown in SEQ ID NO.3.

[0008] Preferably, the molecular marker closely linked to the watermelon peel gloss trait is a T-to-A mutation occurring at position 27993083bp on chromosome 8 of the watermelon genome. The primers designed for the watermelon peel gloss trait mutation are as follows:

[0009] FAM fluorescent-labeled upstream primer 1 (Cla_27993083-F1): 5′-GAAGGTGACCAAGTTCATGCTCTCTATGAATGCAAAATTCTACAAACT-3′ (SEQ ID NO. 1);

[0010] VIC fluorescent-labeled upstream primer 2 (Cla_27993083-F2): 5′-GAAGGTCGGAGTCAACGGATTCTCTATGAATGCAAAATTCTACAAACA-3′ (SEQ ID NO. 2);

[0011] Downstream primer 1 (Cla_27993083-R): 5′-AAACACAAGGTAGGAGTGGGCT-3′ (SEQ ID NO. 3).

[0012] Preferably, the 5' ends of the two primers Cla_27993083-F1 and Cla_27993083-F2 are connected to FAM and VIC fluorescent linker sequences, respectively, FAM signal: GAAGGTGACCAAGTTCATGCT (SEQ ID NO. 4); VIC signal: GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 5).

[0013] Preferably, the genotypes corresponding to the molecular markers are: A:A is a homozygous genotype with shiny peel; T:T is a homozygous genotype with dull peel; T:A is a heterozygous genotype with dull peel.

[0014] Furthermore, the KASP marker primer combination uses the KASP molecular marker Cla_27993083 as a detection target; the Cla_27993083 is located at the 27993083bp base of chromosome 8 of watermelon.

[0015] Technical Solution 2: A method for identifying the glossiness of watermelon peel, comprising the following steps:

[0016] The method comprises extracting genomic DNA of the watermelon to be identified; using the genomic DNA of the watermelon to be identified as a template and adopting the KASP labeled primer combination to perform PCR amplification; and identifying the genotype of the watermelon sample to be identified based on the difference in PCR fluorescence signals; the genotypes include A:A genotype, T:T genotype and T:A genotype.

[0017] Furthermore, the PCR amplification system includes: 2.5 μL 2×KASPmaster mix, 1.25 μL primer mix and 1.25 μL DNA template; the primers include upstream primer 1, upstream primer 2 and downstream primer 1; the primer mix is ​​a mixture of the upstream primer 1, the upstream primer 2 and the downstream primer 1 in a volume ratio of 1:1:3.

[0018] Furthermore, the PCR amplification program is as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 20 s, annealing and extension at 61-55°C for 60 s, decreasing 0.6°C per cycle, 10 cycles; denaturation at 95°C for 20 s, annealing and extension at 55°C for 60 s, 27 cycles.

[0019] Furthermore, the genotype of the watermelon sample to be identified includes: reading the fluorescence signal value of the PCR product; if it is an A:A genotype, it is determined to be a homozygous individual plant with glossy watermelon rind; if it is a T:T genotype, it is determined to be a homozygous individual plant with dull watermelon rind; if it is a T:A genotype, it is determined to be a heterozygous individual plant with dull watermelon rind.

[0020] Technical solution three: Application of the KASP marker primer combination in detecting the gloss trait of watermelon peel.

[0021] The present invention discloses the following technical effects:

[0022] The present invention uses GWAS to locate a significant association locus controlling watermelon peel gloss. Based on this variant locus, a KASP molecular marker associated with watermelon peel gloss was developed. Using the KASP marker provided by the present invention to detect watermelon peel gloss is simple and time-saving. Traditional visual observation requires an entire growing season (approximately 4-5 months) during the fruit's ripening phase, while detection using this KASP marker takes only 1-2 hours. It is well-suited for batch testing of large populations and multiple samples. Furthermore, traditional hybridization requires 5-6 generations to produce breeding materials with stable traits. Using this KASP marker, stable traits can be obtained in just 3 generations, significantly shortening the breeding cycle and improving breeding efficiency. In summary, the present invention addresses the lack of technology for identifying the watermelon peel gloss trait by providing a KASP marker primer combination for identifying watermelon peel gloss. This KASP marker primer combination can accurately and rapidly identify watermelon peel gloss, providing a new technical approach for the screening and identification of watermelon materials with glossy peels and for the breeding of glossy watermelon varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 Manhattan plot for genomic association analysis of watermelon rind glossiness traits;

[0025] Figure 2 These are the genotyping results of the Cla_27993083 marker of the present invention in 69 watermelon samples. Blue represents the A:A genotype fluorescence signal corresponding to primer Cla_27993083, indicating a homozygous individual plant with a glossy peel surface; green represents the T:A genotype fluorescence signal corresponding to primer Cla_27993083, indicating a heterozygous individual plant with a matte peel surface; and orange represents the T:T genotype fluorescence signal corresponding to primer Cla_27993083, indicating a homozygous individual plant with a matte peel surface. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] Example 1 Development and application of KASP molecular markers for watermelon peel gloss trait

[0032] 1. Genome-wide association analysis to identify watermelon peel gloss traits

[0033] The whole genome of 143 natural watermelon population materials was resequenced using Illumina sequencing technology, with an average sequencing depth of 15×. After filtering by the conditions of minimum allele frequency (MAF) ≥ 5% and missing data rate (Missing data rate) ≤ 20%, a total of 2,923,709 SNPs were detected, providing rich genetic variation for watermelon breeding. The fruit rind glossiness trait of 143 watermelon materials was analyzed, and the FaST-LMM (Factored Spectrally Transformed Linear Mixed Models) model was used to conduct a genome-wide association analysis between the watermelon fruit rind glossiness trait and all SNP variant sites. The region 26922183-28011239 on chromosome 8 was significantly associated with the watermelon fruit rind glossiness trait. The Manhattan plot of the FaST-LMM model is shown in the figure below. Figure 1 As shown in the figure, there are 39 SNPs within this association interval. Further analysis of the P values ​​of the 39 SNPs revealed that the smaller the P value, the stronger the trait association. The analysis found that the smallest P value was at SNP 27993083, which is the SNP most associated with the watermelon peel gloss trait.

[0034] 2. Development of KASP markers for detecting the glossiness of watermelon peel

[0035] By comparing the genomic sequences of site 27993083, which is significantly associated with the glossiness of the watermelon peel, a 1bp variation was identified at the genomic level between glossy and dull watermelon peels. This variation caused a T to A mutation, resulting in differences in the peel glossiness trait.

[0036] Based on the mutation of this site, a KASP marker primer combination was designed in the 500bp region upstream and downstream of the mutation site. The specific sequences are as follows:

[0037] FAM fluorescent-labeled upstream primer 1 (Cla_27993083-F1): 5′-GAAGGTGACCAAGTTCATGCTCTCTATGAATGCAAAATTCTACAAACT-3′ (SEQ ID NO. 1);

[0038] VIC fluorescent-labeled upstream primer 2 (Cla_27993083-F2):

[0039] 5'-GAAGGTCGGAGTCAACGGATTCTCTATGAATGCAAAATTCTACAAA CA-3' (SEQ ID NO. 2);

[0040] Downstream primer 1 (Cla_27993083-R):

[0041] 5'-AAACACAAGGTAGGAGTGGGCT-3' (SEQ ID NO. 3).

[0042] The 5' ends of primers Cla_27993083-F1 and Cla_27993083-F2 were connected to FAM and VIC fluorescent linker sequences, respectively. FAM signal: GAAGGTGACCAAGTTCATGCT (SEQ ID NO. 4); VIC signal: GAAGGTCGGAGTCAACGGATT (SEQ ID NO. 5).

[0043] The above primers were synthesized by Nanjing Jisi Huiyuan Biotechnology Co., Ltd.

[0044] The above-mentioned KASP marker primer combination is used to detect the glossiness trait of watermelon peel. If it is an A:A genotype, it is determined to be a homozygous individual plant with glossy watermelon peel; if it is a T:T genotype, it is determined to be a homozygous individual plant with dull watermelon peel; if it is a T:A genotype, it is determined to be a heterozygous individual plant with dull watermelon peel.

[0045] 3. Detection of watermelon peel gloss traits using KASP marker primer combination

[0046] (1) Genomic DNA extraction. The total DNA of leaves from 69 watermelon natural population samples was extracted using the FlaPure Plant DNA Extraction Kit (Beijing Jinsha Biotechnology Co., Ltd.). The peel gloss traits of the 69 watermelon samples are shown in Table 1.

[0047] Table 169 natural watermelon population materials and peel gloss phenotypes

[0048]

[0049] (2) PCR reaction system and procedure. The watermelon DNA extracted in step (1) was used as a template and PCR amplification was performed using the KASP labeled primer combination. The PCR reaction system was 5 μl in total and consisted of the following components: 2.5 μL 2×KASP master mix, 1.25 μL Primer mix, and 1.25 μL DNA template. The Primer mix was Cla_27993083-F1:Cla_27993083-F2:Cla_27993083-R in a ratio of 1:1:3. The PCR reaction procedure was: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 20 s, annealing and extension at 61-55°C for 60 s, decreasing by 0.6°C each cycle, for 10 cycles; denaturation at 95°C for 20 s, annealing and extension at 55°C for 60 s, for 27 cycles.

[0050] (3) Reading the fluorescence signal value of the PCR amplification product. After the PCR amplification cycle is completed, the fluorescence signal value is read using a fluorescence quantitative PCR instrument, and the genotyping results of the watermelon samples are obtained based on the fluorescence difference. If the genotype is homozygous A:A, it is determined to be a watermelon sample with shiny peel, represented by a blue square in the genotyping chart; if the genotype is homozygous T:T, it is determined to be a watermelon sample with dull peel, represented by an orange dot in the genotyping chart; if the genotype is heterozygous T:A, it is determined to be a watermelon sample with dull peel, represented by a green triangle in the genotyping chart.

[0051] 69 different watermelon samples were tested using primer Cla_27993083 to obtain genotyping patterns, as shown in the figure. Figure 2 The KASP test results of 69 watermelon samples are shown in Table 2.

[0052] Table 2 KASP test results of 69 watermelon samples

[0053]

[0054]

[0055]

[0056] As shown in Table 2, through the identification and screening using the primer combination Cla_27993083, the A:A fluorescent signal corresponding to primer Cla_27993083 was detected in the watermelon homozygous material with a glossy peel. The T:T fluorescent signal corresponding to primer Cla_27993083 was detected in the watermelon homozygous material with a dull peel. The T:A fluorescent signal was detected in the watermelon heterozygous material with a dull peel. Therefore, the genotyping results of the primer combination Cla_27993083 of the present invention fully matched the peel phenotype, with a detection accuracy of 100%, and can be applied to the rapid identification of the gloss trait of watermelon peel. Molecular marker screening significantly reduces the workload of visual screening and identification after fruit ripening, improves identification accuracy, and accelerates the breeding process.

[0057] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A KASP marker primer combination for detecting the glossiness of watermelon peel, characterized in that: The KASP marker primer combination includes an upstream primer 1, an upstream primer 2, and a downstream primer 1; the nucleotide sequence of the upstream primer 1 is shown in SEQ ID NO.1; the nucleotide sequence of the upstream primer 2 is shown in SEQ ID NO.2; and the nucleotide sequence of the downstream primer 1 is shown in SEQ ID NO.

3. When the KASP marker primer combination is used to detect the glossiness trait of watermelon peel, if the genotype is A:A, the watermelon peel is determined to be a homozygous individual plant with glossy fruit; if the genotype is T:T, the watermelon peel is determined to be a homozygous individual plant with dull fruit; and if the genotype is T:A, the watermelon peel is determined to be a heterozygous individual plant with dull fruit.

2. A method for identifying the glossiness of watermelon peel, characterized in that: The following steps are involved: Extracting genomic DNA of the watermelon to be identified; using the genomic DNA of the watermelon to be identified as a template, performing PCR amplification using the KASP marker primer combination of claim 1; identifying the genotype of the watermelon sample to be identified based on the difference in PCR fluorescence signals; the genotypes include A:A genotype, T:T genotype and T:A genotype; reading the value of the PCR fluorescence signal; if it is an A:A genotype, it is determined to be a homozygous individual plant with glossy watermelon rind; if it is a T:T genotype, it is determined to be a homozygous individual plant with matte watermelon rind; if it is a T:A genotype, it is determined to be a heterozygous individual plant with matte watermelon rind.

3. The method according to claim 2, characterized in that The PCR amplification system is: 2.5 μL 2×KASPmaster mix, 1.25 μL primer mix, and 1.25 μL DNA template; the primer mix is ​​a mixture of the upstream primer 1, the upstream primer 2, and the downstream primer 1 in a volume ratio of 1:1:

3.

4. The method according to claim 2, characterized in that The PCR amplification program was as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 20 s, annealing and extension at 61-55°C for 60 s, decreasing the temperature by 0.6°C per cycle, for 10 cycles; denaturation at 95°C for 20 s, annealing and extension at 55°C for 60 s, for 27 cycles.

5. Use of the KASP marker primer combination according to claim 1 in detecting the gloss trait of watermelon peel.

Images