A primer pair and method for identifying a new strain of Odetteria oosporei HCS
By designing a specific molecular marker primer pair Y6-F1/Y6-R2 and combining it with PCR amplification and gel electrophoresis, the problems of single strain and confusing identification of Agaricus oosporeus in the market were solved, and rapid and accurate HCS identification of strains was achieved.
Patent Information
- Application Number
- CN202411927344.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-25
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2044-12-25
AI Technical Summary
In the existing technology, the commercial strains of Agaricus oosporei on the market are single, with low yield and unstable quality, and the classification and identification are confusing. The traditional morphological methods are greatly affected by environmental factors, and the operations are cumbersome and the cycle is long.
A specific molecular marker primer pair Y6-F1/Y6-R2 was designed and used to identify a new strain of Odetteria oosporum HCS by PCR amplification and agarose gel electrophoresis, and its specific DNA fragment was used for rapid identification.
The rapid and accurate identification of Odetteria oospore HCS was achieved, the influence of environmental factors was reduced, the identification efficiency and accuracy were improved, and the errors of traditional methods were avoided.
Smart Images

Figure CN119530440B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of specific molecular markers, and in particular to a primer pair and a method for identifying a new strain of Odetteria oosporida HCS. Background Art
[0002] Oudemansiella raphanipes belongs to the class Agaricomycetes, order Agaricales, family Physalacriceae, genus Oudemansiella. It is also known as long root mushroom, long root money mushroom, dew chicken mushroom, etc. Because its appearance is similar to that of wild chicken mushroom and its color is black-brown, its commercial name is black-skinned chicken mushroom. Oudemansiella raphanipes has a crisp and tender taste, and its fruiting body is rich in protein, amino acids, polysaccharides, vitamin C, polyphenols and other ingredients. It has rich nutritional value. Its polysaccharides not only have strong antioxidant capacity, but also can prevent intestinal barrier damage. Petroleum ether extract can effectively inhibit the activity of plant pathogens. Because of its extremely high nutritional value and medicinal value, it is very popular among consumers and has great market potential.
[0003] Although industrial cultivation of Agaricus oosporeus has been achieved, the commercial strains available on the market are very limited, with low yields and inconsistent quality. This strain problem has greatly restricted the industrial development of Agaricus oosporeus. The phenomenon of "same name different species" and "same thing different names" in the market is serious, leading to great confusion in the classification and identification of Agaricus oosporeus.
[0004] Traditional classification and identification of edible fungi is primarily based on the morphological characteristics of their fruiting bodies. However, during their growth and development, edible fungi are susceptible to environmental factors such as temperature, light, humidity, and carbon dioxide concentration. Even within the same strain, morphological characteristics often vary to some extent under different environments. Traditional classification methods are no longer sufficient, and are cumbersome and time-consuming to perform. With the advancement of molecular biology, various molecular marker technologies have been gradually applied to the edible fungi field. The Inter-Simple Sequence Repeat (ISSR) marker, developed by Zietkeiwitcz et al. in 1994 based on the SSR (Simple Sequence Repeat) molecular marker technology, is a microsatellite-based molecular marker. It is now widely used in the identification of edible fungi germplasm resources, phylogenetic analysis, and DNA fingerprinting. Molecular markers are genetic markers based on nucleotide sequence variation within the genetic material of individuals and can directly reflect the genetic differences between species. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to provide a primer pair and method for identifying a new strain of Odetteria oosporei HCS in response to the deficiencies raised in the above background technology.
[0006] To solve the above technical problems, the present invention provides a technical solution as follows: the HCS deposit number of the new strain of Agaricus oosporus is CGMCC NO.41593; the primer pair is Y6-F1 / Y6-R2, the upstream primer sequence is: 5'-GCTTACTCTCGTGCGATGAAG-3'; the downstream primer sequence is: 5'-GAGGATAGTACACAGTGTGATGC-3',
[0007] A method for identifying a new strain of Odette mushroom HCS, comprising the following steps:
[0008] Step 1: extracting DNA from the Odette oospore strain to be tested;
[0009] Step 2: Using the DNA of the sample to be tested extracted in step 1 as the amplification template and the molecular specific labeled primers composed of the sequences shown in the primers as amplification primers, PCR amplification is performed;
[0010] Step 3: Perform agarose gel electrophoresis on the PCR product of step 2 to obtain the specific DNA fragment of strain HCS.
[0011] As an improvement, the specific extraction method of step 1 is: after the strain is activated, it is transferred to PDA culture medium, cultured in the dark at 24°C for 10 days, then the mycelium is scraped, DNA is extracted using a fungal DNA extraction kit, and stored at -20°C.
[0012] As an improvement, the amplification system in step 2 is: 2× Rapid Taq Master Mix 10 μL, 10 μmol / L primer 1 μL, DNA template 1 μL, ddH2O 8 μL, and the amplification program is 94°C pre-denaturation for 4 min, 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 60 s, 35 cycles, 72°C extension for 7 min, and storage at 4°C.
[0013] As an improvement, the electrophoresis in step three is to perform gel electrophoresis on the amplified product in step two through 1.5% agarose gel at 120V to obtain a specific DNA fragment of the strain HCS.
[0014] As an improvement, the nucleic acid sequence of the specific molecular marker amplified by the primer pair Y6-F1 / Y6-R2 is shown as SEQ ID NO.1.
[0015] After adopting the above structure, the present invention has the following advantages: 1. The specific molecular marker of Odetteria oospore HCS is simple, fast and accurate to operate, has a smaller error than traditional morphological identification, is not affected by environmental conditions, and is more intuitive.
[0016] 2. Based on the gene sequencing and bioinformatics analysis of Odetteria oospora, the present invention designed amplification primers for the Odetteria oospora strain HCS. The primers have strong specificity and can specifically amplify the DNA extracted from HCS to a 557bp fragment, while having no amplification effect on other Odetteria oospora strains. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 This is a schematic diagram of the ISSR-PCR amplification results of 12 Odetteria oosporea strains using the ISSR universal primer U880, a molecular marker method for specifically identifying Odetteria oosporea strain HCS.
[0018] Figure 2 Schematic diagram of the amplification results of the specific marker primer pair Y6-F1 / Y6-R2, which is a molecular marker for specifically identifying the HCS strain of Odetteria oosporea, in 12 Odetteria oosporea strains. DETAILED DESCRIPTION
[0019] The present invention is described in further detail below.
[0020] 1. Patent Name: A primer pair and method for identifying a new strain of Agaricus oosporus, HCS, whose nucleotide sequence is shown in SEQ ID NO. 1. Strain HCS is a high-yield and disease-resistant Agaricus oosporus strain obtained by isolation, purification, and domestication cultivation from wild Agaricus oosporus fruiting bodies collected from Yuelu Mountain in Changsha City, Hunan Province. Strain HCS has been deposited with the General Microbiology Center of the China Culture Collection Administration, Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, 100101, China, with a deposit number of CGMCC NO. 41593 and a deposit date of November 11, 2024.
[0021] 2. The present invention provides a primer pair for rapid identification of a new strain of Odetteria oosporum HCS, comprising an upstream primer SEQ ID NO. 2 and a downstream primer SEQ ID NO. 3.
[0022] SEQ ID NO.1:
[0023] GCTTACTCTCGTGCGATGAAGATATACGTTCTCGACTGTACAATAGTAAGTGGTGGCAGCGGCTGCAGCACCGCGTCTGG
[0024] AGACGCGTAACTCTCACGTGCCCGCTTCAGATAACCTCTTGGGGTTGCTACACCGCCCGCCGCGGCAAGAGACTCTCCTG
[0025] CACGGTCAAGTCATGGCTTCGCAGATAAGTCACACCAATTCTTGTGGCATCCGTCCACTGCGCACAGATTCGAATTCTTG
[0026] ATGGTGATGAGAAATCCGCGCCAGCTCCCCGGTACGAACATCCATCCATATGGCAGCGAATAGTAATACGTGCGGAAGAT
[0027] CCAAGGCCCAGAGTTGACGTCCAGCGCCAAACTGAGCTGGAAAAATCGGATGTTGGTAATAAGCAAATTAGAATCCGGAAA
[0028] GTATTCATTCACCCCCTAGATATCGTCCCGGCCCGCGCGCCACACCGACTGAGCCGTGTATCCGAATCCAATCAGACCCC
[0029] TTTCGTTCGTCCTCAAGGCATAATTGGGGGCGTTAATAACGCCCCCATCATCATGCATCACACTGTGTACTATCCTC;
[0030] SEQ ID NO.2: GCTTACTCTCGTGCGATGAAG;
[0031] SEQ ID NO.3: GAGGATAGTACACAGGTTGATGC;
[0032] SEQ ID NO.4: GGAGAGGAGAGGAGA;
[0033] The primer pair is Y6-F1 / Y6-R2, the upstream primer sequence is: 5'-GCTTACTCTCGTGCGATGAAG-3'; the downstream primer sequence is: 5'-GAGGATAGTACACAGTGTGATGC-3',
[0034] The Y6-F1 and Y6-R2 correspond to SEQ ID NO.2 and SEQ ID NO.3 respectively.
[0035] 3. The present invention provides a method for rapidly identifying Odetteria oosporei HCS, using primer pairs for identification.
[0036] The method comprises: extracting genomic DNA of the to-be-tested Odetteria oospora as a template, performing PCR amplification using upstream and downstream primers, and determining that the Odetteria oospora is HCS if the amplified product contains the specific molecular marker shown in 1.
[0037] The present invention also provides specific steps for using the molecular specific marker primers composed of the sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3 in identifying strain HCS:
[0038] Step 1: extracting DNA from the Odette oospore strain to be tested;
[0039] Step 2: Using the DNA of the sample to be tested extracted in step 1 as the amplification template, and using the molecular specific labeled primers composed of the sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3 as amplification primers, PCR amplification is performed;
[0040] Step 3: Perform agarose gel electrophoresis on the PCR product of step 2. If a 557 bp fragment appears in the electrophoresis result, the sample to be tested is strain HCS, otherwise it is not.
[0041] The nucleic acid sequence of the specific molecular marker amplified by the primer pair Y6-F1 / Y6-R2 is shown in SEQ ID NO.1. Specific embodiment:
[0043] 1. Test materials
[0044] The test strains were 12 strains of Agaricus oosporeus, as shown in Table 1. The parent of the new Agaricus oosporeus strain HCS was a wild Agaricus oosporeus fruiting body collected from Yuelu Mountain in Changsha City, Hunan Province on May 22, 2022. It was obtained through systematic domestication and selection and was deposited in the China General Microorganism Culture Collection Center (CGMCC) on November 11, 2024. The deposit number is CGMCC NO.41593, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.
[0045] Table 1 Test strains
[0046]
[0047] 2. Obtaining HCS-specific DNA fragments of Odetteria oosporeensis strains
[0048] (1) After activation, the 12 strains were transferred to PDA medium and cultured in the dark at 24°C for 10 days. Mycelia were scraped and DNA was extracted using a fungal DNA extraction kit and stored at -20°C.
[0049] (2) Thirty primers were randomly selected from 100 universal ISSR primers from Columbia University and screened using DNA from 12 strains as templates. Primer U880 (5'-GGAGAGGAGAGGAGA-3', SEQ ID NO. 4) was ultimately used for amplification. The amplification system consisted of 10 μL of 2× Rapid Taq Master Mix, 1 μL of 10 μmol / L primer, 1 μL of DNA template, and 8 μL of ddH2O. The amplification procedure was 35 cycles of pre-denaturation at 94°C for 4 min, denaturation at 94°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 120 s, and extension at 72°C for 7 min, followed by storage at 4°C.
[0050] (3) The amplified product was subjected to gel electrophoresis at 120V on 1.5% agarose gel and observed and photographed under a gel imager. The results are as follows: Figure 1 As shown (lanes 1-11 are H1-2, H1-4, HW, HCS, HP, HFZ, HDS, HY, HJD, HZW, HZH, and HGT, respectively), a specific DNA fragment of strain HCS was obtained.
[0051] 3. Design of specific molecular markers for strain HCS
[0052] (1) The specific DNA fragment of the obtained strain HCS was recovered by gel, cloned, and sequenced to obtain a specific sequence of 795 bp in length.
[0053] Method: Select Figure 1 The clear bands marked on the gel image were excised and purified, and the purified products were connected to the pEASY-T&BZero vector and transformed into Trans1-T1 competent cells. They were spread on LB solid medium containing AMP and cultured at 37°C overnight. Single colonies were picked and inoculated into LB liquid medium and cultured for 6-8 hours. After the bacterial solution was verified as a positive clone by primer amplification, fresh bacterial solution was used to sequence the vector insert fragment.
[0054] (2) Use Snapgene software to design specific primers for the obtained sequences, complete primer synthesis and sequencing of amplified products.
[0055] Obtain strain HCS molecular marker primers: Y6-F1 / Y6-R2
[0056] Y6-F1: 5'-GCTTACTCTCGTGCGATGAAG-3'
[0057] Y6-R2: 5'-GAGGATAGTACACAGGTTGATGC-3'
[0058] 4. Verification of specific molecular markers
[0059] PCR amplification was performed using DNA from 12 Odetteria oosporea strains as templates and primers Y6-F1 and Y6-R2. The amplification system consisted of 10 μL of 2× Rapid Taq Master Mix, 0.5 μL of each 10 μmol / L primer, 1 μL of DNA template, and 8 μL of ddH2O.
[0060] The amplification program was 94°C pre-denaturation for 4 min, 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 60 s, 35 cycles, 72°C extension for 7 min, and storage at 4°C.
[0061] The amplification results were detected by 1% agarose gel electrophoresis at a voltage of 120V. Figure 2 shown.
[0062] Depend on Figure 2 It can be seen that strain HCS can amplify a specific fragment of 557 bp in size, while other Odetteria oosporosa strains have no bands, which indicates that the specific molecular marker of Odetteria oosporosa strain HCS of the present invention has extremely high specificity and can be used for rapid identification of strain HCS among different strains of Odetteria oosporosa.
[0063] The above description of the present invention and its embodiments is non-limiting, and the actual structure is not limited thereto. In short, if a person skilled in the art is inspired by the above, and does not deviate from the purpose of the invention, without creatively designing a structure and embodiment similar to the technical solution, they shall fall within the scope of protection of the present invention.
Claims
1. A primer pair for identifying a new strain of Odetteria oosporei HCS, characterized in that: The HCS preservation number of the new Odette oospore strain is CGMCC NO.41593; the primer pair is Y6-F1 and Y6-R2, the nucleotide sequence of the upstream primer Y6-F1 is: 5'-GCTTACTCTCGTGCGATGAAG-3'; the nucleotide sequence of the downstream primer Y6-R2 is: 5'-GAGGATAGTACACAGTGTGATGC-3'.
2. A method for identifying the Odette oospore strain HCS, characterized in that: The following steps are involved: Step (1): extracting DNA from the Odette mushroom strain to be tested; Step (2): using the DNA of the sample to be tested extracted in step (1) as an amplification template and the primer pair Y6-F1 and Y6-R2 described in claim 1 as amplification primers, PCR amplification is performed; Step (3): Detect the PCR product of step (2) by agarose gel electrophoresis; The electrophoresis in step (3) is to perform gel electrophoresis on the amplified product in step (2) through 1%-1.5% agarose and 120V. If a 557bp fragment appears in the amplification result, it can be determined that the sample to be tested is the Odetteria oosporum strain HCS.
3. A method for identifying the Odette oospore strain HCS according to claim 2, characterized in that: The specific extraction method of step (1) is as follows: after the strain is activated, it is transferred to PDA culture medium, cultured in the dark at 24°C for 10 days, and then the mycelium is scraped, DNA is extracted using a fungal DNA extraction kit, and stored at -20°C.
4. A method for identifying the Odette oospore strain HCS according to claim 2, characterized in that: The amplification system in step (2) is as follows: 10 μL of 2× Rapid Taq Master Mix, 1 μL of each of the upstream and downstream primers at 10 μmol / L, 1 μL of DNA template, 8 μL of ddH2O, and the amplification program is 94°C pre-denaturation for 4 min, 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 60 s, 35 cycles, 72°C extension for 7 min, and storage at 4°C.
5. A method for identifying the Odette oospore strain HCS according to claim 2, characterized in that: The nucleic acid sequence of the specific molecular marker amplified by the primer pair Y6-F1 and Y6-R2 is shown in SEQ ID NO.1.
Citation Information
Patent Citations
Primer pair for identifying new sparassis crispa strain JSJ-Spar16-1 and identification method of new sparassis crispa strain JSJ-Spar16-1
CN117512201A